Please help in writing these in OCaml functional programming language.docx

•Download as DOCX, PDF•

0 likes•2 views

Please help in writing these in OCaml functional programming language asap !!! takes three input lists of integers, each of which is assumed to be sorted. Their lengths are unimportant. It merges all three into a single sorted list of integers. The time complexity should be linear in the sum of the lengths of the three lists. Write a function called which will take one argument (a list of integers) and return the index of the smallest element (not the value!). The index is for the first element, for the second element, and so on. Note that we don't normally talk of "indices" for lists (as opposed to arrays, where we do), but we will do so here. If there is more than one copy of the smallest element, return the index of the first occurrence of the element in the list. Don't use higher-order list processing functions in this problem; just write a regular recursive list processing function. It can implement a recursive or iterative process as you see fit. Most especially, you are not allowed to call any sorting functions in this function (such as the function in the OCaml standard libraries). If the input list is empty, raise an exception with a meaningful error message. The easiest way to do this is to call the function with the error message; it will raise the exception for you. .

Education

Similar to Please help in writing these in OCaml functional programming language.docx

searching

Rajendran

Csallner algorithms1

seshagiri rao

Provide the implementations and signatures for the following operations (functions) for our previous modeling of lists as Cartesians. A. Length of a list (len function): This function returns the number of elements that a list contains. B. Index set of a list (inds function): The set of indices of the elements in the list, from 1 to and including the length of the list. If the list is empty the index set is the empty set. C. Element set (elems function): This function returns the set of distinct elements of the list. If the list is empty then the element set is empty. D. The list indexing operation l(i), where if the list is empty then the operation is undefined, i.e. ends in the result chaos. Hint: As discussed in the class, a list can be modeled using Cartesians as in the following. Hint: As discussed in the class, a list can be modeled using Cartesians as in the following..

Provide the implementations and signatures for the following operati.pdf

alsofshionchennai

FINAL revised LIST in Python.pdf

SanjayChoudhary270270

Python for loop

Aishwarya Deshmukh

Notes3

hccit

Python revision tour II

Mr. Vikram Singh Slathia

Python Tutorial Part 1

Haitham El-Ghareeb

Chapter 4 algorithmic efficiency handouts (with notes)

mailund

CS 107 – Introduction to Computing and Programming – Spring 2013 Homework Assignment 7 ( Draft 3.0 - Hopefully Final ) Fun with Linked Lists Due: Monday 29 April at 8:00 A.M. Optional hard copy may be turned in to TA during lab. Overall Assignment For this assignment, you are to write a program that reads in sentences character-by-character, creates a linked list out of the character stream, and then performs various operations on the resulting list(s). Node Structure The linked list node that you create for this assignment shall be named “node”, and shall have at a minimum the following fields: struct node { char c; int sequence, totalSequence; struct node * next; }; where:  The char c is a character read in from the keyboard.  sequence is the original position of this character within the sentence, starting from 1. I.e. the first character in the sentence will have sequence 1, the second 2, etc.  totalSequence is the same idea as sequence, but the numbers are since the program started. So for example, if the first sentence read contains 20 characters, ( not counting the newline character ), then the first character of the second sentence would have a sequence number of 1, but a totalSequence number of 21. Program Operation After reporting your name and explaining to the user what the program does, your program should do the following: 1. Ask the user to enter a sentence. 2. Read the characters one-by-one, until the newline character ( ‘\n’ ) is read in. For each character read in: A. Create a new node, using dynamic allocation ( malloc ), and fill in the node fields. B. Add the node to the beginning of a linked list for this sentence. 3. Once the sentence is stored in a linked list, give the user a list of operations supported, ( see below ) and allow them to choose which one(s) to perform. Based upon their choice, use a switch to perform the operation requested and print out the results. 4. Two choices on the list must be to quit the program and to read in the next sentence. In the latter case the current sentence must be either deleted or added to a linked list of past sentences. 5. Repeat from step 1 until the user enters "done". Note that this test should be case-insensitive. 6. Print overall summary statistics, such as number of characters and sentences processed. Required Functions  void print( struct node *head ); o This function prints out the characters of the linked list, in the order of the list. o Note: Printing the sentence as the linked list is originally created will print backwards from what the user entered, because of the way that the linked list is created. o Alternate: For all functions, if you use typedef to create a type “node”, then you can use that defined type instead of “struct node”. o Skills: Traversing a linked list. Also, printing is always needed.  void printReversed( struct node *head ); o This function prints.

