• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Hardisty roberts 190313_opt
 

Hardisty roberts 190313_opt

on

  • 165 views

Description of White Paper published in BMC Ecology

Description of White Paper published in BMC Ecology

Statistics

Views

Total Views
165
Views on SlideShare
165
Embed Views
0

Actions

Likes
0
Downloads
1
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Hardisty roberts 190313_opt Hardisty roberts 190313_opt Presentation Transcript

    • ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community** 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community*“We are drowning in information, while starving for wisdom. The world henceforth willbe run by synthesizers, people able to put together the right information at the righttime, think critically about it, and make important choices” E. O. Wilson, Harvard* 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community*“We are drowning in information, while starving for wisdom. The world henceforth willbe run by synthesizers, people able to put together the right information at the righttime, think critically about it, and make important choices” E. O. Wilson, Harvard Time to model all life on Earth.Purves et. al. (2013) Nature,493: 295-297* 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity A decadal view of biodiversity informatics: challenges and priorities Alex Hardisty, Dave Roberts, and the biodiversity informatics community* The Grand Challenge for Biodiversity Informatics An infrastructure to allow the available data to be brought into a coordinated coupled modelling environment, capable of addressing questions relating to our use of the natural environment, that captures the variety, distinctiveness and complexity of all life on Earth To achieve it we need: To build user confidence Integrative flexible e-Science environments Predictive models across multiple scales, coupled* 80 people took part in the open debate that led to this paper SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity1. Open Data should be normal practice;SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity1. Open Data should be normal practice; 2. Data encoding should allow analysis across multiple scales;SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity1. Open Data should be normal practice; 2. Data encoding should allow analysis across multiple scales; 3. Infrastructure projects should devote significant resources to market the service they develop;SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Didimosphenia geminata didymo Echinella geminata AAAAAGCTCGTAGTTGGATTTGTGATG Gomphonema vulgare Bréb. GAATTTGAATACTTTTAAAGTGTTCTAG AAACTGTCATCCGTGGGTGGAATTTGT TTGGCATTAGGTTGTCAGRCAGAGGATG CCTATMCTTTACTGTGAAAAAATCAGTG Didymosphenia CGTTCAAAGCAGACTTACGTCGATGAA geminata (Lyngbye) TGTATTAGCATGGAA TGTATTAG TATTAG TATT TT Schmidt 1899 Rock Snot D. geminata didymo Didymosphenia geminata (Lyngbye) Didymosphenia geminata Courtesy of ‘Linking Global Names and Pro-iBiosphere’, 2013, D. J. PattersonSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity 4. A list of taxon namesNames as strings of characters…Actinobacillus actimomycetemcomitans Difficulties with Latinized NamesActinobacillus actimycetemcomitansActinobacillus actinmycetemcomitans Transcription errorsActinobacillus actinomicetemcomitansActinobacillus actinomyActinobacillus actinomyce Actinobacillus actinomycetemcommitansActinobacillus actinomycemcomitans Actinobacillus actinomycetemocimitansActinobacillus actinomyceremcomitans Actinobacillus actinomycetencomitansActinobacillus actinomycetam Actinobacillus actinomycetumActinobacillus actinomycetamcomitans Actinobacillus actinomyctemcomitansActinobacillus actinomycetecomitans Actinobacillus actinomyectomcomitansActinobacillus actinomycetemcmitans Actinobacillus actinomyetemcomitansActinobacillus actinomycetemcomintans Actinobacillus actinonmycetemcomitansActinobacillus actinomycetemcomitance Actinobacillus actionomycetemcomitansActinobacillus actinomycetemcomitans Actinobacillus actynomicetemcomitansActinobacillus actinomycetemcomitants Actinobacillus antinomycetemcomitansNomenclator provides correct spelling. Indexing infrastructure resolves to it. Courtesy of Dave Remsen, GBIFSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual BiodiversityNames as strings of characters… 4. A list of taxon namesActinobacillus actimomycetemcomitans Difficulties with Latinized NamesActinobacillus actimycetemcomitansActinobacillus actinmycetemcomitans Transcription errorsActinobacillus actinomicetemcomitansActinobacillus actinomyActinobacillus actinomyce Actinobacillus actinomycetemcommitansActinobacillus actinomycemcomitans Actinobacillus actinomycetemocimitansActinobacillus actinomyceremcomitans Actinobacillus actinomycetencomitans 5. PersistentActinobacillus actinomycetam Actinobacillus