SlideShare a Scribd company logo
Esquema
TruSeq small RNA
5' R1====================> 3'
_RA5______________________ _RA3_________________
_RP1______________________________________________
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC INSERTO TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC[NNNNNNN]TCTCGTATGCCGTCTTCTGCTTG
TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAG ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG[NNNNNNN]AGAGCATACGGCAGAAGACGAAC
___________________________________________________________01IPR_
ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG ATCGAAT AGAGCATACGGCAGAAGACGAAC
___________PTS_
TTGCACCACCTTAAG 5' 5'
< |||||
CCCGTGG 3'
_______
* STP oligo forms a stem loop and one end of the stem loop anneals to the 3' adapter oligo and inhibits further ligation.

More Related Content

More from Daniel Guariz Pinheiro

Anotação Gênica Funcional
Anotação Gênica FuncionalAnotação Gênica Funcional
Anotação Gênica Funcional
Daniel Guariz Pinheiro
 
Predição Gênica
Predição GênicaPredição Gênica
Predição Gênica
Daniel Guariz Pinheiro
 
Montagem de Genomas
Montagem de GenomasMontagem de Genomas
Montagem de Genomas
Daniel Guariz Pinheiro
 
NexteraXTpe
NexteraXTpeNexteraXTpe
MiSeq Genomic Schema
MiSeq Genomic SchemaMiSeq Genomic Schema
MiSeq Genomic Schema
Daniel Guariz Pinheiro
 

More from Daniel Guariz Pinheiro (6)

Anotação Gênica Funcional
Anotação Gênica FuncionalAnotação Gênica Funcional
Anotação Gênica Funcional
 
Predição Gênica
Predição GênicaPredição Gênica
Predição Gênica
 
Montagem de Genomas
Montagem de GenomasMontagem de Genomas
Montagem de Genomas
 
NexteraXTpe
NexteraXTpeNexteraXTpe
NexteraXTpe
 
Illumina-truseq-paired-end
Illumina-truseq-paired-endIllumina-truseq-paired-end
Illumina-truseq-paired-end
 
MiSeq Genomic Schema
MiSeq Genomic SchemaMiSeq Genomic Schema
MiSeq Genomic Schema
 

Recently uploaded

CACJapan - GROUP Presentation 1- Wk 4.pdf
CACJapan - GROUP Presentation 1- Wk 4.pdfCACJapan - GROUP Presentation 1- Wk 4.pdf
CACJapan - GROUP Presentation 1- Wk 4.pdf
camakaiclarkmusic
 
The basics of sentences session 5pptx.pptx
The basics of sentences session 5pptx.pptxThe basics of sentences session 5pptx.pptx
The basics of sentences session 5pptx.pptx
heathfieldcps1
 
Digital Artifact 1 - 10VCD Environments Unit
Digital Artifact 1 - 10VCD Environments UnitDigital Artifact 1 - 10VCD Environments Unit
Digital Artifact 1 - 10VCD Environments Unit
chanes7
 
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
Levi Shapiro
 
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Dr. Vinod Kumar Kanvaria
 
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO PerspectiveAdvantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
Krisztián Száraz
 
S1-Introduction-Biopesticides in ICM.pptx
S1-Introduction-Biopesticides in ICM.pptxS1-Introduction-Biopesticides in ICM.pptx
S1-Introduction-Biopesticides in ICM.pptx
tarandeep35
 
The approach at University of Liverpool.pptx
The approach at University of Liverpool.pptxThe approach at University of Liverpool.pptx
The approach at University of Liverpool.pptx
Jisc
 
1.4 modern child centered education - mahatma gandhi-2.pptx
1.4 modern child centered education - mahatma gandhi-2.pptx1.4 modern child centered education - mahatma gandhi-2.pptx
1.4 modern child centered education - mahatma gandhi-2.pptx
JosvitaDsouza2
 
How libraries can support authors with open access requirements for UKRI fund...
How libraries can support authors with open access requirements for UKRI fund...How libraries can support authors with open access requirements for UKRI fund...
How libraries can support authors with open access requirements for UKRI fund...
Jisc
 
Thesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.pptThesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.ppt
EverAndrsGuerraGuerr
 
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdfMASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
goswamiyash170123
 
Best Digital Marketing Institute In NOIDA
Best Digital Marketing Institute In NOIDABest Digital Marketing Institute In NOIDA
Best Digital Marketing Institute In NOIDA
deeptiverma2406
 
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
Academy of Science of South Africa
 
Digital Artifact 2 - Investigating Pavilion Designs
Digital Artifact 2 - Investigating Pavilion DesignsDigital Artifact 2 - Investigating Pavilion Designs
Digital Artifact 2 - Investigating Pavilion Designs
chanes7
 
Francesca Gottschalk - How can education support child empowerment.pptx
Francesca Gottschalk - How can education support child empowerment.pptxFrancesca Gottschalk - How can education support child empowerment.pptx
Francesca Gottschalk - How can education support child empowerment.pptx
EduSkills OECD
 
