Expression Vectors
Dr Ravi Kant Agrawal, MVSc, PhD
Senior Scientist (Veterinary Microbiology)
Food Microbiology Laboratory
Division of Livestock Products Technology
ICAR-Indian Veterinary Research Institute
Izatnagar 243122 (UP) India
Expression Vectors:
Vectors that can yield the protein products of the cloned genes.
Two elements that are required for active gene expression: a
strong promoter and a ribosome binding site near an initiating
ATG codon.
The main function of an expression vector is to yield the
product of a gene, therefore a strong promoter is necessary.
The more mRNA is produced, the more protein product is made.
Expression in E. coli
E. coli is one of the most widely used expression host for
protein expression.
The techniques for expression in E. coli are well developed and
work by increasing the number of copies of the gene or
increasing the binding strength of the promoter region so
assisting transcription.
For example a DNA sequence for a protein of interest could
be cloned or subcloned into a high copy-
number plasmid containing the lac promoter, which is
then transformed into the bacterium Escherichia coli. Addition
of IPTG (a lactose analog) activates the lac promoter and
causes the bacteria to express the protein of interest.
Expression in E. coli:
Advantages:
 Rapid doubling time (approximately 30 min)
Growth in simple defined (and inexpensive) media,
An extensive knowledge of its promoter and terminator
sequences
Proteins of both prokaryotic and eukaryotic origin can be
produced within the organism.
Many proteins of prokaryotic are originated in E. coli due to
E.coli cells are easily broken for the harvesting of proteins
produced within the cell (Easy harvesting).
Drawback:
1. E. coli cells are Unable to process introns and
2. Do not possess the extensive post-translational machinery
(glycosylation, methylation, phosphorylation etc).
In expression vector various Genetic elements required are:
1. Origin of replication
2. Selective marker
3. Transcriptional promoter
4. Unique multiple cloning sites
5. Translational initiation regions (TIRs)
6. Translational terminator
Expression vector
Origin of replication: Sequences that allow their autonomous
replication within the cell.
There are 2 types:
1) ColE1 replicon :
- pBR322 (copy no. ~15-20)
- pUC (copy no. ~500-700)
2) p51A replicon :
-pACYC184 (copy no. ~10-12)
Selective marker: sequences encoding a selectable
marker that assures maintenance of the vector in the
host.
• Ampicillin
• Kanamycin interfere with
• Chloramphenical protein synthesis
• Tetracycline
Transcriptional promoter:
Promoter is a –
• Region of DNA that control the transcription of a particular
gene.
• It locate upstream of the genes.
• Recognizing site for RNA polymerase (sigma subunit).
Good promoter should be:
• Strong promoter: Accumulation of expressed protein up 10 to
30% or more of the total cellular protein.
• Minimal basal expression level: Tight regulation of the
promoter
• Easily induction: Simple and cost effective manner
Multiple cloning site:
It is defined as a short segment of DNA which contain many
restriction sites (usually 20+).
To simplify the insertion of the heterologous gene in the
correct orientation within the vector.
Translational initiation regions (TIRs):
Located on the 5’-mRNA
Translational terminator:
Located on the 3’-mRNA
Use of Rho-independent termination
Some commonly used expression host-vector system and
expression inducible expression system:
Many different promoter sequences have been used to illicit
inducible protein production in E. coli
1. lac Promoter
2. tac Promoter
3. λPL Promoter
4.T7 Expression System
Many different promoter sequences have been used to induce
protein production in E.coli. These are:
The lac Promoter:
 Lac prompter provides a mechanism for inducible gene
expression.
 Without lactose in the cell, the repressor protein binds to the
operator and prevents the read of RNA polymerase into the
three structural genes.
 With lactose in the cell, lactose binds to the repressor. This
causes a structural change in the repressor and it loses its
affinity for the operator. Thus RNA polymerase can bind to the
promoter and transcribe the structural genes.
 In this system lactose acts as an effector molecule.
 Fusing the lac promoter sequence to another gene will result in
the lactose-(or IPTG-) dependent expression of that gene.
Control Circuit for the lac Operon:
I P O || Z | Y | A |
controlling region ǁ structural genes
lac Operon Gene Gene function
• I Gene for repressor protein
• P Promoter
• O Operator
• lac Z Gene for ß-galactosidase
• lac Y Gene for ß-galactoside permease
• lac A Gene for ß-galactoside transacetylase
Operon - a cluster of structural genes that are expressed as a
group and their associated promoter and operator
The lac operon promoter (which regulates the transcription of lacZ,
not lacI)
(a) Presented so that the genome sequence numbers increase from left
to right. Its 5' to 3' sequence is the same as in the database
(ACCESSION AE000141).
(b) Presented so that the promoter sequence numbers increase from
left to right. Its 5' to 3' sequence is comparable to the consensus
sequence.
lac promoter- lactose- (or IPTG-
isopropylthiogalactoside) inducible
Problems with lac promoter-
1. Weak
2. Leaky expression
mutant versions of the lacI gene : lacIq allele
increased DNA binding
overproduction of LacI
reduced level of transcription in the absence of inducer
The tac Promoter:
The lac promoter is weak because the -
35 region deviates from the consensus.
The creation of a fusion sequence
containing the -35 region of the E. coli
trp operon and the -10 region of the lac
operon controlling the expression of
the genes responsible for tryptophan
biosynthesis and lactose metabolism
which results in the formation of the
tac promoter.
The tac promoter is 5 times stronger
then lac promoter.
Expression vectors that carry the tac
promoter also carry the lacO operator
and usually the lacI gene encoding the
Lac repressor.
