The document summarizes key concepts of object-oriented programming in Perl. It provides an overview of objects and inheritance, demonstrates converting a module to an object-oriented structure, and shows an example of implementing inheritance with a Machine class and Refrigerator subclass. The example outputs show objects can call methods from both the parent and child classes, highlighting how inheritance works.
Have Your Cake and Eat It Too: Meta-Programming Techniques for JavaHoward Lewis Ship
The document discusses meta-programming in Java using bytecode manipulation libraries like ASM. It describes how ASM works by allowing the reading, modification, and writing of Java bytecode. This enables dynamically rewriting classes by adding, removing, or modifying fields and methods at runtime. The document provides an example of using ASM to add a private field to a class. It also discusses how meta-programming techniques can be used to implement features like aspect-oriented programming and dynamic proxies in Java.
The document discusses the Combined Public Key (CPK) cryptosystem used in OpenSolaris. CPK provides identity-based encryption and signature schemes as an alternative to traditional public key infrastructure. It maps identities to key pairs using a hash function and private/public key matrices. CPK interfaces with the Solaris cryptographic and key management frameworks using standards like PKCS #11 and PKCS #7.
Embedding Languages Without Breaking ToolsLukas Renggli
Domain-specific languages (DSLs) are increasingly used as embedded languages within general-purpose host languages. DSLs provide a compact, dedicated syntax for specifying parts of an application related to specialized domains. Unfortunately, such language extensions typically do not integrate well with the development tools of the host language. Editors, compilers and debuggers are either unaware of the extensions, or must be adapted at a non-trivial cost. We present a novel approach to embed DSLs into an existing host language by leveraging the underlying representation of the host language used by these tools. Helvetia is an extensible system that intercepts the compilation pipeline of the Smalltalk host language to seamlessly integrate language extensions. We validate our approach by case studies that demonstrate three fundamentally different ways to extend or adapt the host language syntax and semantics.
The document discusses using the Java Content Repository (JCR) specification and REST web services to build non-CMS web applications that access content in a flexible and standardized way. It provides an overview of JCR and how the Apache Sling framework uses JCR and REST to easily create dynamic websites and applications using content from a JCR-compliant repository without the need for server-side programming. Code snippets are included that demonstrate performing basic CRUD operations on content from a JCR repository using RESTful URLs and JavaScript.
This document introduces JCR (JSR-170 and JSR-283), including:
1. An overview of JSR-170 and the development of JCR 1.0.
2. Details about JCR 2.0 such as backwards compatibility, reorganization, and new features like access control management, retention policies, and versioning.
3. Descriptions of implementations of JCR standards like Apache Jackrabbit and frameworks built on top of it like Apache Sling.
This document provides a summary of key XML Schema components and their attributes. It defines elements such as <schema>, <element>, <complexType>, <simpleType>, <attribute>, <group> and <attributeGroup>. For each element, it lists important attributes like id, name, type and more. It also summarizes common XML Schema facets for constraining values like length, pattern, enumeration and others.
The document discusses evaluating how advanced techniques for splitting identifiers impact the performance of feature location techniques. It describes using different identifier splitting algorithms, such as CamelCase, Samurai, and a manually developed "perfect" splitting algorithm, within information retrieval and dynamic feature location techniques. The study compares the effectiveness of these feature location techniques when using different splitting algorithms using four software systems and associated datasets involving features and bugs. Results are presented using box plots to compare the median and average effectiveness across all data points for each technique and dataset.
CIS14: Developing with OAuth and OIDC ConnectCloudIDSummit
David Chase, Ping Identity
Exploring the implementation and architecture of OAuth and OpenID Connect, using web and mobile applications, with topics including grant types, choosing a grant type, refresh tokens, and managing sessions
Have Your Cake and Eat It Too: Meta-Programming Techniques for JavaHoward Lewis Ship
The document discusses meta-programming in Java using bytecode manipulation libraries like ASM. It describes how ASM works by allowing the reading, modification, and writing of Java bytecode. This enables dynamically rewriting classes by adding, removing, or modifying fields and methods at runtime. The document provides an example of using ASM to add a private field to a class. It also discusses how meta-programming techniques can be used to implement features like aspect-oriented programming and dynamic proxies in Java.
The document discusses the Combined Public Key (CPK) cryptosystem used in OpenSolaris. CPK provides identity-based encryption and signature schemes as an alternative to traditional public key infrastructure. It maps identities to key pairs using a hash function and private/public key matrices. CPK interfaces with the Solaris cryptographic and key management frameworks using standards like PKCS #11 and PKCS #7.