Model Attribute Check Company Auto Property
Model Attribute  Check Company Auto PropertyModel Attribute  Check Company Auto Property
Model Attribute Check Company Auto Property
Celine George
 
2024.06.01 Introducing a competency framework for languag learning materials ...
2024.06.01 Introducing a competency framework for languag learning materials ...2024.06.01 Introducing a competency framework for languag learning materials ...
2024.06.01 Introducing a competency framework for languag learning materials ...
Sandy Millin
 
A Strategic Approach: GenAI in Education
A Strategic Approach: GenAI in EducationA Strategic Approach: GenAI in Education
A Strategic Approach: GenAI in Education
Peter Windle
 
The Challenger.pdf DNHS Official Publication
The Challenger.pdf DNHS Official PublicationThe Challenger.pdf DNHS Official Publication
The Challenger.pdf DNHS Official Publication
Delapenabediema
 

Recently uploaded (20)

CACJapan - GROUP Presentation 1- Wk 4.pdf
CACJapan - GROUP Presentation 1- Wk 4.pdfCACJapan - GROUP Presentation 1- Wk 4.pdf
CACJapan - GROUP Presentation 1- Wk 4.pdf
 
The basics of sentences session 5pptx.pptx
The basics of sentences session 5pptx.pptxThe basics of sentences session 5pptx.pptx
The basics of sentences session 5pptx.pptx
 
Digital Artifact 1 - 10VCD Environments Unit
Digital Artifact 1 - 10VCD Environments UnitDigital Artifact 1 - 10VCD Environments Unit
Digital Artifact 1 - 10VCD Environments Unit
 
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
 
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
 
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO PerspectiveAdvantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
 
S1-Introduction-Biopesticides in ICM.pptx
S1-Introduction-Biopesticides in ICM.pptxS1-Introduction-Biopesticides in ICM.pptx
S1-Introduction-Biopesticides in ICM.pptx
 
The approach at University of Liverpool.pptx
The approach at University of Liverpool.pptxThe approach at University of Liverpool.pptx
The approach at University of Liverpool.pptx
 
1.4 modern child centered education - mahatma gandhi-2.pptx
1.4 modern child centered education - mahatma gandhi-2.pptx1.4 modern child centered education - mahatma gandhi-2.pptx
1.4 modern child centered education - mahatma gandhi-2.pptx
 
How libraries can support authors with open access requirements for UKRI fund...
How libraries can support authors with open access requirements for UKRI fund...How libraries can support authors with open access requirements for UKRI fund...
How libraries can support authors with open access requirements for UKRI fund...
 
Thesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.pptThesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.ppt
 
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdfMASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
MASS MEDIA STUDIES-835-CLASS XI Resource Material.pdf
 
Best Digital Marketing Institute In NOIDA
Best Digital Marketing Institute In NOIDABest Digital Marketing Institute In NOIDA
Best Digital Marketing Institute In NOIDA
 
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
 
Digital Artifact 2 - Investigating Pavilion Designs
Digital Artifact 2 - Investigating Pavilion DesignsDigital Artifact 2 - Investigating Pavilion Designs
Digital Artifact 2 - Investigating Pavilion Designs
 
Francesca Gottschalk - How can education support child empowerment.pptx
Francesca Gottschalk - How can education support child empowerment.pptxFrancesca Gottschalk - How can education support child empowerment.pptx
Francesca Gottschalk - How can education support child empowerment.pptx
 
Model Attribute Check Company Auto Property
Model Attribute  Check Company Auto PropertyModel Attribute  Check Company Auto Property
Model Attribute Check Company Auto Property
 
2024.06.01 Introducing a competency framework for languag learning materials ...
2024.06.01 Introducing a competency framework for languag learning materials ...2024.06.01 Introducing a competency framework for languag learning materials ...
2024.06.01 Introducing a competency framework for languag learning materials ...
 
A Strategic Approach: GenAI in Education
A Strategic Approach: GenAI in EducationA Strategic Approach: GenAI in Education
A Strategic Approach: GenAI in Education
 
The Challenger.pdf DNHS Official Publication
The Challenger.pdf DNHS Official PublicationThe Challenger.pdf DNHS Official Publication
The Challenger.pdf DNHS Official Publication
 

illuminatruseqsmallrna

  • 1. Esquema TruSeq small RNA 5' R1====================> 3' _RA5______________________ _RA3_________________ _RP1______________________________________________ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC INSERTO TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC[NNNNNNN]TCTCGTATGCCGTCTTCTGCTTG TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAG ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG[NNNNNNN]AGAGCATACGGCAGAAGACGAAC ___________________________________________________________01IPR_ ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG ATCGAAT AGAGCATACGGCAGAAGACGAAC ___________PTS_ TTGCACCACCTTAAG 5' 5' < ||||| CCCGTGG 3' _______ * STP oligo forms a stem loop and one end of the stem loop anneals to the 3' adapter oligo and inhibits further ligation.