Because of this, these vectors are IPTG
inducible and can be repressed and
induced in a variety of E. coli strains.
-35 CONSENSUS -10 CONSENSUS
5’-TTGACA-3’ 5’-TATAAT-3’
Lac : 5’-…TTTACAC…..TCCGGCTCGTATATTGTGT…………..CAGGAAACAGCT ATG…-3’
_______ ______ _____ ______
-35 -10 RBS Protein
Trp : 5’-…TTGACAATTAATCATCGAAC….TTAACTAG………….AAAGGGTAT…….ACA ATG…-3’
_______ _______ _____ ______
-35 -10 RBS Protein
Tac : 5’-…TTGACAATTAATCATCGGCTCGTATATTGTGT………AGGAAACAGCGG ATG…-3’
_______ ______ _____ ______
-35 -10 RBS Protein
DNA sequence of lac, trp and tac promoter.
The consensus E. coli -35 and -10 sequence based on the analysis
of naturally occurring promoters are shown and the sequence
of each of the promoters, extending from the -35 region to
translational start site, are shown.
The tac promoter is a hybrid of the trp and lac promoter.
The -35 and -10 region contains closely resemble the consensus
sequences.
The tac promoter is able to induce the expression of target
genes such that encoded polypeptide can accumulate at the
level of 20-30% of the total cell protein.
3. The λPl Promoter:
 This is responsible for
transcription of left-hand side of
the λ genome, including N and
cIII.
 Λ repressor which is the product
of the cI gene, repress the
promoter.
Two basic methods are used to
activate this promoter.
 Transform the expression vector
into an E. coli strain in which the cI
gene has been placed under the
control of tightly regulated trp
promoter.
 Then expression of the target
gene can be induced by the
addition of tryptophan to the
growth media, which will prevent
transcription of the cI gene and
consequently activate the strong
λ Pl promoter.
 This system can be used to express
highly toxic proteins.
The λPL promoter - transcription of
the left-hand side of the λ genome,
including N and cIII
One way:
expression vector
Transform In E. coli strain
(cI gene under control of trp promoter)
Expression of the target gene - By addition of tryptophan
Advantage- Tightly controlled system so can be use
for highly toxic proteins
cI gene - λ repressor,
The λPL Promoter
Activation of the λPL promoter.
1. Temperature-sensitive mutant of cI (Ci857)
above 30 ◦C
mutan λ repressor
λPL for the expression -target genes .
Advantage-high levels of target gene expression,
Disadvantage- Heat pulse difficult to control
Other way:
4. The T7 Expression System-
 It is different from its E. coli counterpart.
E. coli enzyme- Has a α2β2 subunit structure
T7 RNA polymerase- Binds to DNA 17 bp promoter sequences (5-
TAATACGACTCACTATA-3) found upstream of the T7 viral gene it
activates.
bacteriophage T7
RNA polymerasesingle-subunit
T7 promoter .The target gene
plasmid
wild-type
no expression
E. coli strain
lac promoter
T7 RNA
polymerase
T7 gene 1
expression of the
target gene.
To control the leaky production of T7 RNA polymerase (thereby
ensuring that target gene expression is minimized), E. coli cells
co-transformed With The plasmid pLysS -T7 lysozyme, natural
inhibitor of T7 RNA polymerase.
The T7 Expression System: pET vector system
The pET System is the most powerful system yet developed for
the expression of recombinant proteins in E. coli.
Translation signals; expression is induced by providing a source
of T7 RNA polymerase in the host cell.
T7 RNA polymerase is so selective and active that, when fully
induced, almost all of the cell’s resources are converted to
target gene expression.
The desired product can comprise more than 50% of the total
cell protein a few hours after induction.
pET vector:
– T7 promoter for expression
– lac O, lac I : tighter regulation of transcription
– origin of replication : pBR322
– selectable marker : Ampr
– ccdB : control of cell death
– RBS : ribosome binding site
– Start codon : ATG
– Tag, Fusion : 6xHis, V5 Epitope, GST
– T7 terminator
 The expression vector (pET) contain the target gene under the
control of T7 (RNA polymerase) promoter.
 The vector is transformed into an E. coli strain that contains a
copy of gene for T7 RNA polymerase gene under the control of
the lac promoter (BL21 DE3).
 The promoter for both the target gene and T7 RNA polymerase
gene, also contain the lacO operator sequence and therefore
inhibited by the lac repressor(lacI).
 IPTG induction allows the transcription of the T7RNA
polymerase gene whose protein product activates the
expression of target gene. After induction sufficient T7 RNA
polymerase is produced.
Expression in Yeast
Advantages-
1. Easy to manipulate as E. coli
2. Yeast cell growth is faster, easier and less expensive than other
eukaryotic cells
3. Post-translational modifications
4. Gives higher expression levels.
Three main species of yeast are used for the production of
recombinant proteins –
1. Saccharomyces cerevisiae
2. Pichia pastoris and
3. Schizosaccharomyces pombe
Baker’s yeast, S. cerevisiae, is-
A single-celled eukaryote that grows rapidly (a doubling time of
approximately 90 min) in simple, defined media similar to those
used for E. coli cell growth.
Advantage:
Many, but not all, of the post-translation modifications found in
higher eukaryotic cells.
A number of constitutive promoters for the genes encoding
phosphoglycerate kinase (PGK), glyceraldehyde-3-phosphate
dehydrogenase (GPD) and alcohol dehydrogenase (ADH1) have
been used to produce target proteins, however, these suffer with
similar problems as constitutive E. coli expression.