CS 107 – Introduction to Computing and Programming – Spring 20.docx

faithxdunce63732

Anton Kasyanov, Introduction to Python, Lecture4

Anton Kasyanov

Erlang kickstart

Ryan Brown

Ch 1 intriductions

irshad17

Functional programming

Bas Bossink

MODULE-2.pptx

ASRPANDEY

easyPy-Basic.pdf

Mina Firoozgohar

in python Purpose The purpose of this assignment is to give you practice with writing loops and introduce you to lists. Problem Write a program that receives a series of numbers from the user and allows the user to press the Enter key to indicate that inputs are done. As each number is input, it is stored into a list. After the user presses the Enter key (i.e., they enter nothing as input), the program should do the following: - If the list has no elements, just prints "Empty List". - If the list has at least one element, you must print: The total number of items in the list The list itself sorted in ascending order. The sum of all the elements in the lis. The average of the elements in the list. The largest value in the list. The smallest value in the list. The first half of the list. (If the list has an odd number of elements, you can exclude the middle element. For example, if there are 5 elements, just print the first 2 .) Each individual list element. You must use a loop to iterate through the list to print each element, and each element must be separated by a tab character (t). Inputs Any input other than a number or the Enter key should be caught using an exception with an appropriate error message and the program should continue seeking input. Comments Make sure your code is sufficiently commented! In this casse, you'll want to include your name and denote where input is collected, where errors are handled, and where the various list calculations occur. Hint for stopping input An easy way to capture whether the Enter key was pressed or not is to initially accept the input as a string. and then convert it to integer, all within a Try block: try: input string = input("Enter a Number.") number = int(input string) If it causes an exception, in your except clause you can check for cither the value of the input_string variable to be an empty string (which is two double quotes without anything in it) or the length of the string being zero (the function len can be used). If it's not an empty string but invalid input (like nonnumeric input) you must continue to seck input after a proper error message. .

in python Purpose The purpose of this assignment is to give you practi.docx

MichaelQEBMartinc

tupple.pptx

satyabratPanda2

you will implement some sorting algorithms for arrays and linked lists. Insertion Sort and Quicksort of an array Implement the insertion sort and quicksort for an integer array. The functions are defined in the "sorting.h" header file. /** * @brief Insertion sort algorithm * @param array Array to be sorted. The array is modified in place. * @param lowindex Lowest index of the array * @param highindex Highest index of the array * @param reversed If reversed = true, the array should be sorted in descending order, otherwise in ascending order */ void insertionSort(int array[], int lowindex, int highindex, bool reversed = false); and ** * @brief Quick sort algorithm * * @param array Array to be sorted. The array is modified in place. * @param lowindex Lowest index of the array * @param highindex Highest index of the array * @param reversed If reversed = true, the array should be sorted in descending order, otherwise in ascending order */ void quickSort(int array[], int lowindex, int highindex, bool reversed = false); The array should be sorted in place. Compared to the examples in the textbook, those functions have an additional parameter reversed. If reversed = true, the array should be sorted in descending order, otherwise in ascending order. You should complete the implementations of those two functions in the "sorting_basic.cpp" file. A better quicksort algorithm Quicksort is a very fast comparison sorting algorithm, especially wheb the array or list gets large. However, when the arrays/lists are small enough, quicksort may run slower than some of the (n^2) algorithms. This might not seem important until you note that when sorting a large array with quicksort, many small sublists must be sorted. While the savings on sorting one small list with a faster algorithm might be negligible, sorting hundreds of small lists with a faster algorithm can make a difference in the overall efficiency of the sort. For this part of the assignment, you will combine quicksort with another sorting algorithm to build a faster sorting algorithm. One option is to use quicksort until the array/list gets small enough, and then use insertion sort or another sort to sort the small arrays/lists What does "small enough" mean? You can try a percentage of the list (say, 5% or 10%), or an absolute number (5 elements, 8 elements, 10 elements, 15 elements, 100 elements, etc), or something else of your choosing. Based on your tests, choose the one that is the most efficient. You should also tests to ensure that your hybrid quicksort has reasonable performance on all lists -- most notably, it should be efficient on sorted and inverse sorted lists as well as random lists. The definition of the hybrid quicksort function is as the following: /** * @brief A hybrid of insertion sort and quick sort algorithm. The algorithm is based on the idea that if the array is short, it is better to use insertion sort. * It uses quicksort until the list gets small enough, and then uses insertion s.