Embedding Languages Without Breaking ToolsLukas Renggli
Domain-specific languages (DSLs) are increasingly used as embedded languages within general-purpose host languages. DSLs provide a compact, dedicated syntax for specifying parts of an application related to specialized domains. Unfortunately, such language extensions typically do not integrate well with the development tools of the host language. Editors, compilers and debuggers are either unaware of the extensions, or must be adapted at a non-trivial cost. We present a novel approach to embed DSLs into an existing host language by leveraging the underlying representation of the host language used by these tools. Helvetia is an extensible system that intercepts the compilation pipeline of the Smalltalk host language to seamlessly integrate language extensions. We validate our approach by case studies that demonstrate three fundamentally different ways to extend or adapt the host language syntax and semantics.
The document discusses using the Java Content Repository (JCR) specification and REST web services to build non-CMS web applications that access content in a flexible and standardized way. It provides an overview of JCR and how the Apache Sling framework uses JCR and REST to easily create dynamic websites and applications using content from a JCR-compliant repository without the need for server-side programming. Code snippets are included that demonstrate performing basic CRUD operations on content from a JCR repository using RESTful URLs and JavaScript.
This document introduces JCR (JSR-170 and JSR-283), including:
1. An overview of JSR-170 and the development of JCR 1.0.
2. Details about JCR 2.0 such as backwards compatibility, reorganization, and new features like access control management, retention policies, and versioning.
3. Descriptions of implementations of JCR standards like Apache Jackrabbit and frameworks built on top of it like Apache Sling.
This document provides a summary of key XML Schema components and their attributes. It defines elements such as <schema>, <element>, <complexType>, <simpleType>, <attribute>, <group> and <attributeGroup>. For each element, it lists important attributes like id, name, type and more. It also summarizes common XML Schema facets for constraining values like length, pattern, enumeration and others.
The document discusses evaluating how advanced techniques for splitting identifiers impact the performance of feature location techniques. It describes using different identifier splitting algorithms, such as CamelCase, Samurai, and a manually developed "perfect" splitting algorithm, within information retrieval and dynamic feature location techniques. The study compares the effectiveness of these feature location techniques when using different splitting algorithms using four software systems and associated datasets involving features and bugs. Results are presented using box plots to compare the median and average effectiveness across all data points for each technique and dataset.
CIS14: Developing with OAuth and OIDC ConnectCloudIDSummit
David Chase, Ping Identity
Exploring the implementation and architecture of OAuth and OpenID Connect, using web and mobile applications, with topics including grant types, choosing a grant type, refresh tokens, and managing sessions
M A R A T H I A S M I T A D R S H R I N I W A S K A S H A L I K A Rdrsolapurkar
This document discusses the nature of personal identity and how it relates to broader concepts of humanity. It argues that while initial identities like family, culture and nationality are important, as one gains awareness they must be able to rise above restrictive identities and see common bonds with all humanity. Sacrificing physical or sectarian interests for the benefit of mankind is a sign of growth. True self is realized not by denying identities but transcending limitations to identify with the interests of all people regardless of affiliations.
El documento describe diferentes tipos de investigación como básica, aplicada, experimental, proyectiva e histórica. También discute el proceso de autoformación a través de sistemas expertos, inteligencia artificial, agromática, realidad virtual, telematica y bioinformatica. Finalmente, ofrece experiencias y recomendaciones sobre apoyo investigativo y desplazamiento diferencial de motores.
Studi di settore. Le novità introdotte dal decreto legge n. 81 del 2 luglio 2...gianlkr
CIRCOLARE N. 5
Direzione Centrale Accertamento
Roma, 23 gennaio 2008
Oggetto: Studi di settore. Le novità introdotte dal decreto legge n. 81 del 2 luglio 2007 e dalla legge finanziaria per il 2008.
This document describes how to use Alfredo PUMEX to add customizable fields to the SugarCRM Users module in a modular way without overwriting core files. PUMEX uses jQuery to dynamically extend the Users module functionality. It includes JavaScript files that insert custom HTML into the detail and edit views. Server-side PHP scripts then retrieve and save any custom field data. This allows third-party modules to customize the Users module in a standardized way without conflicting with each other or requiring patches on SugarCRM upgrades.
Yoga integrates the right and left cerebral cortex, or right and left brain. The inability to see unity across different fields and paths is due to a deficiency in developing and integrating the right and left brain, leading to sectarianism and injustice. Even an intelligent person can be antisocial without balancing left brain development with right brain integration.
This document provides a help and tutorial for TopStyle Pro version 3.11. It covers getting started with TopStyle, editing style sheets and HTML/XHTML, working with colors, previews, validation, site management, reports, mappings, customization, and third-party integration. It also includes appendices on CSS basics and tips, TopStyle tips and tricks, style sheet resources, keyboard shortcuts, and regular expressions.