02 Systems have been utilized for inducible expression.
Saccharomyces cerevisiae
1. The GAL system –
In yeast, galactose is converted to glucose -6- phosphate by the
enzymes of the Leloir pathway.
Each of the Leloir pathway structural genes (collectively called
Gal genes) are expressed at a high levels, representing 0.5-1% of
the total cellular RNA but ONLY when the cells are grown on
galactose as the sole carbon source.
Each of the gal genes contains within its promotor at least one or
multiple binding sites for the transcriptional activator Gal4p.
The binding of Gal4p and its transcriptional activity when bound
is regulated by the source of carbon available.
When yeast is grown on glucose, transcription of Gal4p is down
regulated, so there is less Gal4p and reduced level of activator
binding at the promotors of the Gal structural genes.
To produce a target protein in S. cerevisiae using galactose
induction, the gene encoding the protein must be cloned so that
it is under the control of a Gal promotor.
The promotor for Gal1 gene encoding galactokinase is most
commonly used.
Synthestic promotors containing multiple Gal4p binding sites are
also available.
Expression vector is transformed in to yeast cells and protein
production is initiated by switching the cells to a galactose
containing medium.
Protein produced by these methods is usually in low abundance
and maximum production may represent 1-5% of the total cell
protein. Therefore detection by CBB R 250 ot possible and
require western blotting
Additional difficulty is brought about by the activator of the
GAL genes i.e. Gal4p which is normally present in the yeast cells
at very low level. Therefore if expression vector which carries
multiple Gal4p binding sites, as a high copy number plasmid,
there may not be sufficient Gal4p to activate the expression of
all the available target genes to a maximum level.
To overcome this yeast strains have been constructed in which
the coding sequence of the Gal4 gene has been placed under
the GAL promotor control. This results in feedback loop in
which induction by galactose results in the production of Gal4p
so that more of the target gene may be expressed.
GAL genes Promoter one / more binding site for
transcriptional activator Gal4p
Binding of Gal4p to these sites and its transcriptional
activity when bound, is regulated by the source of carbon
galactose ( galactose in medium)
Structural genes (GAL genes)
0.5-1 per cent of the total cellular mRNA
Leloir pathway enzymes
glucose-6-phosphate
Less
GAL structural genes
yeast
Glucose (preferred carbon source)
less Gal4p
raffinose,
production
Gal4p
Gal80p, inhibits
 Galactose inducible gene expression in yeast.
 The expression of genes from multicopy vectors under the control of the GAL1
promoter (PGAL1) can be increased substantially if the gene encoding the
transcriptional activator of GAL1, GAL4, is also placed under the control of PGAL1.
 In this case, induction by galactose will produce more Gal4p and consequently
more of the target protein
2.The CUP1 System:
Copper ions (Cu2+ and Cu3+) are essential at appropriate levels, yet
toxic at higher levels in all living MOs.
Cells must maintain a proper level of copper ions
Copper homeostasis in S. cerevisiae involves
Distribution
Uptake,
Detoxification mechanisms.
At High concentrations, copper ion detoxification is mediated
by a copper ion sensing metelloregulatory transcription factor
called Ace1p.
Upon interaction with copper, Ace1p binds DNA upstream of the
CUP1 gene, which encodes a metallothionin protein and induces
its transcription.
The transcription of CUP1 is induced rapidly by addition of
exogenous copper to the medium.
Expression vectors harbouring CUP1 promotor can therefore be
used to induce target gene expression in copper dependent
fashion.
Cu ions
Ace1p
CUP1 gene
metallothionein
Advantage: Can be grown on rich carbon sources, such as glucose,
to high cell density, and protein production is initiated by the
addition of copper sulphate (0.5 mM final concentration) to the
cultures.
Drawback- Due to presence of copper ions in yeast growth
media, and indeed in water supplies. Therefore off state in the
absence of added copper may still yield significant levels of
protein production
Pichia pastoris
Pichia pastoris is a methylotropic yeast capable of metabolizing
methanol as its sole carbon source.
First step is oxidation of methanol to formaldehyde using
molecular o2 utilizing alcohol oxidase (AOX1).
Alcohol oxidase has poor affinity for O2 and Pichia pastoris
compensates it by producing large amounts of Alcohol oxidase.
Therefore, the promotor regulating the production of Alcohol
oxidase may be utilized to drive heterologous protein
expression in Pichia pastoris since it is tightly regulated and
induced by methanol to very high levels.
P. pastoric cells containing expression vector, which is usually
integrated into the genome as single or multiple copies are grown
in gycerol (growth on glucose represses AOX1 transcription, even
in the presence of methanol), to extremely high cell density prior
to addition of methanol.
Once induced, target protein may accumulate at very high levels,
often ranging from 0.5-10’s of grams per litre of yeast culture e.g.
HBsAg is produced 1g/litre.
Methylotrophic yeast
methanol formaldehyde
O2
alcohol oxidase
(AOX1 gene)
Advantages-
Tightly regulated
High levels protein production
P. pastoris has advantage of glycosylation of secreted
proteins
Glycoproteins produced in P. pastoris resmble closely
the glycoprotein structure of those found in higher
eukaryotes.
Schizosaccharomyces pombe:
 Single cell eukaryotic organism
 The properties like codon usage, chromosomal structure and
function, cell cycle control and RNA spilcing suggest that S. pombe is
an ideal candidate for production of eukaryotic proteins.
 Additionally, eukaryotic proteins produced in S. pombe are more
likely to be folded properly which reduce protein insolubility.
 Protein production in S. pombe is usually controlled by nmt1
promotor.
 This promotor is active when cells are grown in absence of thiamine.
