This study examined the association between a FOXP3 gene polymorphism (rs3761548) and nondermatomal vitiligo in an Indian population. The researchers found that: 1) Female patients with the CC genotype were protected against vitiligo, while those with the CA genotype had a 3-fold higher risk of developing vitiligo. 2) No significant differences were observed between genotype frequencies in male patients and controls. 3) The results suggest the FOXP3 polymorphism may influence vitiligo susceptibility in women through altered regulatory T cell expression and function.

1. Association of FOXP3 (rs3761548) promoter
polymorphism with nondermatomal vitiligo:
A study from India
Parveen Jahan, PhD,a
Rajeshwari Cheruvu, MSc,a
Surekha Tippisetty, MSc,a
Prasanna Latha Komaravalli, PhD,a
Vijayalakshmi Valluri, PhD,b
and Mohammed Ishaq, PhDa
Hyderabad, India
Background: The rs3761548 polymorphism (À3279 C[A) of FOXP3 gene is associated with several
autoimmune disorders.
Objective: We sought to determine whether rs3761548 polymorphism is associated with nondermatomal
vitiligo in Indian subjects.
Methods: Genomic DNA was isolated from blood samples of 303 patients and 305 control subjects and
genotyping was done by allele-specific primers. Data analysis was carried out for the entire cohort and
separately for male and female participants as FOXP3 is an X-linked marker. Statistics were performed
using software.
Results: The genotype frequencies differed significantly from patients to control subjects (P = .002).
Further analysis demonstrated female participants with CC genotype were protected (CC vs CA1AA; odds
ratio 0.38, 95% confidence interval 0.238-0.615) and those with CA genotype were at higher risk to develop
vitiligo (CA vs CC1AA; odds ratio 2.634, 95% confidence interval 1.604-4.325). However, no such statistical
difference was observed in male participants.
Limitations: Our study is, to our knowledge, the first report from India with respect to vitiligo and
rs3761548; however, we lack adequate literature assistance.
Conclusions: The rs3761548 of FOXP3 gene in our population may be associated with susceptibility
to vitiligo because of altered expression. CC genotype appears to be protective and CA genotype
seems to impart nearly 3-fold risk to develop vitiligo in women and girls. ( J Am Acad Dermatol
2013;69:262-6.)
Key words: autoimmunity; FOXP3 single-nucleotide polymorphism rs3761548; gender; Indian population;
nondermatomal; vitiligo; X-chromosome.
The incidence of vitiligo is estimated to range
from less than 0.1% to more than 8% of the
worldwide population.1
Integration of epi-
demiologic, clinical, immunohistochemical, and
therapeutic data strongly supports the implication
of immunologic pathomechanisms in the disease.
The process underlying the induction of autoreactive
T cells and the loss of tolerance to melanocyte
From the Department of Genetics, Osmania University,a
and Lepra
India.b
Supported by Department of Science and Technology, New Delhi,
No SR/SO/HS/0151/2010.
Conflicts of interest: None declared.
Accepted for publication January 28, 2013.
Reprint requests: Parveen Jahan, PhD, Department of Genetics,
Osmania University, Hyderabad 500 007, India. E-mail:
dr_parveenjahan@yahoo.co.in.
Published online March 15, 2013.
0190-9622/$36.00
Ó 2013 by the American Academy of Dermatology, Inc.
http://dx.doi.org/10.1016/j.jaad.2013.01.035
Abbreviations used:
bp: base pair
CI: confidence interval
FOXP3: forkhead box P3
OR: odds ratio
SNP: single-nucleotide polymorphism
Tregs: regulatory T cells
262

2. antigens is still debated.2
Histopathological studies
have demonstrated increased CD81
cytotoxic
T lymphocytes and decreased naturally occurring
CD41
CD251
FOXP31
regulatory T cells (Tregs). The
paucity of Tregs in vitiligo skin is thought to cause
perpetual antimelanocyte reactivity in nonsegmental
vitiligo.3
Recent genomewide analyses have identi-
fied genes involved in risk of
vitiligo with 17 loci now
confirmed; 16 in European-
derived white individuals, 4
in Chinese population, and a
few in both4,5
; 1 among these
genes is FOXP3 (forkhead
box P3). FOXP3 gene, a fork-
head/winged helix transcrip-
tion factor, appears to be of
key importance in the devel-
opment, expression, and
function of Tregs. The role
of FOXP3 was first reported
in the immune dysregulation,
polyendocrinopathy, enter-
opathy, X-linked syndrome
(IPEX); later, approximately 20 mutations were iden-
tified.6
Further studies have reported that FOXP3 can
be associated with various autoimmune diseases.7,8
However, there are few studies on FOXP3 gene
function in vitiligo. The current study focuses on
evaluating the association of FOXP3 gene rs3761548
C[A single-nucleotide polymorphism (SNP) in the
susceptibility to vitiligo in the Indian population.