TopStyle Help & <b>Tutorial</b>tutorialsruby
This document provides a table of contents for the TopStyle Pro Help & Tutorial, which teaches how to use the TopStyle software for editing style sheets and HTML/XHTML documents. It lists over 50 sections that provide explanations and instructions for features like creating and opening files, editing styles, working with colors, previews, validation, site management, reports and customizing the software. The document was created by Giampaolo Bellavite from the online help provided with TopStyle version 3.11.
The Art Institute of Atlanta IMD 210 Fundamentals of Scripting <b>...</b>tutorialsruby
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers for applications and researchers. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
Standardization and Knowledge Transfer – INS0tutorialsruby
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers and a flexible model. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation by defining rules for tags. CSS rules are defined in external style sheets to keep presentation separate from structure and content.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation through rules that target specific XHTML elements.
This document discusses how to create and use external cascading style sheets (CSS) in Dreamweaver. It provides steps to:
1. Open the CSS Styles tab in Dreamweaver and create a new external CSS stylesheet using a sample text style.
2. Save the stylesheet and link it to a new HTML page to style elements like headings, text sizes, and boxes.
3. Edit existing styles by selecting a tag in the CSS Styles panel and modifying properties directly, or by clicking the tag and using the pencil icon to edit in a window. This allows customizing styles globally across all linked pages.
This document provides an overview of how to create and use cascading style sheets (CSS) in Dreamweaver. It describes the different types of style sheets, including external and internal style sheets. It outlines the steps to create an external style sheet in Dreamweaver using the CSS Styles panel and provides instructions for linking the external style sheet to an HTML page. The document demonstrates how to experiment with predefined styles and how to edit, add, and delete styles in the CSS stylesheet.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using the bulletin board for questions.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on topics like TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using bulletin boards, and includes images related to these topics.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables adapting appearance for different devices. The document provides examples of using CSS classes to style template elements and explains how to set up a demo system using the included CSS and templates.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables customization of appearance for different devices. The document provides examples of how to apply CSS classes and rules to Corvid template elements to control fonts, colors, positioning and more.
M A R A T H I A S M I T A D R S H R I N I W A S K A S H A L I K A Rdrsolapurkar
This document discusses the nature of personal identity and how it relates to broader concepts of humanity. It argues that while initial identities like family, culture and nationality are important, as one gains awareness they must be able to rise above restrictive identities and see common bonds with all humanity. Sacrificing physical or sectarian interests for the benefit of mankind is a sign of growth. True self is realized not by denying identities but transcending limitations to identify with the interests of all people regardless of affiliations.
El documento describe diferentes tipos de investigación como básica, aplicada, experimental, proyectiva e histórica. También discute el proceso de autoformación a través de sistemas expertos, inteligencia artificial, agromática, realidad virtual, telematica y bioinformatica. Finalmente, ofrece experiencias y recomendaciones sobre apoyo investigativo y desplazamiento diferencial de motores.
Studi di settore. Le novità introdotte dal decreto legge n. 81 del 2 luglio 2...gianlkr
CIRCOLARE N. 5
Direzione Centrale Accertamento
Roma, 23 gennaio 2008
Oggetto: Studi di settore. Le novità introdotte dal decreto legge n. 81 del 2 luglio 2007 e dalla legge finanziaria per il 2008.
This document describes how to use Alfredo PUMEX to add customizable fields to the SugarCRM Users module in a modular way without overwriting core files. PUMEX uses jQuery to dynamically extend the Users module functionality. It includes JavaScript files that insert custom HTML into the detail and edit views. Server-side PHP scripts then retrieve and save any custom field data. This allows third-party modules to customize the Users module in a standardized way without conflicting with each other or requiring patches on SugarCRM upgrades.
Yoga integrates the right and left cerebral cortex, or right and left brain. The inability to see unity across different fields and paths is due to a deficiency in developing and integrating the right and left brain, leading to sectarianism and injustice. Even an intelligent person can be antisocial without balancing left brain development with right brain integration.
This document provides a help and tutorial for TopStyle Pro version 3.11. It covers getting started with TopStyle, editing style sheets and HTML/XHTML, working with colors, previews, validation, site management, reports, mappings, customization, and third-party integration. It also includes appendices on CSS basics and tips, TopStyle tips and tricks, style sheet resources, keyboard shortcuts, and regular expressions.
TopStyle Help & <b>Tutorial</b>tutorialsruby
This document provides a table of contents for the TopStyle Pro Help & Tutorial, which teaches how to use the TopStyle software for editing style sheets and HTML/XHTML documents. It lists over 50 sections that provide explanations and instructions for features like creating and opening files, editing styles, working with colors, previews, validation, site management, reports and customizing the software. The document was created by Giampaolo Bellavite from the online help provided with TopStyle version 3.11.