 In the presence of more than 0.5 uM thiamine, promotor is turned
off.
 Overall protein production levels- similar to S. cerevisiae.
Advantages- expressed proteins are folded properly
Solubility more
No message in thiamine (nmt1) promoter
thiamine
> 0.5 μM thiamine, the promoter is turned off.
Using animal cells for recombinant protein production
The difficulties inherent in synthesis of a fully active animal
protein in a microbial host have prompted biotechnologists to
explore the possibility of using animal cells for recombinant
protein synthesis.
For proteins with complex and essential glycosylation
structures, an animal cell might be the only type of host within
which the active protein can be synthesized.
Insect Cell Expression System
• Higher Eukaryotic system than yeast - more complex post-
translational modifications .
• Folding of mammalian proteins - soluble protein mammalian
origin.
• The most commonly used vector system - baculovirus.
The benefits of protein expression with baculovirus are:
Eukaryotic post-translational modification
Proper protein folding and function
High expression levels
Expression in Insect Cells
The expression system is based on the baculoviruses, a group of
viruses that are common in insects (& insect cell lines) but do
not normally infect vertebrates.
The baculovirus genome includes the polyhedrin gene, whose
product accumulates in the insect cell as large nuclear inclusion
bodies toward the end of the infection cycle .
The product of this single gene frequently makes up over 50% of
the total cell protein.
Similar levels of protein production also occur if the normal
gene is replaced by a foreign one.
Baculoviruses - rod-shaped viruses.
Nuclear polyhedrosis viruses (NPV) - occlusion bodies
(polyhedrin).
The polyhedrin gene is transcribed at very high levels late in the
infection process (3-5 d post-infection).
The polyhedrin promoter can be used to drive target gene
expression.
Baculoviruses are rod-shaped
viruses that infect insects and
insect cell lines.
They have double-stranded
circular DNA genomes in the
range of 90–180 kbp (Ayres et al.,
1994).
Viral infection results in cell lysis,
usually 3–5 d after the initial
infection, and the subsequent
death of the infected insect.
The NUCLEAR POLYHEDROSIS
VIRUSES are a class of
baculoviruses that produce
occlusion bodies in the nucleus
of infect cells.
These occlusion bodies consist
primarily of a single protein,
polyhedrin, which surrounds the
viral particles and protects them
from harsh environments.
Crystalline inclusion bodies in the
nuclei of insect cells
infected with a baculovirus.
Most viruses of this type need to be eaten by the insect
before infection will occur, and the occlusion body protects
the viral particles from degradation in the insect gut.
The polyhedrin gene is transcribed at very high levels late in
the infection process (2–4 d post-infection).
In cultured insect cells, the production of inclusion bodies is
not essential for viral infection or replication.
Consequently, the polyhedrin promoter can be used to drive
target gene expression.
The baculovirus Autographa californica nuclear polyhedrosis
virus (AcNPV) has become a popular tool of the production
recombinant proteins in insect cells (Fraser, 1992).
It is used in conjunction with insect cell lines derived from the
moth Spodoptera frugiperda.
These cell lines (e.g. Sf9 and Sf21) are readily cultured in the
laboratory.
The size of the baculoviral genome generally precludes the
cloning of target genes directly onto it.
Instead, the target gene is cloned downstream of the
polyhedrin promoter in a transfer plasmid (Lopez-Ferber, Sisk
and Possee, 1995).
The transfer plasmid also contains the sequences of
baculovirus genomic DNA that flank the polyhedrin gene, both
upstream and downstream.
To produce recombinant viruses, the recombinant transfer
plasmid is co-transfected with linearized baculovirus vector
DNA into insect cells.
The flanking regions of the transfer plasmid participate in
homologous recombination with the viral DNA sequences and
introduce the target gene into the baculovirus genome.
The recombination process also results in the repair of the
circular viral DNA and allows viral replication to proceed
through the re-formation of ORF1629 (a viral capsid associated
protein that is essential for the production of viral particles).
Recombinant viral infection can be observed microscopically
by viewing viral plaques on a lawn of insect cells.
Plaques containing recombinant virus will be unable to form
occlusion bodies due to the lack of a functional polyhedrin protein
(Smith, Summers and Fraser, 1983).
Screening plaques this way is, however, technically difficult.
Therefore, the transfer plasmids also usually contain the lacZ gene,
or another readily observable reporter gene, which allows for the
visual identification of recombinant plaques by their blue
appearance after staining with X-Gal.
Following transfection and plaque purification to remove any
contaminating parental virus, a high-titre virus stock is prepared,
and used to infect large-scale insect cell culture for protein
production.
The infected cells undergo a burst of target protein production,
after which the cells die and may lyse.
Protein production in baculovirus infected insect cells has the
advantage that very high levels of protein can be produced relative
to other eukaryotic expression systems, and that the glycosylation
pattern obtained is similar, but not identical, to that found in
higher eukaryotes (Possee, 1997; Joshi et al., 2000).
Baculoviruses also have the advantage that multiple genes can be
expressed from a single virus. This allows the production of
protein complexes whose individual components may not be
stable when expressed on their own (Roy et al., 1997 ).
 Baculovirus is a very large DNA virus
(genome of about 150 kb) that
infects insect cells.
 To express a foreign gene in
baculovirus, the gene of interest is
cloned in place of the viral coat-
protein gene in a plasmid carrying a
small part of the viral genome.
 The recombinant plasmid is
cotransfected into insect cells with
wild-type baculovirus DNA.
 At a low frequency, the plasmid and
viral DNAs recombine through
homologous sequences, resulting in
the insertion of the foreign gene
into the viral genome.