you will implement some sorting algorithms for arrays and linked lis.pdf

clearvisioneyecareno

Real World Haskell: Lecture 3

Bryan O'Sullivan

Similar to Please help in writing these in OCaml functional programming language.docx (20)

searching

Csallner algorithms1

Provide the implementations and signatures for the following operati.pdf

FINAL revised LIST in Python.pdf

Python for loop

Notes3

Python revision tour II

Python Tutorial Part 1

Chapter 4 algorithmic efficiency handouts (with notes)

CS 107 – Introduction to Computing and Programming – Spring 20.docx

Anton Kasyanov, Introduction to Python, Lecture4

Erlang kickstart

Ch 1 intriductions

Functional programming

MODULE-2.pptx

easyPy-Basic.pdf

in python Purpose The purpose of this assignment is to give you practi.docx

tupple.pptx

you will implement some sorting algorithms for arrays and linked lis.pdf

Real World Haskell: Lecture 3

More from kathrynj2

Please solve h- where it asks to record the payment of interest on bon.docx

kathrynj2

Please Show Work! 1. Mendel did experiments where he kept track of the color of the flowers. First, he created two true breeding lines ( F 0 parental generation): parents with purple flowered pea plants produced offspring with purple flowered pea plants, and parents with white flowered pea plants produced offspring with white flowered pea plants. When he crossed purple with white flowered pea plants from these true-breeding lines, all of the offspring were purple. Answer the following questions, label them A-I. A. What is the gene coding for in this example (what traits are we looking at)? B. What are the two alleles and what do they represent (provide the letters, dominant/recessive and colors? C. What percentage of plants in the F 1 generation (also called First generation offspring) are white? D. What is the phenotype of the F 1 generation? E. When members of the F 1 generation are crossed what is the resulting genotypic ratio? F. If the plants are crossed 2000 times from the F 1 generation how many would be white? G. What is the phenotypic ratio of the F 2 generation? H . What would be the genotypic ratio if members of the F 1 generation are backcrossed with individuals from the true white flowered breeding line called F 0 generation? I. If this was done 4000 times how many of the plants would be purple? You must show all your work .

Please Show Work! 1- Mendel did experiments where he kept track of the.docx

kathrynj2

Please help. Thank you in advance. You have just completed a simulation in which you attempted to construct a random sample that was representative of your chosen population using EPSEM techniques. The issues you encountered are similar to those that social scientists have to deal with on a regular basis: the integrity of the experiment depends on a random and representative sample. How well can you answer the following question? Why is a "random sample" not random in the popular sense of the word? What is another term social scientists use for these kinds of samples? .

Please help- Thank you in advance- You have just completed a simulatio.docx

kathrynj2

Please help write a Python script that will take any text dataset and augment it in some way to expand the dataset. Possibilities include synonym replacement, which replaces words with words that mean the same thing, random inserts, swaps, and deletions, among others. Submission must include a script that will augment any text dataset within its folder. Please include a sample un-augmented dataset with your submission. .

Please help write a Python script that will take any text dataset and.docx

kathrynj2

Please help with the following questions- What is the total debt ratio.docx

kathrynj2

Please Help Need ASAP JAVA Write a class named Food with the following specifications: Name the class Food Create the following instance variables: String name, double weight, and String taste Create a constructor that will be blank Create another constructor that will take in three arguments: name, weight and taste . Use the this keyword to assign the instance variables values based on the arguments passed in by the constructor. HINT: public Food(String name, int weight, String taste) Create an accessor (aka get) and a mutator (aka set) method which will get and set the weight and taste instance variables of the Food class. (Total of 4 methods) Create a method called "public String data()". This method will return a String which will contain the name, weight, and taste of the fruit. .