The Art Institute of Atlanta IMD 210 Fundamentals of Scripting <b>...</b>tutorialsruby
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers for applications and researchers. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
Standardization and Knowledge Transfer – INS0tutorialsruby
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers and a flexible model. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation by defining rules for tags. CSS rules are defined in external style sheets to keep presentation separate from structure and content.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation through rules that target specific XHTML elements.
This document discusses how to create and use external cascading style sheets (CSS) in Dreamweaver. It provides steps to:
1. Open the CSS Styles tab in Dreamweaver and create a new external CSS stylesheet using a sample text style.
2. Save the stylesheet and link it to a new HTML page to style elements like headings, text sizes, and boxes.
3. Edit existing styles by selecting a tag in the CSS Styles panel and modifying properties directly, or by clicking the tag and using the pencil icon to edit in a window. This allows customizing styles globally across all linked pages.
This document provides an overview of how to create and use cascading style sheets (CSS) in Dreamweaver. It describes the different types of style sheets, including external and internal style sheets. It outlines the steps to create an external style sheet in Dreamweaver using the CSS Styles panel and provides instructions for linking the external style sheet to an HTML page. The document demonstrates how to experiment with predefined styles and how to edit, add, and delete styles in the CSS stylesheet.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using the bulletin board for questions.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on topics like TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using bulletin boards, and includes images related to these topics.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables adapting appearance for different devices. The document provides examples of using CSS classes to style template elements and explains how to set up a demo system using the included CSS and templates.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables customization of appearance for different devices. The document provides examples of how to apply CSS classes and rules to Corvid template elements to control fonts, colors, positioning and more.
The document provides an introduction to CSS and how it works with HTML to control the presentation and styling of web page content. It explains basic CSS concepts like selectors, properties and values, and how CSS rules are used to target specific HTML elements and style them. Examples are given of common CSS properties and selectors and how they can be used to style elements and format the layout of web pages.
The document introduces CSS and how it works with HTML to separate content from presentation, allowing the styling of web pages through rules that target HTML elements. It explains CSS syntax and various selectors like type, class, ID, and descendant selectors. Examples are provided of how CSS can be used to style properties like color, font, padding, and layout of elements on a page.
Cascading Style Sheets (CSS) allow users to define how HTML elements are presented on a page. CSS enables changing the appearance and layout of an entire website by editing just one CSS file. CSS uses selectors to apply styles to HTML elements via properties and values. Styles can be defined internally in HTML or externally in CSS files. CSS can control text formatting, colors, spacing, positioning and more to achieve visual consistency across web pages.
Cascading Style Sheets (CSS) allow users to define how HTML elements are presented on a page. CSS enables changing the appearance and layout of an entire website by editing just one CSS file. CSS uses selectors to apply styles to HTML elements via properties and values. Styles can be defined internally in HTML or externally in CSS files. CSS can control text formatting, colors, spacing, positioning and more to achieve visual consistency across web pages.
Fueling AI with Great Data with Airbyte WebinarZilliz
This talk will focus on how to collect data from a variety of sources, leveraging this data for RAG and other GenAI use cases, and finally charting your course to productionalization.
Freshworks Rethinks NoSQL for Rapid Scaling & Cost-EfficiencyScyllaDB
Freshworks creates AI-boosted business software that helps employees work more efficiently and effectively. Managing data across multiple RDBMS and NoSQL databases was already a challenge at their current scale. To prepare for 10X growth, they knew it was time to rethink their database strategy. Learn how they architected a solution that would simplify scaling while keeping costs under control.
[OReilly Superstream] Occupy the Space: A grassroots guide to engineering (an...Jason Yip
The typical problem in product engineering is not bad strategy, so much as “no strategy”. This leads to confusion, lack of motivation, and incoherent action. The next time you look for a strategy and find an empty space, instead of waiting for it to be filled, I will show you how to fill it in yourself. If you’re wrong, it forces a correction. If you’re right, it helps create focus. I’ll share how I’ve approached this in the past, both what works and lessons for what didn’t work so well.
Ivanti’s Patch Tuesday breakdown goes beyond patching your applications and brings you the intelligence and guidance needed to prioritize where to focus your attention first. Catch early analysis on our Ivanti blog, then join industry expert Chris Goettl for the Patch Tuesday Webinar Event. There we’ll do a deep dive into each of the bulletins and give guidance on the risks associated with the newly-identified vulnerabilities.
Driving Business Innovation: Latest Generative AI Advancements & Success StorySafe Software
Are you ready to revolutionize how you handle data? Join us for a webinar where we’ll bring you up to speed with the latest advancements in Generative AI technology and discover how leveraging FME with tools from giants like Google Gemini, Amazon, and Microsoft OpenAI can supercharge your workflow efficiency.