 Virus plaques develop, and the
plaques containing recombinant
virus look different because they
lack the coat protein.
 The plaques with recombinant virus
are picked and expanded.
 This virus stock is then used to
infect a fresh culture of insect cells,
resulting in high expression of the
foreign protein.
Baculovirus Expression System
The production of a recombinant
baculoviral genome for the
production of proteins in insect
cells.
 The target gene is cloned under
the control of the polyhedrin
promoter into a transfer vector
that also contains regions of the
viral genome that flank the
polyhedrin locus.
 The vector is then co-
transfected into insect cells
with a viral genome that has
been linearized using restriction
enzymes (RE) that cut in several
places.
 Homologous recombination
between the linear genome and
the vector will result in
formation of a functional viral
genome that is capable of
producing viral particles.
 The inclusion of lacZ in the
transfer vector allows for visual
screening of viral plaques to
identify recombinants
 The main disadvantages of producing proteins in this way is
that the construction and purification of recombinant
baculovirus vectors for the expression of target genes in insect
cells can take as long as 4–6 weeks, and that the cells grow
slowly (increasing the risk of contamination) in expensive
media.
 An alternative approach to recombinant viral genome
production uses site-specific transposition in E. coli rather than
homologous recombination in insect cells (Luckow et al., 1993 ).
E. coli Baculovirus Shuttle Vector - Bacmids
• It is based on site-specific transposition of an expression
cassette into a baculovirus shuttle vector (bacmid) propagated
in E. coli.
• The bacmid contains the entire baculovirus genome, a low-copy
number E. coli F-plasmid origin of replication and the
attachment site for the bacterial transposon Tn7.
• The bacmid propagates in E. coli as a large plasmid.
• Recombinant bacmids are constructed by transposing a Tn7
element from a donor plasmid, which contains the target gene
to be expressed, to the attachment site on the bacmid – a
helper plasmid encoding the transposase is required for this
function.
• The recombinant bacmid can be isolated from E. coli and
transfected directly into insect cells.
E. coli Baculovirus Shuttle Vector - Bacmids
•Shuttle vectors allow ease of transfer between systems
•Genetic manipulations in one system, expression in another
Advantages
• The polyhedrin gene is not required for the continuous
production of infectious virus in insect cell culture. Its sequence
is replaced with that of the heterologous gene.
• The polyhedrin gene promoter is very strong. This determines a
very high level of production of recombinant protein.
• Very late expression allows for the production of very toxic
proteins.
• This system is capable of post-translational modifications.
Disadvantages
 Expensive.
 Glycosylation in insect cells is different (insect cells unable to
produce complex N-linked side chains with penultimate
galactose and terminal sialic acid) from that in vertebrate cells,
therefore, a problem for therapeutic proteins.
 A large fraction of the RP can be poorly processed and
accumulates as aggregates.
 Discontinuous expression: baculovirus infection of insect cells
kills the host and hence the need to re-infect fresh cultures for
each round of protein synthesis.
 Inefficient for production on a commercial scale
Modifying the Insect Cell Host
 Genetic engineering of the host for proper expression
 Add missing glycosylation enzymes
 Add proteolytic processing enzymes
Expression in Higher-Eukaryotic Cells
For the production of mammalian proteins, mammalian cells
have an obvious advantage.
Mammalian cell lines derived from humans or hamsters have
been used in synthesis of several recombinant proteins, and in
most cases these proteins have been processed correctly and
are indistinguishable from the non-recombinant versions.
Two modes of expression - transient and stable.
Three cell types are dominant in transient expression: human
embryonic kidney (HEK), COS and baby hamster kidney (BHK),
whilst CHO (Chinese hamster ovary) cells are used
predominantly for stable expression.
Note: The acronym "COS" is derived from the cells being CV-1
(simian) in Origin, and carrying the SV40 genetic material.[2] Two
forms of COS cell lines commonly used are COS-1 and COS-7.
Mammalian expression vectors
Eukaryotic origin of replication is from an animal virus: e.g.
Simian virus 40 (SV40).
Popular markers for selection are the bacterial gene Neor
(encodes neomycin phosphotransferase), which confers
resistance to G418 (Geneticin), and the gene, encoding
dihydropholate reductase (DHFR).
When DHFR is used, the recipient cells must have a defective
DHFR gene, which makes them unable to grow in the presence
of methotrexate (MTX), unlike transfected cells with a
functional DHFR gene.
Promoter sequences that drive expression of both marker and
cloned heterologous gene, and the transcription termination
(polyadenyation signals) are usually from animal viruses
(human CMV, SV40, herpes simplex virus) or mammalian genes
(bovine growth hormone, thymidine kinase).
Mammalian Expression Vector
 “I” is an intron that enhances expression
 Other signals similar to insect and prokaryotic vectors
Translation Control Elements
 K - Kozak Sequence (equivalent to RBS)
 S - For secretion signal peptide
 T - tag peptide for purification
 P - Proteolytic cleavage sequence
 SC - Stop codon for translation
 3’UTR - proper sequences for efficient translation and mRNA
stability (e.g. polyadenylation sequence)
Two Vector Expression System
• Useful for proteins of two different polypeptides
Two Gene Expression Vector
Selectable Markers for Mammalian Systems
• Most commonly used to select for transformed cells (killing
non-resistant ones)
• Can be used for increasing expression of heterologous
proteins
Selective marker gene systems for mammalian cells
Use of Selectable Markers for Increasing Heterologous
Protein Production in Mammalian Systems
• Methotrexate (MTX ) inhibits dihydrofolate reductase (DHFR)
• DHFR -ve host cell with DHFR gene on cloning vector (i.e. linked
to target gene)
• Gradually increase MTX concentration in culture
• Gene copy number of DHFR and linked target gene increase to
compensate for inhibition of DHFR (more protein that is less
active gives cell enough metabolic through put to survive)
 However, this is the most expensive approach to recombinant protein
production, especially as the possible co-purification of viruses with
the protein means that rigorous quality control procedures must be
employed to ensure that the product is safe.