actinomycetumActinobacillus actinomycetamcomitans Actinobacillus actinomyctemcomitansActinobacillus actinomycetecomitans Actinobacillus actinomyectomcomitansActinobacillus actinomycetemcmitansActinobacillus actinomycetemcomintans Actinobacillus actinomyetemcomitans Actinobacillus actinonmycetemcomitans IdentifiersActinobacillus actinomycetemcomitance Actinobacillus actionomycetemcomitansActinobacillus actinomycetemcomitans Actinobacillus actynomicetemcomitansActinobacillus actinomycetemcomitants Actinobacillus antinomycetemcomitansNomenclator provides correct spelling. Indexing infrastructure resolves to it. DOI: 10.4289/0013-8797.115.1.75SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual BiodiversityNames as strings of characters… 4. A list of taxon namesActinobacillus actimomycetemcomitans Difficulties with Latinized NamesActinobacillus actimycetemcomitansActinobacillus actinmycetemcomitans Transcription errorsActinobacillus actinomicetemcomitansActinobacillus actinomyActinobacillus actinomyce Actinobacillus actinomycetemcommitansActinobacillus actinomycemcomitans Actinobacillus actinomycetemocimitansActinobacillus actinomyceremcomitans Actinobacillus actinomycetencomitans 5. PersistentActinobacillus actinomycetam Actinobacillus actinomycetumActinobacillus actinomycetamcomitans Actinobacillus actinomyctemcomitansActinobacillus actinomycetecomitans Actinobacillus actinomyectomcomitansActinobacillus actinomycetemcmitansActinobacillus actinomycetemcomintans Actinobacillus actinomyetemcomitans Actinobacillus actinonmycetemcomitans IdentifiersActinobacillus actinomycetemcomitance Actinobacillus actionomycetemcomitansActinobacillus actinomycetemcomitans Actinobacillus actynomicetemcomitansActinobacillus actinomycetemcomitants Actinobacillus antinomycetemcomitansNomenclator provides correct spelling. Indexing infrastructure resolves to it. DOI: 10.4289/0013-8797.115.1.75 6. Author identifiersSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity 7. 3rd party authenticationSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Atopobium minutum 8. Classification Bank Sphaerobacter thermophilus strain TH3 Actinomycetes: the antibiotic factories Bifidobacteriaceae Actinomycetaceae Arthrobacteriaceae, Cellomonadaceae, Microbacteriaceae, Dermatophilaceae Insertion element and realtives in 23S rRNA Propionibacteriaceae Nocardioidaceae Frankiaceae Corynebacteriaceae, Mycobacteriaceae, Nocardiaceae and realtives Actinoplanaceae Pseudonocardiaceae Streptomycetaceae, Streptosporangiaceae and relatives Embley & Stackebrandt (1994) Bergey’s Manual, 2nd Edition (2012)SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity 9. Accepted names Dynamic Annual Home Edition Checklist Welcome to the Catalogue of Life website: gateway to our Overview database of the worlds known species of animals, plants, fungi About the Catalogue of Life and micro-organisms Contributors & partners Contact us I . P . N . I User Guide Explore » Getting started Versions of the Catalogue Contributing your data This Dynamic Edition is a constantly evolving version of the Catalogue of Life. Glossary The most comprehensive and Now tracking 70% of species known to science authoritative global index of Additional Services species currently available, the Downloads Advanced services 1,315,754 species Catalogue of Life consists of a single integrated checklist and taxonomic hierarchy for all the Latest on Twitter worlds species. Catalogue of Life catalogueoflife catalogueoflife Catalogue of Life, Annual Checklist » 11th March 2013 is now online at catalogueoflife.org/col 6 days ago · reply · retweet · favorite The Annual Checklist is a snapshot of the entire Catalogue of Life: a fixed imprint. catalogueoflife Catalogue of Life, 08th February 2013 is now online at catalogueoflife.org/col Why two versions? 37 days ago· reply · retweet · favorite Join the conversation © 2013, Species 2000 at University of Reading | Disclaimer Design: Chris Turnbull | Content: Simon Thornton-WoodSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity 10. Tools to make LOD Humans are good at interpreting this: Implicit semantics o “Compound 2a melted at 119 C” Machines need this: Explicit semantics CML Schema <cml:molecule ref=“2a”> <cml:property> Molecules in CML/InChl <cml:scalar dictRef=“prop:mpt” units=“units:celsius” propertyDictionary dataType=“xds:float” unitsDictionary >119</cml:scalar> </cml:property> W3CSchema </cml:molecule> 4 namespaces, 3 dictionariesSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Most textbooks will tell you that, in 1610, Galileo Galilei became the first person to observe Saturns rings. But what did he really see? GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. RobbinsSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity This? GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. RobbinsSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Or this? GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. RobbinsSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual BiodiversityThe generation ofimportant newinsights whilehandicapped withlimited technology,indirectmeasurement, andfuzzy data is themark of scientificgreatness. GBIF/GBIC – 2-4 Jul 2012 – Copenhagen, © 2012, R. J. Robbins SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity 11. Data fit for purpose Data are received at face-value, examined and tested. If the user is satisfied, then the data will be applied.SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity 12. Observational data infrastructure http://www.earthobservations.org/geobon.shtml http://www.eubon.eu http://www.teamnetwork.org http://mooreabiocode.org/ Moorea Biocode Project http://www.ilternet.eduhttp://www.neoninc.org Agriculture Climate Forest Invasion Urban Systems Change Management Biology EcosystemsSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity To build user confidence Thus far, all projects share a common problem of keeping services running after project funding ended New models are needed To create translational pipelines to industry adoption To encourage institutional adoption for care and maintenance For recognition of contribution other than through publication of academic papers Stronger marketing and outreach Invest more in up-skilling and hand-holdingSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Integrative flexible e-Science environments Using standardised building blocks and workflows Interoperable components With access to data from multiple sources Recognise different kinds of VRE General-purpose / specialised / single scientific objective - cf. chemistry laboratory vs forensics lab vs HIV vaccine lab - BioVeL / AquaMaps and iMarine / CarbonWaterCloud Must generate immediate benefit for users Science driven, with scientists as active participants in creation of infrastructure Functions people find useful: simple and intuitive Technology invisible (disappears into background)SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Predictive models across multiple scales A new framework of methods, techniques, standards to bring about interoperability of data and models across different biological scales From Genetic through species and ecosystem to landscape Learn from Virtual Physiological Human and from Numerical weather prediction and climatology Edwards (2010). A Vast Machine “General Ecological Models” Purves et al. (2013). doi:10.1038/493295a Evolvable to incorporate new scientific insights Re-analysis models Making data we have global Implies ‘inversion’ of existing infrastructure ‘inversion’ of existing infrastructure is about re-examining every element of data we have to re-construct the past biodiversity, as a guide and calibrator of models that can predict the futureSEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual BiodiversitySection 1: The fundamental backbone (getting the basics right) 1. Why are names important? 9. How to balance professional and non-professional 2. How are names organised? contributions 3. Which is the right name? 10. Engagement of users 4. What is the name of that organism? 11. Whos who? 5. Can biodiversity studies be done without names? 12. User identification 6. Biodiversity data beyond names 13. How do we ensure the right metadata are created 7. To link resources we need identifiers at the point of data generation? 8. Centralised or networked services? 14. Sustaining the physical infrastructureSection 2: The next steps15. Data Sharing 19. Beyond Sharing and Re-use: the problem of scale16. Why do we need vocabularies and ontologies? 20. How reliable are the data?17. How would Knowledge Organising Systems help? 21. What will the physical infrastructure look like?18. How easy is it to integrate data?Section 3: New tools22. How much of the legacy collections can be digitised? 27. How do you aggregate the data you need?23. How to generate more targeted and reliable data? 28. How complete are the data?24. What role do mobile devices play? 29. How can we encourage virtual research25. How do you find the data you need? environments?26. How do you extract the data you need? 30. What can you do with your data in the future?Section 4: The human interface31. How can we give users confidence?32. Who owns what?33. What benefits come to contributors? SEVENTH FRAMEWORK PROGRAMME -infrastructure
    • ViBRANT Virtual Biodiversity Thank you for your attention. Any questionsAlex Hardisty <hardistyAR@cardiff.ac.uk>Dave Roberts <dmr@nomencurator.org> Hardisty et al. (2013) A decadal view of biodiversity informatics: challenges and priorities. BMC Ecology (in press)http://www.slideshare.net/vibrantmanager/hardisty-roberts-190313opthttp://www.biovel.eu http://vbrant.euSEVENTH FRAMEWORK PROGRAMME -infrastructure