During the hour, we’ll take you through:
Guest Speaker Segment with Hannah Barrington: Dive into the world of dynamic real estate marketing with Hannah, the Marketing Manager at Workspace Group. Hear firsthand how their team generates engaging descriptions for thousands of office units by integrating diverse data sources—from PDF floorplans to web pages—using FME transformers, like OpenAIVisionConnector and AnthropicVisionConnector. This use case will show you how GenAI can streamline content creation for marketing across the board.
Ollama Use Case: Learn how Scenario Specialist Dmitri Bagh has utilized Ollama within FME to input data, create custom models, and enhance security protocols. This segment will include demos to illustrate the full capabilities of FME in AI-driven processes.
Custom AI Models: Discover how to leverage FME to build personalized AI models using your data. Whether it’s populating a model with local data for added security or integrating public AI tools, find out how FME facilitates a versatile and secure approach to AI.
We’ll wrap up with a live Q&A session where you can engage with our experts on your specific use cases, and learn more about optimizing your data workflows with AI.
This webinar is ideal for professionals seeking to harness the power of AI within their data management systems while ensuring high levels of customization and security. Whether you're a novice or an expert, gain actionable insights and strategies to elevate your data processes. Join us to see how FME and AI can revolutionize how you work with data!
Monitoring and Managing Anomaly Detection on OpenShift.pdfTosin Akinosho
Monitoring and Managing Anomaly Detection on OpenShift
Overview
Dive into the world of anomaly detection on edge devices with our comprehensive hands-on tutorial. This SlideShare presentation will guide you through the entire process, from data collection and model training to edge deployment and real-time monitoring. Perfect for those looking to implement robust anomaly detection systems on resource-constrained IoT/edge devices.
Key Topics Covered
1. Introduction to Anomaly Detection
- Understand the fundamentals of anomaly detection and its importance in identifying unusual behavior or failures in systems.
2. Understanding Edge (IoT)
- Learn about edge computing and IoT, and how they enable real-time data processing and decision-making at the source.
3. What is ArgoCD?
- Discover ArgoCD, a declarative, GitOps continuous delivery tool for Kubernetes, and its role in deploying applications on edge devices.
4. Deployment Using ArgoCD for Edge Devices
- Step-by-step guide on deploying anomaly detection models on edge devices using ArgoCD.
5. Introduction to Apache Kafka and S3
- Explore Apache Kafka for real-time data streaming and Amazon S3 for scalable storage solutions.
6. Viewing Kafka Messages in the Data Lake
- Learn how to view and analyze Kafka messages stored in a data lake for better insights.
7. What is Prometheus?
- Get to know Prometheus, an open-source monitoring and alerting toolkit, and its application in monitoring edge devices.
8. Monitoring Application Metrics with Prometheus
- Detailed instructions on setting up Prometheus to monitor the performance and health of your anomaly detection system.
9. What is Camel K?
- Introduction to Camel K, a lightweight integration framework built on Apache Camel, designed for Kubernetes.
10. Configuring Camel K Integrations for Data Pipelines
- Learn how to configure Camel K for seamless data pipeline integrations in your anomaly detection workflow.
11. What is a Jupyter Notebook?
- Overview of Jupyter Notebooks, an open-source web application for creating and sharing documents with live code, equations, visualizations, and narrative text.
12. Jupyter Notebooks with Code Examples
- Hands-on examples and code snippets in Jupyter Notebooks to help you implement and test anomaly detection models.
Northern Engraving | Nameplate Manufacturing Process - 2024Northern Engraving
Manufacturing custom quality metal nameplates and badges involves several standard operations. Processes include sheet prep, lithography, screening, coating, punch press and inspection. All decoration is completed in the flat sheet with adhesive and tooling operations following. The possibilities for creating unique durable nameplates are endless. How will you create your brand identity? We can help!
HCL Notes und Domino Lizenzkostenreduzierung in der Welt von DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-und-domino-lizenzkostenreduzierung-in-der-welt-von-dlau/
DLAU und die Lizenzen nach dem CCB- und CCX-Modell sind für viele in der HCL-Community seit letztem Jahr ein heißes Thema. Als Notes- oder Domino-Kunde haben Sie vielleicht mit unerwartet hohen Benutzerzahlen und Lizenzgebühren zu kämpfen. Sie fragen sich vielleicht, wie diese neue Art der Lizenzierung funktioniert und welchen Nutzen sie Ihnen bringt. Vor allem wollen Sie sicherlich Ihr Budget einhalten und Kosten sparen, wo immer möglich. Das verstehen wir und wir möchten Ihnen dabei helfen!