 The major problem with expressing genes in mammalian cells is that
expression levels like those we have discussed above are simply not
currently available.
 For many years protein production in mammalian cells has utilized
strong constitutive promoters to elicit transcription of target genes.
 Promoters, such as those derived from the SV40 early promoter, the
Rous sarcoma virus (RSV) long terminal repeat promoter and the
cytomegalovirus (CMV) immediate early promoter, will all
constitutively drive the expression of genes placed under their
control.
 Inducible systems can also be used e.g. heat-shock promoters or
glucocorticoid hormone inducible systems have been used to express
target genes (Wurm, Gwinn and Kingston, 1986; Hirt et al., 1992).
 These systems, however suffer from leaky gene expression in the
absence of induction and potentially damaging induction conditions.
 To overcome some of the problems of using endogenous promoters
to drive target gene expression, systems have been imported from
bacteria to control gene expression in mammalian cells.
Tet-on/Tet-off System
The control of transcriptional initiation is fundamentally
different between eukaryotes and prokaryotes.
An activator from prokaryotes is unable to bring about a
transcriptional response in eukaryotes and vice versa.
 DNA binding is, however, species independent.
The tightly regulated DNA binding properties of prokaryotic
activators can be used to direct eukaryotic activation domains
to drive the expression of target genes.
One such system exploits the DNA properties of the E. coli
tetracycline repressor.
• The E. coli tet operon was originally identified as a transposon
(Tn10) that confers resistance to the antibiotic tetracycline
(Foster et al., 1981).
• The TetR protein, in a similar fashion to the lac repressor protein
(LacI), binds to the operator of the tetracycline-resistance
operon and prevents RNA polymerase from initiating
transcription.
 Activation of the tetracycline-resistance operon occurs when
tetracycline itself binds to the repressor and induces a
conformational change that inhibits its DNA binding activity.
 The TetR protein has a very high affinity for the antibiotic
(association constant ∼3 × 10−9 M−1) and will dissociate from
its DNA binding site when tetracycline is present at low
concentrations (Takahashi, Degenkolb and Hillen, 1991).
 The regulated DNA binding activity of TetR cannot itself elicit a
transcriptional response in eukaryotes, but can if the protein is
fused to a eukaryotic transcriptional activator domain.
 The use of the tet system to drive target gene expression in
eukaryotes relies on the insertion of two recombinant DNA
molecules into the host cell.
 Regulator plasmid – produces a version of the E. coli
tetracycline repressor (TetR) that is fused to the transcriptional
activation domain of the herpes simplex virus VP16 protein.
The fusion protein is constitutively produced in the host cell
from the CMV promoter.
 Response plasmid – contains the target gene cloned
downstream of multimerised copies of the tetracycline
operator (tetO) DNA sequence that form a tetracycline
response element (TRE) cloned into a minimal CMV promoter
that is not, on its own, able to support gene activation.
Figure: Tetracycline
regulated gene
expression for protein
production in
mammalian cells.
 The Tet-off and Tet-
on systems differ in
their transcriptional
response to added
tetracycline.
 The Tet-off system
turns transcription
of the target gene
off in response to
tetracycline,
whereas the Tet-on
system, which
contains a mutant
version of TetR with
altered DNA binding
properties, activates
gene expression in
response to
tetracycline addition
• In the absence of tetracycline, the TetR-VP16 fusion protein will
bind to the TRE and activate transcription of the target gene.
• Upon the addition of tetracycline to the cells, however, TetR
will dissociate and target gene transcription will be turned off
(Gossen and Bujard, 1992).
• That is, the addition of tetracycline turns target gene
expression off.
• The use of the tet system has become more prevalent due to
the existence of a mutant version of TetR.
• The mutant tetracycline repressor contains four amino acid
changes (E71K, D95N, L101S and G102D) from the wild-type
protein that radically alter its DNA binding properties.
• Rather than tetracycline inhibiting its DNA binding properties,
the mutant protein, called rTetR for reverse tetracycline
repressor, will only bind DNA in the presence of tetracycline
(Gossen et al., 1995).
• This means that, with the appropriate TetR fusion to the
activation domain of VP16, target gene expression can either be
inhibited or activated in the presence of tetracycline.
• Tet-off uses the wild-type TetR protein fused to VP16. Target
gene expression is active in the absence of tetracycline but not
in its presence.
• Tet-on uses the mutant rTetR proteins fused to VP16. Target
gene expression is active in the presence of tetracycline but not
in its absence.
The advantage of this on and off switching system is that host
cells do not need to be exposed for long times to the antibiotic
prior to the induction of either gene expression or gene
silencing.
Additionally, the control over target gene activation achieved
using the Tet system is very tight. For example, transgenic mice
have been produced that carry the diptheria toxin A gene under
the control for a TRE promoter. Small quantities of the toxin,
perhaps as little as a single molecule, will lead to cell death.
When fed with water containing tetracycline, mice containing a
Tet-off version of the regulator in conjunction with the
diptheria toxin responder are healthy until tetracycline is
removed, when death ensues as a result of toxin production
(Lee et al., 1998).