METHODS
We report a hospital-based case-control study car-
ried out with institutional ethical committee approval.
For this study, 303 Indian patients with nondermato-
mal vitiligo (Central Research Institute of Unani
Medicine, Hyderabad) and 305 individuals without
vitiligo (Red Cross Blood Bank, Hyderabad) were
recruited after obtaining written consent for collecting
clinical/demographic information along with a 5-mL
blood sample. Genomic DNA was isolated through
standard protocol9
and stored at À208C until used.
Genotyping was done for FOXP3 rs3761548 C[A SNP
for all patients and control subjects using the following
allele-specific primers:
Outer forward: 59GACTTAACCAGACAGCGTAG39
Inner forward: 59TTCTGGCTCTCTCCCCAACTGC39
Inner reverse: 59TGAGGGGTAAACTGAGGCCTT39
Outer reverse: 59 CTGGTGTGCCTTTGGTCT39
Allele-specific polymerase chain reaction was set
up with the following conditions for 30 cycles: initial
denaturation at 958C for 7 minutes, denaturation at
948C for 30 seconds, annealing for 45 seconds at
53.58C, elongation for 1 minute at 728C, final elon-
gation at 728C for 5 minutes, and hold at 48C. A final
volume of 10 L of polymerase chain reaction mix
consists of 1.25 L of 1X complete buffer, 1.5 L of 50
to 70 ng of genomic DNA, 0.3 L of 5 U of Taq
polymerase, 0.3 L of dNTPs, and 0.15 L of each
control primer. Products
were run on 2% agarose gel
electrophoresis containing
ethidium bromide at 100 V
for 20 minutes. The A alle-
leespecific product showed
a band at 209 base pair (bp),
C alleleespecific band at 397
bp, and general product at
564 bp (Fig 1).
Statistical analyses
Descriptive statistics were
done to calculate percent-
ages, mean values, and SD
values. The x2
contingency
tables were used to compare
the allele and genotype frequencies for the total
cohort and for gender-stratified data. The risk asso-
ciated with individual genotypes or alleles was
calculated as the odds ratio (OR) with 95% confi-
dence interval (CI) using online 2 3 2 contingency
calculator. Analysis was carried out using software
(SPSS, Version 14, SPSS, IBM Corp, Armonk, NY)
wherever required and the significance was defined
as a 2-sided P value less than .05.
RESULTS
This study comprised 608 individuals: 305 control
subjectsand303patientswithameanageof33.326 14
years and 28.0 6 12.7 years, respectively. The patient
group included 170 (56%) male and 133 (44%) female
participants with an age range of 3 to 62 years at the
time of sample collection, which included the patients
with age at onset of 1 to 59 years. The control group
included 141 (46%) men and 164 (54%) women with
an age range of18to 80years. Therecruitment ofthese
participants was based on the diagnostic criterion of
the dermatologist. The mean age at onset of vitiligo
was 22.15 6 13.0 years in the patient group and
21.97 6 14.25 years and 22.25 6 12.40 years in male
and female patients, respectively.
Perusal of Table I and Fig 2 revealed that the
distribution of CC, CA, and AA genotypes of FOXP3
rs3761548 was 76.40%, 12.78%, and 10.82% in control
subjects and 63.37%, 19.80%, and 16.83% in patients,
respectively. A significant association between
FOXP3 SNP and vitiligo susceptibility was observed
CAPSULE SUMMARY
d Histopathological studies in vitiligo have
demonstrated increased cytotoxic T
lymphocytes and a decrease in naturally
occurring T-regulatory cells.
d The rs3761548 single-nucleotide
polymorphism confers susceptibility (CA)
and protection (CC) toward vitiligo in
women and girls of India.
d Further studies in this direction
strengthen the autoimmune basis for
vitiligo and help clinicians.