Wir erklären Ihnen, wie Sie häufige Konfigurationsprobleme lösen können, die dazu führen können, dass mehr Benutzer gezählt werden als nötig, und wie Sie überflüssige oder ungenutzte Konten identifizieren und entfernen können, um Geld zu sparen. Es gibt auch einige Ansätze, die zu unnötigen Ausgaben führen können, z. B. wenn ein Personendokument anstelle eines Mail-Ins für geteilte Mailboxen verwendet wird. Wir zeigen Ihnen solche Fälle und deren Lösungen. Und natürlich erklären wir Ihnen das neue Lizenzmodell.
Nehmen Sie an diesem Webinar teil, bei dem HCL-Ambassador Marc Thomas und Gastredner Franz Walder Ihnen diese neue Welt näherbringen. Es vermittelt Ihnen die Tools und das Know-how, um den Überblick zu bewahren. Sie werden in der Lage sein, Ihre Kosten durch eine optimierte Domino-Konfiguration zu reduzieren und auch in Zukunft gering zu halten.
Diese Themen werden behandelt
- Reduzierung der Lizenzkosten durch Auffinden und Beheben von Fehlkonfigurationen und überflüssigen Konten
- Wie funktionieren CCB- und CCX-Lizenzen wirklich?
- Verstehen des DLAU-Tools und wie man es am besten nutzt
- Tipps für häufige Problembereiche, wie z. B. Team-Postfächer, Funktions-/Testbenutzer usw.
- Praxisbeispiele und Best Practices zum sofortigen Umsetzen
How to Interpret Trends in the Kalyan Rajdhani Mix Chart.pdfChart Kalyan
A Mix Chart displays historical data of numbers in a graphical or tabular form. The Kalyan Rajdhani Mix Chart specifically shows the results of a sequence of numbers over different periods.
Discover top-tier mobile app development services, offering innovative solutions for iOS and Android. Enhance your business with custom, user-friendly mobile applications.
Digital Banking in the Cloud: How Citizens Bank Unlocked Their MainframePrecisely
Inconsistent user experience and siloed data, high costs, and changing customer expectations – Citizens Bank was experiencing these challenges while it was attempting to deliver a superior digital banking experience for its clients. Its core banking applications run on the mainframe and Citizens was using legacy utilities to get the critical mainframe data to feed customer-facing channels, like call centers, web, and mobile. Ultimately, this led to higher operating costs (MIPS), delayed response times, and longer time to market.
Ever-changing customer expectations demand more modern digital experiences, and the bank needed to find a solution that could provide real-time data to its customer channels with low latency and operating costs. Join this session to learn how Citizens is leveraging Precisely to replicate mainframe data to its customer channels and deliver on their “modern digital bank” experiences.
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...Alex Pruden
Folding is a recent technique for building efficient recursive SNARKs. Several elegant folding protocols have been proposed, such as Nova, Supernova, Hypernova, Protostar, and others. However, all of them rely on an additively homomorphic commitment scheme based on discrete log, and are therefore not post-quantum secure. In this work we present LatticeFold, the first lattice-based folding protocol based on the Module SIS problem. This folding protocol naturally leads to an efficient recursive lattice-based SNARK and an efficient PCD scheme. LatticeFold supports folding low-degree relations, such as R1CS, as well as high-degree relations, such as CCS. The key challenge is to construct a secure folding protocol that works with the Ajtai commitment scheme. The difficulty, is ensuring that extracted witnesses are low norm through many rounds of folding. We present a novel technique using the sumcheck protocol to ensure that extracted witnesses are always low norm no matter how many rounds of folding are used. Our evaluation of the final proof system suggests that it is as performant as Hypernova, while providing post-quantum security.
Paper Link: https://eprint.iacr.org/2024/257
Skybuffer SAM4U tool for SAP license adoptionTatiana Kojar
Manage and optimize your license adoption and consumption with SAM4U, an SAP free customer software asset management tool.
SAM4U, an SAP complimentary software asset management tool for customers, delivers a detailed and well-structured overview of license inventory and usage with a user-friendly interface. We offer a hosted, cost-effective, and performance-optimized SAM4U setup in the Skybuffer Cloud environment. You retain ownership of the system and data, while we manage the ABAP 7.58 infrastructure, ensuring fixed Total Cost of Ownership (TCO) and exceptional services through the SAP Fiori interface.
AppSec PNW: Android and iOS Application Security with MobSFAjin Abraham
Mobile Security Framework - MobSF is a free and open source automated mobile application security testing environment designed to help security engineers, researchers, developers, and penetration testers to identify security vulnerabilities, malicious behaviours and privacy concerns in mobile applications using static and dynamic analysis. It supports all the popular mobile application binaries and source code formats built for Android and iOS devices. In addition to automated security assessment, it also offers an interactive testing environment to build and execute scenario based test/fuzz cases against the application.
This talk covers:
Using MobSF for static analysis of mobile applications.
Interactive dynamic security assessment of Android and iOS applications.