Advantages:
 There are no examples of higher eukaryotic proteins, which
could not be made in detectable levels, and in a form identical
to the natural host (that includes all types of post-translational
modifications).
Disadvantages:
 Cultures characterized by lower cell densities and lower
growth rates.
 Maintenance and growing very expensive.
 Gene manipulations are very difficult.
 Mammalian cells might contain oncogenes or viral DNA, so
recombinant protein products must be tested more extensively
Pharming - recombinant protein from live animals
and plants
• The use of silkworms for recombinant protein production is an
example of the process Often referred to as pharming, where a
transgenic organism acts as the host for protein synthesis.
• Pharming is a recent and controversial innovation in gene
cloning.
Applications
• Eukaryotic expression systems are frequently employed for the
production of recombinant proteins as therapeutics as well as
research tools.
• Functional analysis of cloned genes.
• Gene cloning in yeast systems.
• Protein expression trials.
• Protein purification.
Recombinant Proteins
Successfully Produced in
S. cerevisiae
For a range of reasons as
expressed previously
each of these
represented a better
product than was
obtainable using a
prokaryotic expression
system
Examples of Proteins Successfully Produced by
Baculovirus Systems
Thanks
Acknowledgement: All the material/presentations available online on the subject
are duly acknowledged.
Disclaimer: The author bear no responsibility with regard to the source and
authenticity of the content.
Questions???

Expression vectors

  • 1.
    Expression Vectors Dr RaviKant Agrawal, MVSc, PhD Senior Scientist (Veterinary Microbiology) Food Microbiology Laboratory Division of Livestock Products Technology ICAR-Indian Veterinary Research Institute Izatnagar 243122 (UP) India
  • 2.
    Expression Vectors: Vectors thatcan yield the protein products of the cloned genes. Two elements that are required for active gene expression: a strong promoter and a ribosome binding site near an initiating ATG codon. The main function of an expression vector is to yield the product of a gene, therefore a strong promoter is necessary. The more mRNA is produced, the more protein product is made.
  • 3.
    Expression in E.coli E. coli is one of the most widely used expression host for protein expression. The techniques for expression in E. coli are well developed and work by increasing the number of copies of the gene or increasing the binding strength of the promoter region so assisting transcription. For example a DNA sequence for a protein of interest could be cloned or subcloned into a high copy- number plasmid containing the lac promoter, which is then transformed into the bacterium Escherichia coli. Addition of IPTG (a lactose analog) activates the lac promoter and causes the bacteria to express the protein of interest.
  • 4.
    Expression in E.coli: Advantages:  Rapid doubling time (approximately 30 min) Growth in simple defined (and inexpensive) media, An extensive knowledge of its promoter and terminator sequences Proteins of both prokaryotic and eukaryotic origin can be produced within the organism. Many proteins of prokaryotic are originated in E. coli due to E.coli cells are easily broken for the harvesting of proteins produced within the cell (Easy harvesting). Drawback: 1. E. coli cells are Unable to process introns and 2. Do not possess the extensive post-translational machinery (glycosylation, methylation, phosphorylation etc).
  • 5.
    In expression vectorvarious Genetic elements required are: 1. Origin of replication 2. Selective marker 3. Transcriptional promoter 4. Unique multiple cloning sites 5. Translational initiation regions (TIRs) 6. Translational terminator
  • 6.
  • 7.
    Origin of replication:Sequences that allow their autonomous replication within the cell. There are 2 types: 1) ColE1 replicon : - pBR322 (copy no. ~15-20) - pUC (copy no. ~500-700) 2) p51A replicon : -pACYC184 (copy no. ~10-12)
  • 8.
    Selective marker: sequencesencoding a selectable marker that assures maintenance of the vector in the host. • Ampicillin • Kanamycin interfere with • Chloramphenical protein synthesis • Tetracycline
  • 9.
    Transcriptional promoter: Promoter isa – • Region of DNA that control the transcription of a particular gene. • It locate upstream of the genes. • Recognizing site for RNA polymerase (sigma subunit). Good promoter should be: • Strong promoter: Accumulation of expressed protein up 10 to 30% or more of the total cellular protein. • Minimal basal expression level: Tight regulation of the promoter • Easily induction: Simple and cost effective manner
  • 10.
    Multiple cloning site: Itis defined as a short segment of DNA which contain many restriction sites (usually 20+). To simplify the insertion of the heterologous gene in the correct orientation within the vector. Translational initiation regions (TIRs): Located on the 5’-mRNA Translational terminator: Located on the 3’-mRNA Use of Rho-independent termination
  • 12.
    Some commonly usedexpression host-vector system and expression inducible expression system:
  • 13.
    Many different promotersequences have been used to illicit inducible protein production in E. coli 1. lac Promoter 2. tac Promoter 3. λPL Promoter 4.T7 Expression System
  • 14.
    Many different promotersequences have been used to induce protein production in E.coli. These are: The lac Promoter:  Lac prompter provides a mechanism for inducible gene expression.  Without lactose in the cell, the repressor protein binds to the operator and prevents the read of RNA polymerase into the three structural genes.  With lactose in the cell, lactose binds to the repressor. This causes a structural change in the repressor and it loses its affinity for the operator. Thus RNA polymerase can bind to the promoter and transcribe the structural genes.  In this system lactose acts as an effector molecule.  Fusing the lac promoter sequence to another gene will result in the lactose-(or IPTG-) dependent expression of that gene.
  • 15.
