Dr. Stickle

757 views

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
757
On SlideShare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
4
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Dr. Stickle

    1. 1. Dr. Stickle an EST-Database
    2. 2. Dr. Stickle an EST-Database
    3. 3. The Goal
    4. 4. The Goal • Creating a pipeline for EST-Analysis
    5. 5. The Goal • Creating a pipeline for EST-Analysis • Displaying the results via an online framework
    6. 6. wtf is a pipeline?
    7. 7. Different steps of analysis performed in an automated fashion wtf is a pipeline?
    8. 8. wtf is a pipeline? Different steps of analysis performed in an automated fashion
    9. 9. Analysis:
    10. 10. ✓Assembly of EST-Reads into contigs ✓SNP-Detection MIRA But: ★Takes ages ★not well documented ★buggy
    11. 11. ✓Assembly of EST-Reads into contigs ✓SNP-Detection MIRA But: ★Takes ages ★not well documented ★buggy
    12. 12. ✓Assembly of EST-Reads into contigs ✓SNP-Detection MIRA But: ★Takes ages ★not well documented ★buggy
    13. 13. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
    14. 14. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
    15. 15. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
    16. 16. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
    17. 17. SNPs ORFs Contigs BLAST MIRA PFAM BLAST2GO
    18. 18. MIRA SNPs ORFs Contigs BLAST PFAM BLAST2GO
    19. 19. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
    20. 20. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
    21. 21. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
    22. 22. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
    23. 23. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
    24. 24. BLAST Basic Local Alignment Search Tool
    25. 25. BLAST Basic Local Alignment Search Tool
    26. 26. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database
    27. 27. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
    28. 28. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
    29. 29. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
    30. 30. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
    31. 31. Tools gene ontology Blast2GO mapping open reading frame ORF prediction PFAM domain annotation
    32. 32. Blast2GO
    33. 33. Tools gene ontology Blast2GO mapping open reading frame ORF prediction PFAM domain annotation
    34. 34. ORF
    35. 35. Tools gene ontology Blast2GO mapping open reading frame ORF prediction PFAM domain annotation
    36. 36. PFAM
    37. 37. Ugly *.ace-output generated via MIRA
    38. 38. What we‘ve got here:
    39. 39. What we‘ve got here: •Different tools •many different output-files
    40. 40. What we‘ve got here: •Different tools •many different output-files What we want: a structured database containing all the information
    41. 41. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
    42. 42. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
    43. 43. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
    44. 44. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
    45. 45. How to parse Data Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Script •read input •use parser •insert db Database
    46. 46. >abc_123 agtagtacgtacgtggacgtatgact >def_456 agtagtacgtacgtggacgtatgact
    47. 47. Summary & Results
    48. 48. Summary & Results •created the pipeline •analysed data •started filling the database
    49. 49. Summary & Results •created the pipeline •analysed data •started filling the database To be done •wait for MIRA •SNP-parser
    50. 50. thx to: •Marvin, for «time till scooter» and sending us to Lothar •Lothar, for providing always friendly and calm advice •Suse, for actually having used MIRA at least once •Andrew, for Andreas •Andreas, for Andrew •Bastien Chevreux, for not fixing those damn bugs in MIRA
    51. 51. k,thx,bai
    52. 52. Dr. Iglo
    53. 53. Dr. Iglo

    ×