Solving Mobile app CTF challenges.
Reverse engineering and runtime analysis of Mobile malware.
How to shift left and integrate MobSF/mobsfscan SAST and DAST in your build pipeline.
Programming Foundation Models with DSPy - Meetup SlidesZilliz
Prompting language models is hard, while programming language models is easy. In this talk, I will discuss the state-of-the-art framework DSPy for programming foundation models with its powerful optimizers and runtime constraint system.
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor IvaniukFwdays
At this talk we will discuss DDoS protection tools and best practices, discuss network architectures and what AWS has to offer. Also, we will look into one of the largest DDoS attacks on Ukrainian infrastructure that happened in February 2022. We'll see, what techniques helped to keep the web resources available for Ukrainians and how AWS improved DDoS protection for all customers based on Ukraine experience
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
perl_objects
1. Object Oriented Perl Overview
Review of references... example from hash of
hashes
Overview of why use objects (again)
Brian O'Connor Simple example, convert Lincoln's module to an
UCLA object-oriented module
boconnor@ucla.edu
What are objects really?
Inheritance
Simple inheritance example from Simon's code
The Long Way
Hash of Hashes Review
This is the long
(perhaps clearer)
Hash_1
$hash_ref value
way...
key (hash_ref) Hash_2
*
GeneA * key value
seq ccta...
GeneB *
length 67
GeneC *
gc% 52%
2. The Long Way
If we dump $data, which is a hashref, we get Hash of Hashes Review
the following:
$VAR1 = { Hash_1
'GeneC' => { $hash_ref value
'length' => 10, key (hash_ref) Hash_2
'gc' => '0.5',
*
'seq' => 'cccggattat' GeneA * key value
},
'GeneB' => { seq ccta...
'length' => 10,
'gc' => '0.5',
GeneB *
'seq' => 'cccggattat' length 67
},
'GeneA' => {
GeneC *
'length' => 10, gc% 52%
'gc' => '0.5',
'seq' => 'cccggattat'
}
};
The Short Way The Short Way
Compare that with the way I showed you You can see the structure produced is the same:
yesterday:
$VAR1 = {
'GeneC' => {
'length' => 10,
'gc' => '0.5',
'seq' => 'cccggattat'
},
'GeneB' => {
'length' => 10,
'gc' => '0.5',
'seq' => 'cccggattat'
},
'GeneA' => {
'length' => 10,
'gc' => '0.5',
'seq' => 'cccggattat'
}
};
3. Why Objects Why Object Oriented Perl?
Small App Small App
Small App
MONOLITHIC vs. Obj 1 Obj 3 Obj 1 Obj 3
Obj 2 Small App Obj 2
Look Inside an Object Modules vs. Objects
First, let's convert Lincoln's MySequence module
Obj1
from an earlier lecture to an object-oriented
module
method_1
The difference is pretty clear:
Data
method_2 modules let you import variables and subroutines into
your current program when you say “use”
method_3
objects are encapsulated, you get a reference to one
(usually using “new”) and call methods on them
directly
4. The Original Module Code to Call MySequence
the subroutines in this module are now available
in your code
Exporter
What we
export
Works as You Expect Conflicts
By saying use MySequence; all the subroutines What happens when you have conflicts for
and data MySequence exports is available within subroutines or variables?
your program
[boconnor@dhcp10-51 module]$ perl test.pl
original = gattccggatttccaaagggttcccaatttggg
complement = cccaaattgggaaccctttggaaatccggaatc
5. Conflicts
The Object Oriented Way
What happens when you have conflicts for
subroutines or variables?
Let's recode this as an object-oriented module
[boconnor@dhcp10-51 module]$ perl test.pl
Avoids pollution of your namespace
HI!! Key terms
original = gattccggatttccaaagggttcccaatttggg
complement = 1 abstraction
encapsulation
The new subroutine interferes with the
MySequence subroutine
Recall from Yesterday Recall from Yesterday
How to create an object from an Object Oriented How to then call methods on that object...
Module...
#!/usr/bin/perl -w $sequence->subseq(1,40);
use strict; $sequence->id();
use Bio::PrimarySeq; $sequence->desc();
my $sequence = Bio::PrimarySeq->new(
-seq => 'gattaca',
-id => 'oligo234',
-alphabet => 'dna'
);
6. The Original Module The Object Oriented Module
Need to When you make a method
call on an OO Module the
eliminate the first argument is the class
Exporter
code
Need to
include a
“new”
method
The Object Oriented Module The Object Oriented Module
You create a new hash bless associates this new
reference ($self) and this bit of memory with a class
will store all the objects type (i.e. package to call
data methods with)
7. What Does bless Mean? What Does bless Mean?
an example... in the debugger
an example...