J AM ACAD DERMATOL
VOLUME 69, NUMBER 2
Jahan et al 263

3. when patients and control subjects were compared
(x2
= 12.26; P = .002). The vitiligo cohort was then
stratified by gender and tested against corresponding
gender-specific control groups. With respect to gen-
der, only female patients showed significant differ-
ence from female control subjects (P .05) and no
such difference was seen when male patients were
compared with male control subjects (P [.05). For
female participants: CC vs others = OR 0.38, P .01,
95% CI 0.23-0.61; CAvs others = OR 2.63, P.01, 95%
CI 1.60-4.32; and AA vs others = OR 1.25, P[.05, 95%
CI 0.54-2.89. With respect to allelic frequency, C allele
was higher in pooled data and in both male and
female patients; however, the difference was not of
statistical significance (P[.05).
DISCUSSION
Immune tolerance is visualized as a balance with
autoreactive cells on one side and regulatory mech-
anisms intended to counter the autoreactive pro-
cesses on the other. A shift of the balance toward the
autoreactive cells, either by increasing the number or
functions of autoreactive cells or by diminishing
regulatory mechanisms, manifests as autoimmunity.
Tregs provide a substantial component of the auto-
immune counterbalance.10
Markers expressed by
Tregs include FOXP3, GIRT, CTLA4, and CD25, yet
only FOXP3 expression is relatively unique to
Tregs.11
The recognition of FOXP3, a transcription
factor as a critical molecule of CD41
CD251
Treg
development and function has provided new pros-
pects and generated expanded interest in studying
the balance between autoimmunity and regulatory
mechanisms and was suggested to be a candidate
gene for autoimmune diseases.
Development of Tregs requires continuous
expression of FOXP3, while altered expression may
result in its functional deficiency.12,13
Based on the
involvement of FOXP3 mutations/alterations, several
functional polymorphisms of FOXP3 gene have been
explored in the pathogenesis of various human dis-
orders.7,8
Vitiligo, one of the human dermatologic
disorders, is characterized by non-mendelian inheri-
tance (incomplete penetrance, multiple susceptibility
loci, genetic heterogeneity) and involves genes asso-
ciated with the biosynthesis of melanin, a response to
oxidative stress, and regulation of autoimmunity.
In this study, a functional polymorphic marker
rs3761548 (C[A) of FOXP3 has been investigated in
patients with nondermatomal vitiligo and healthy
control subjects of Indian origin.
Previous studies have reported that A allele of this
polymorphism was observed to be a risk factor for
autoimmune diseases such as systemic lupus eryth-
ematosus,14
autoimmune thyroid diseases,15
and
allergic rhinitis.16
It was shown that A allele causes
loss of binding to the e47 and c-myb factors, leading
to defective transcription of FOXP3 gene in psoriatic
patients and AA genotype shown to be associated
with lowest production of FOXP3 among the other
genotypes.17
Another study from a Han Chinese
population showed significant association of unex-
plained recurrent spontaneous abortions with
rs3761548, suggesting patients with AA genotype
may have fewer Tregs and/or weaker suppressive
function thereby difficultly achieving fetal tolerance
leading to early fetal loss.18
However, increased risk
for psoriasis was reported in individuals with AC
(À3279 C[A) genotypes in a Han Chinese popula-
tion.7
Our previous results on preeclampsia with
respect to the same polymorphism showed associa-
tion with C allele.19
Thus individuals with different
genotypes of rs3761548 may show distinct response
patterns in various autoimmune diseases.
In accordance to earlier studies that dealt with
other autoimmune diseases, our study results
showed AA genotype to be allied with vitiligo
susceptibility (Table I). The down-regulation of
FOXP3 gene may be associated with the AA geno-
type that is responsible for proinflammatory re-
sponse in patients with vitiligo. Although high
frequency of predisposing allele A was seen in
patients, it did not vary significantly from that of
the control subjects. The protective nature of CC
genotype was reflected in the form of elevated
frequency of CC individuals in the control group.
Generally, females mount stronger innate and
adaptive immune responses than males, which can
result in faster clearance of pathogens but also may
contribute to increased susceptibility to inflamma-
tory and autoimmune diseases.20
FOXP3 SNP is
an X-linked marker; males are hemizygous and
contribute a single allele and female individuals
contribute 2 alleles to the genotype. With this in
Fig 1. Gel picture showing genotypes of FOXP3
rs3761548 polymorphism.