Please Help Need ASAP JAVA Write a class named Food with the followin.docx

kathrynj2

Please help using data in second photo. Thank you Identify the main domains found in SARS-CoV-2 protein. List the name of the domain, a brief summary of its function and the interval range (which positions in the linear amino acid sequence is it found). You can click on the ( + ) sign on the left-hand side of each row to expand the information in the table. >SARS-COV-2 ATGTTTGITTTTCTTGTTITATTECCACTAGTCICTAGTCAGTGIGITAATCTTACAACCAGAACTCAATTACC CCCTGCATACACTAATTCTTTCACACGTGGTGITTATTACCCTGACAAAGITTCAGATCCTCAGTITTACATT CAACTCAGGACTTGTTCITACCTITCTTTTCCAATGITACTIGGTTCCATGCTATACATGTCTCTGGGACCAAT GGTACTAAGAGGTITGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGTTCCACTGAGAAGTCTAA CATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTIATTGITAATAACGCTA CTAATGTTGTTATTAAAGTCTGTGAATTCAATTTTGTAATGATCCATTTTTGGGTGTTAATTACCACAAAAAC AACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTAITCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA GCCTITTCTTATGEACCTTGAAGGAAAACAGGGTAATTTCAMANACTTAGGGAATTTGTGITTAAGAATATTG ATGGTTAITTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGITTTTCGGCT TTAGAACATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGITCAAACTTTACTTGCTTTACATAGAAG TTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAAC CTAGGACITTTCTATTAAAATATAATGAAMATGGAACCATTACAGATGCTGIAGACTGTGCACITGACCCICTC TCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCA ACCAACAGAATCTAITGTTAGATTTCCTAATATTACAAACTGTGCCCTTTTGGIGAAGTTTTTAACGCCACCA GATTTECATCTGITTATGCTTGGAACAGGARGAGMATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAAT TCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAMATTAAATGATCTCTCCTTTACTAATGT CIATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAMATCGCTCCAGGGCAAACTGCAAAGATTGCIG ATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCITGGAATTCTAACAATCTTGATTCTAAG GTTGGTGGTAATTATAATTACCTGIATAGAITGTITAGGAAGTCTAATCTCAAMCCTTTTGAGAGAGATATTTC AACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGITTAATTGTTACTTTCCTTTACAAT CATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTA CATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAMAACAAATGTGTCAATTFCAACIT CAATGGTTTAACAGGCACAGGTGITCTTACTGAGTCTAACAAAAAITTCTCCCTITCCAACAATTTGCCAGAG ACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGAITCYTGACATTACACCATGIRCIITT GGTGGTGICAGTGTTATAACACCAGGAACAMTACITCTAACCAGGITGCTGITCTITATCAGGATGTTAACTG CACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTCGCGIGITFATTCTACAGGTTCZANG TITTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCMACAACTCA TATGAGTGTGACATACCCATT GGTGCAGGIATATGCGCTAGTTAICAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGICAATC CATCATTGCCTACACTATGTCACTTGGTGCAGAAAATYCAGTTGCTTACICTAA GAACTCTATTGCCATACCCA CAAATTTTACTATTAGTGTTACCACAGAATTCTACCAGTGTCTATGACCMAGACATCAGTAGATTGTACMAFG TGCTITAACTGGAATAGCTGTTGAACAAGACAMAACACCCMGMAGITTTTGCACAAGTCAAACARATIACA AAACACCACCAATTAAAGATTTTGGTGGTTTTAAIT TTTCACAAATATTACCAGATCCATCAAAACCAAGCAAG AGGTCATTTATTGAGATCTACTTTTCAACAAAGIGACAC'RGCAGATGCTGGCTTCAICAAACAATA TGOTGA TTGCCTTGGTGATATTGCTGCTAGAGACCTCATITGTGCACAAAGTJTACGGCCITACTGITITGCCACCTT TGCTCACAGATGAAATGATIGCTCAATACACTTCTGCACTGITAGCGGGZACMATCACTICTGGITGGACCTIT GGTGCAGGTGCTG.