$obj = { name => 'mini', color =>
$obj = { name => 'mini', color => 'yellow' };
'yellow' }; x $obj
print ref($obj), “ ”, $obj->{name}, “n”;
bless ($obj, “Fruit::Banana”); Fruit::Banana=HASH(0x8ec7980)
print ref($obj), “ ”, $obj->{name}, “n”; 'color' => 'yellow'
'name' => 'mini'
HASH mini
Fruit::Banana mini What is an object then? A
hashref that stores data and is
associated with a package
The Object Oriented Module The Object Oriented Module
The object is now created
and returned to the
program that called new.
When called in an object
context the object is
automatically passed in at
the first argument
8. What is $self? Code to Call MySequence
the actual object you're calling this method from Let's take a look at the code that uses the new OO
allows you to manipulate the data within that MySequence module
specific object instance (it's just a hashref)
compare this to new() and other method calls
like it
Output is Identical! Why Object Oriented Perl?
Identical output to the previous version
Small App
[boconnor@dhcp10-51 oo_module]$ perl test.pl Small App
original = gattccggatttccaaagggttcccaatttggg
complement = cccaaattgggaaccctttggaaatccggaatc
Obj 1 Obj 3
And you can create your own reversec subroutine log log
and not have it conflict with the MySequence Obj 2
Small App
method! log
9. Inheritance Inheritance
In this example every object has a log()
method Independent parent Base
& Redundant log
Wouldn't it be nice to only write this once?
becomes
Solution: Inheritance! Obj 1
log child Obj 1 Obj 2
Obj 2
log Neither actually
implements a log
method
More Generally Simon's Example: The Machines!
Let's take a look at the implementation of the
superclass Fruit name, color, shape
following hierarchy
isa
isa
Machine voltage
name, color, shape,
subclass Grape Banana peel
isa
isa
Think of Banana inherits voltage voltage
Refrigerator ATM
inheritance as an name, color & temp cash
“isa” relationship shape
banana adds peel
10. Simon's Example: The Machines! Simon's Example: The Machines!
We want to implement Machine and Refrigerator The means that we can create a Refrigerator
so that Machine defines the voltage() method object and call either voltage() or temp()
and Refrigerator defines the temp() method on it
Machine voltage Machine voltage
isa
isa
isa
isa
voltage voltage voltage voltage
Refrigerator ATM Refrigerator ATM
temp cash temp cash
Let's Start with test.pl Let's Start with test.pl
“use” what you want Always include a method to
to create before you create a new object.
call new Call it using this OOP syntax.
* differs from calling Machine::Refrigerator::new()
11. The Refrigerator The Refrigerator
Recall, the Refrigerator
needs to do 2 things for magic
the client:
get/set a temperature
get/set a voltage magic
The Refrigerator The Refrigerator
This says, use the Machine, as the root
“Machine” module class, handles the
as a base class. creation and
Everything a initialization of the
Machine can do so object via its new
can a Refrigerator. method. This is how
you call it.
12. The Machine
The Refrigerator
Call new() to Create a Refrigerator
magic
It returns a new object
of type
Machine::Refrigerator!!
magic
The Machine The Machine
Call new() to Create a Refrigerator Call new() to Create a Refrigerator
so the object ($self) is just
a reference to an empty
hash! Just like in the
How does it become a MySequence example,
Machine::Refrigerator? the bless command
associates a hashref with
a class
(Machine::Refrigerator
in this case)
13. The Refrigerator Finish back at test.pl
$r (a Machine::Refrigerator)
has both the voltage()
method (from Machine) and it's
Finish setting up own temp() method
Refrigerator
specific information
and return the new
object $self
Look at the Output Lessons
You can call both temp() and voltage() on When you call a method this way:
the $r object which is of type
Machine::Refrigerator->new(
Machine::Refrigerator temp => 20,
voltage => 110 );
my $self = $class->SUPER::new(@_);
[boconnor@dhcp10-51]$ perl test.pl
Start temp: 20
Start voltage: 110 The first var is a string of the class (package)
New temp: 45 name you're calling on... In both cases it's
“Machine::Refrigerator”
14. Lessons Lessons
When you call a method this way (through an The returned object is a bit of memory (a hashref)
object): associated with a given class and it's methods
$r->temp();
Here's a dump in the debugger of the $r object:
The first var is a reference to the object itself so
you can get/set data within it... it's just a
“blessed” hashref! DB<2> x $r
Machine::Refrigerator=HASH(0x94e3bd8)
sub temp { 'temp' => 20
my $self = shift;
'voltage' => 110
...
}
So Now You... For More Information
Can use references Perl Cookbook, Programming Perl
Can use other people's objects perlobj and perlref man pages
Can create objects of your own Google
Can create complex object trees through Simon's Object Tutorial, try implementing the
inheritance ATM class