J AM ACAD DERMATOL
AUGUST 2013
264 Jahan et al

4. mind, we stratified the vitiligo cohort by gender and
tested affected individuals against corresponding
gender-specific control groups. Similar to our pooled
data results, a higher frequency of A allele in patients
and C allele in control subjects was observed both in
males and females (P[.05). A Chinese study has also
shown male participants carrying A allele to be
significantly more susceptible to vitiligo.21
In the
current study, the CC genotype in females appeared
to be highly protective (OR 0.39; P = .0001) over
genotypes AA and CA. Because the A allele was
functionally associated with lower transcription fac-
tor, we expected the AA individuals to be increased
in frequency in female patients. Contrary to our
assumption, individuals with the CA genotype ex-
hibited an approximately 3-fold increased suscepti-
bility (OR 2.63; P = .0002) to vitiligo. Likewise,
increased frequency of heterozygote women (CA)
was observed in psoriatic patients.7
As we could
detect this association only in female participants,
there might be minor differences in immunologic
mechanisms in males and females leading to a
multifactorial disease such as vitiligo.22,23
Broen
et al24
reported that skewed X-chromosomal inacti-
vation may play a role in the susceptibility to
systemic sclerosis by influencing FOXP3 expression.
Possible explanations for the increased frequency of
heterozygous female individuals (CA) among pa-
tients with vitiligo observed in our study are skewed
X-chromosomal inactivation, influence of female
hormones, and other environmental factors.
Decreased numbers of CD41
CD251
Tregs and de-
creased expression of FOXP3 would impair the
suppressive activity of CD41
CD251
Tregs, which
may be a factor in the pathogenesis of vitiligo.25
In summary, rs3761548 of FOXP3 gene in our
population may be associated with susceptibility to
vitiligo because of its altered expression. Females
with CC genotype appear to be protective and CA
genotype seems to impart nearly 3-fold risk to
developing vitiligo. However, to understand the
preponderance of heterozygotes in female patients,
studies are warranted pertaining to possible skewed
X-inactivation and influence of female hormones in
the susceptibility to vitiligo.
We thank all the patients and control subjects who
cooperated by providing blood samples and clinical infor-
mation for this study.
REFERENCES
1. Alikhan A, Felsten LM, Daly M, Petronic-Rosic V. Vitiligo: a
comprehensive overview, part I: introduction, epidemiology,
quality of life, diagnosis, differential diagnosis, association,
Table I. Distribution of genotype and allele frequencies, and odds ratio of FOXP3 rs3761548 polymorphism in
patients and control subjects
Category
Genotypes
Odds ratio
Alleles
Odds ratio (CI)CC (%) CA (%) AA (%) C A
Whole cohort N = 608
Control subjects n = 305 233 (76.40) 39 (12.78) 33 (10.82) CC vs others 0.53*
CA vs others 1.68y
AA vs others 1.67y
0.82 0.18 0.59 (0.30-1.16)z
Patients n = 303 192 (63.37) 60 (19.80) 51 (16.83) 0.73 0.27
Female N = 297
Control subjects n = 164 113 (68.90) 39 (23.70) 12 (7.30) CC vs others 0.38*
CA vs others 2.63*
AA vs others 1.25z
0.81 0.19 0.52 (0.27-1.00)z
Patients n = 133 61 (45.90) 60 (45.10) 12 (9.00) 0.68 0.32
Male N = 311
Control subjects n = 141 120 (85.10) - 21 (14.89) C vs A 0.59z
A vs C 1.70z
0.85 0.15 0.59 (0.28-1.21)z
Patients n = 170 131 (77.00) - 39 (23.00) 0.77 0.23
CI, Confidence interval.
*P .01.
y
P .05.
z
Not significant.
Fig 2. Distribution of genotype frequencies of FOXP3
rs3761548 polymorphism in patients and control subjects
by gender.
J AM ACAD DERMATOL
VOLUME 69, NUMBER 2
Jahan et al 265

5. histopathology, etiology, and work up. J Am Acad Dermatol
2011;65:473-91.
2. Ben Ahmed M, Zaraa I, Rekik R, Elbeldi-Ferchiou A, Kourda N,
Belhadj Hmida N, et al. Functional defects of peripheral
regulatory T lymphocytes in patients with progressive vitiligo.
Pigment Cell Melanoma Res 2012;25:99-109.
3. Oiso N, Suzuki T, Fukai K, Katayama I, Kawada A. Non
segmental vitiligo and autoimmune mechanism. Dermatol
Res Pract 2011;2011:518090.
4. Birlea SA, Jin Y, Bennett DC, Herbstman DM, Wallace MR,
McCormack WT, et al. Comprehensive association analysis of
candidate genes for generalized vitiligo supports XBP1,
FOXP3, and TSLP. J Invest Dermatol 2011;131:371-81.
5. Spritz RA. The genetics of generalized vitiligo: autoimmune
pathways and an inverse relationship with malignant mela-
noma. Genome Med 2010;2:78.