Please help using data in second photo- Thank you Identify the main d.docx

kathrynj2

please help me to do this - how I can do this- Homework- Install two V.docx

kathrynj2

please help me to asnwer all the question. It Biologh 212 thank you! MULTIPLE CHOICE QUESTION A presynaptic neuron releases a neurotransmitter that causes the postsynaptic neuron to open K + channels in its plasma membrane. What will this cause? EPSP, depolarization EPSP, hyperpolarization IPSP, hyperpolarization IPSP, depolarization Speaking of action potentials... What was the last phase in a neuronal action potential and why was it important? depolarization AND it excites the cell repolarization AND it returns the cell to a resting state hyperpolarization AND it excites the cell repolarization AND it helps to keep the action potential moving one way hyperpolarization AND it helps to keep the action potential moving one way depolarization AND it helps to keep the action potential moving one way depolarization AND it returns the cell to a resting state .

please help me to asnwer all the question- It Biologh 212 thank you!.docx

kathrynj2

Please help me draw this chart The City of Lethbridge has decided to build a botanical garden and picnic area in the heart of the city for the recreation of its citizens. The precedence table for all the actlvitles required to construct this area successfully is as follows: Refer to the legend for the activity that corresponds to each code. (Make each activity siart as soon as possible.) Using the line drawing tool, draw a Gantt chart for activities E through I of the project. .

Please help me draw this chart The City of Lethbridge has decided to b.docx

kathrynj2

please show all work Assume we are using the simple model for floating.docx

kathrynj2

please help esp on the first one 3. Bacteriophages have lytic and lysogenic life cycles- what are some advantages ( + 2 ) and disadvantages ( + 2 ) of each cycle for the phage? 4. Briefly list 4 ways of detecting a virus and describe how each of them work ( + 6 ) 5. Why should a human not be worried about a bacteriophage in their food? ( + 2 ) 6. What are two ways that a virus can manage to maintain a persistent infection? ( + 2 ) 7. Do retroviruses carry reverse transcriptase genes, or do the host? Explain why its necessary ( + 2 ) 8. Name 3 ways that viruses can be transmitted ( L 2 ) .

please help esp on the first one 3- Bacteriophages have lytic and lys.docx

kathrynj2

Please review the Trade agreement between the North American Countries of the USA, Canada & Mexico. Prior to July 2020, these countries had NAFTA as their trade agreement. In 2018, the 3 countries signed a new agreement which took effect on July 1 st , 2020. - Please review the changes that new trade agreement has brought. - Give information on how the trade has affected. - End the review paper with your projections on how trade will look between these 3 countries in the next 10 years. However, use appropriate resources to support your opinions. - Include, if any, amendments you would make to the trade agreement, and give your reason why. .

Please review the Trade agreement between the North American Countries.docx

kathrynj2

Please provide 1 explanation and 1 example for each of the points above in terms of creating value for business - Projects produce value via: - Creating a new product, service, or result that meets the needs of customers or end users; - Creating positive social or environmental contributions; - Improving efficiency, productivity, effectiveness, or responsiveness; - Enabling the changes needed to facilitate organizational transition to its desired future state; and - Sustaining benefits enabled by previous programs, projects, or business operations. .

Please provide 1 explanation and 1 example for each of the points abov.docx

kathrynj2

PLEASE PROVIDE ME WITH DETAILED INFORMATION ON A RESEARCH INTERESTS F.docx

kathrynj2

Please place the following events in transcription in the correct order. Pank the options below. ANA polymerase binds to the promoter region just upstream of the gene. Transcription continues until a terminator site in the DNA is reached. The mRNA transcript is released. RNA polymerase unwinds the DNA at the promoter site and begins to transcribe the template strand of DNA. RNA polymerase moves along the template strand of DNA adding complementary RNA nucleotides, extending the mRNA. .

Please place the following events in transcription in the correct orde.docx

kathrynj2

please match the processes below with the correct description Match th.docx

kathrynj2

Please look up the Terri Schiavo case I. Introduction: Describe the provided case, including information on the stakeholders involved, the bioethical issue, and the time period of the incident that occurred. II. Bioethical Analysis: Analyze the bioethical issue for the role end-of-life issues played in the case. Be sure to use appropriate terminology and support with secondary research. III. Conclusion: Describe how the bioethical issue influenced the decisions of healthcare professionals involved in the case. Be sure to use specific examples. .

Please look up the Terri Schiavo case I- Introduction- Describe the p.docx

kathrynj2

More from kathrynj2 (18)