6. van der Vliet HJJ, Nieuwenhuis EE. IPEX as a result of
mutations in FOXP3. Clin Dev Immunol 2007;2007:89017.
7. Gao L, Li K, Li F, Li H, Liu L, Wang L, et al. Polymorphisms in the
FOXP3 gene in Han Chinese psoriasis patients. J Dermatol Sci
2010;57:51-6.
8. Park O, Grishina I, Leung PS, Gershwin ME, Prindiville T.
Analysis of the Foxp3/scurfin gene in Crohn’s disease. Ann N
Y Acad Sci 2005;1051:218-28.
9. Tippisetty S, Mohammed I, Komaravalli PL, Jahan P. Angiotensin
converting enzyme (ACE) gene polymorphism in vitiligo: pro-
tective and predisposing effects of genotypes in disease
susceptibility and progression. Eur J Dermatol 2011;21:173-7.
10. Torgerson TR. Regulatory T cells in human autoimmune
diseases. Springer Semin Immunopathol 2006;28:63-76.
11. de Boer OJ, van der Loos CM, Teeling P, van der Wal AC,
Teunissen MB. Immunohistochemical analysis of regulatory T
cell markers FOXP3 and GITR on CD41
CD251
T cells in normal
skin and inflammatory dermatoses. J Histochem Cytochem
2007;55:891-8.
12. Williams LM, Rudensky AY. Maintenance of the
Foxp3-dependent developmental program in mature regulatory
T cells requires continued expression of Foxp3. Nat Immunol
2007;8:277-84.
13. Wan YY, Flavell RA. Regulatory T-cell functions are subverted
and converted owing to attenuated Foxp3 expression. Nature
2007;445:766-70.
14. Lin YC, Lee JH, Wu AS, Tsai CY, Yu HH, Wang LC, et al.
Association of single-nucleotide polymorphisms in FOXP3
gene with systemic lupus erythematosus susceptibility: a
case-control study. Lupus 2011;20:137-43.
15. Inoue N, Watanabe M, Morita M, Tomizawa R, Akamizu T,
Tatsumi K, et al. Association of functional polymorphisms
related to the transcriptional level of FOXP3 with prognosis of
autoimmune thyroid diseases. Clin Exp Immunol 2010;162:
402-6.
16. Zhang L, Zhang Y, Desrosiers M, Wang C, Zhao Y, Han D.
Genetic association study of Foxp3 gene polymorphism in
allergic rhinitis in a Chinese population. Hum Immunol 2009;
70:930-4.
17. Shen Z, Chen L, Hao F, Wang G, Liu Y. Intron-1 rs3761548 is
related to the defective transcription of Foxp3 in psoriasis
through abrogating E47/c-Myb binding. J Cell Mol Med 2010;
14:226-41.
18. Wu Z, You Z, Zhang C, Li Z, Su X, Zhang X, et al. Association
between functional polymorphisms of Foxp3 gene and the
occurrence of unexplained recurrent spontaneous abortion in
a Chinese Han population. Clin Dev Immunol 2012;2012:
896458.
19. Jahan P, Srinivasagari R, Goudi D, Komaravalli PL, Ishaq M. Role
of Foxp3 gene in maternal susceptibility to pre-eclampsiaea
study from South India. Scand J Immunol 2013;77:104-8.
20. Klein SL. Immune cells have sex and so should journal articles.
Endocrinology 2012;153:2544-50.
21. Li HX. Relationship between regulatory T cell and FoxP3 gene
polymorphism and vitiligo 2010 China papers, China’s out-
standing master’s theses part C. GT ID2144360245498320.
22. Surekha T, Ishaq M, Latha KP, Rao PH, Jahan P. Do clinical
variants of vitiligo involve X-linked gene(s) too? J Med Sci
2008;8:728-33.
23. Surekha T, Ishaq M, Jahan P. Parent-of-origin effect; a hint
from vitiligo epidemiology. J Dermatol 2011;38:947-9.
24. Broen JC, Wolvers-Tettero IL, Geurts-van Bon L, Vonk MC,
Coenen MJ, Lafyatis R, et al. Skewed X chromosomal inacti-
vation impacts T regulatory cell function in systemic sclerosis.
Ann Rheum Dis 2010;69:2213-6.
25. Ting-hui L, Xiao-bin X, Li X, Yun HE, Li-ping C. Role of CD41
CD251
regulatory T cells and Foxp3 expression on the
pathogenesis of vitiligo. Chin J Aesthetic Med 2009;8:819-22.
J AM ACAD DERMATOL
AUGUST 2013
266 Jahan et al