    Control Circuit forthe lac Operon: I P O || Z | Y | A | controlling region ǁ structural genes lac Operon Gene Gene function • I Gene for repressor protein • P Promoter • O Operator • lac Z Gene for ß-galactosidase • lac Y Gene for ß-galactoside permease • lac A Gene for ß-galactoside transacetylase Operon - a cluster of structural genes that are expressed as a group and their associated promoter and operator
  • 17.
    The lac operonpromoter (which regulates the transcription of lacZ, not lacI) (a) Presented so that the genome sequence numbers increase from left to right. Its 5' to 3' sequence is the same as in the database (ACCESSION AE000141). (b) Presented so that the promoter sequence numbers increase from left to right. Its 5' to 3' sequence is comparable to the consensus sequence.
  • 18.
    lac promoter- lactose-(or IPTG- isopropylthiogalactoside) inducible Problems with lac promoter- 1. Weak 2. Leaky expression mutant versions of the lacI gene : lacIq allele increased DNA binding overproduction of LacI reduced level of transcription in the absence of inducer
  • 19.
    The tac Promoter: Thelac promoter is weak because the - 35 region deviates from the consensus. The creation of a fusion sequence containing the -35 region of the E. coli trp operon and the -10 region of the lac operon controlling the expression of the genes responsible for tryptophan biosynthesis and lactose metabolism which results in the formation of the tac promoter. The tac promoter is 5 times stronger then lac promoter. Expression vectors that carry the tac promoter also carry the lacO operator and usually the lacI gene encoding the Lac repressor. Because of this, these vectors are IPTG inducible and can be repressed and induced in a variety of E. coli strains.
  • 20.
    -35 CONSENSUS -10CONSENSUS 5’-TTGACA-3’ 5’-TATAAT-3’ Lac : 5’-…TTTACAC…..TCCGGCTCGTATATTGTGT…………..CAGGAAACAGCT ATG…-3’ _______ ______ _____ ______ -35 -10 RBS Protein Trp : 5’-…TTGACAATTAATCATCGAAC….TTAACTAG………….AAAGGGTAT…….ACA ATG…-3’ _______ _______ _____ ______ -35 -10 RBS Protein Tac : 5’-…TTGACAATTAATCATCGGCTCGTATATTGTGT………AGGAAACAGCGG ATG…-3’ _______ ______ _____ ______ -35 -10 RBS Protein DNA sequence of lac, trp and tac promoter. The consensus E. coli -35 and -10 sequence based on the analysis of naturally occurring promoters are shown and the sequence of each of the promoters, extending from the -35 region to translational start site, are shown. The tac promoter is a hybrid of the trp and lac promoter. The -35 and -10 region contains closely resemble the consensus sequences. The tac promoter is able to induce the expression of target genes such that encoded polypeptide can accumulate at the level of 20-30% of the total cell protein.
  • 21.
    3. The λPlPromoter:  This is responsible for transcription of left-hand side of the λ genome, including N and cIII.  Λ repressor which is the product of the cI gene, repress the promoter. Two basic methods are used to activate this promoter.  Transform the expression vector into an E. coli strain in which the cI gene has been placed under the control of tightly regulated trp promoter.  Then expression of the target gene can be induced by the addition of tryptophan to the growth media, which will prevent transcription of the cI gene and consequently activate the strong λ Pl promoter.  This system can be used to express highly toxic proteins. The λPL promoter - transcription of the left-hand side of the λ genome, including N and cIII
  • 22.
    One way: expression vector TransformIn E. coli strain (cI gene under control of trp promoter) Expression of the target gene - By addition of tryptophan Advantage- Tightly controlled system so can be use for highly toxic proteins cI gene - λ repressor, The λPL Promoter Activation of the λPL promoter.
  • 23.
    1. Temperature-sensitive mutantof cI (Ci857) above 30 ◦C mutan λ repressor λPL for the expression -target genes . Advantage-high levels of target gene expression, Disadvantage- Heat pulse difficult to control Other way:
  • 25.
    4. The T7Expression System-  It is different from its E. coli counterpart. E. coli enzyme- Has a α2β2 subunit structure T7 RNA polymerase- Binds to DNA 17 bp promoter sequences (5- TAATACGACTCACTATA-3) found upstream of the T7 viral gene it activates. bacteriophage T7 RNA polymerasesingle-subunit
  • 26.
    T7 promoter .Thetarget gene plasmid wild-type no expression E. coli strain lac promoter T7 RNA polymerase T7 gene 1 expression of the target gene. To control the leaky production of T7 RNA polymerase (thereby ensuring that target gene expression is minimized), E. coli cells co-transformed With The plasmid pLysS -T7 lysozyme, natural inhibitor of T7 RNA polymerase.
  • 27.
    The T7 ExpressionSystem: pET vector system The pET System is the most powerful system yet developed for the expression of recombinant proteins in E. coli. Translation signals; expression is induced by providing a source of T7 RNA polymerase in the host cell. T7 RNA polymerase is so selective and active that, when fully induced, almost all of the cell’s resources are converted to target gene expression. The desired product can comprise more than 50% of the total cell protein a few hours after induction. pET vector: – T7 promoter for expression – lac O, lac I : tighter regulation of transcription – origin of replication : pBR322 – selectable marker : Ampr – ccdB : control of cell death – RBS : ribosome binding site – Start codon : ATG – Tag, Fusion : 6xHis, V5 Epitope, GST – T7 terminator
  • 28.
     The expressionvector (pET) contain the target gene under the control of T7 (RNA polymerase) promoter.  The vector is transformed into an E. coli strain that contains a copy of gene for T7 RNA polymerase gene under the control of the lac promoter (BL21 DE3).  The promoter for both the target gene and T7 RNA polymerase gene, also contain the lacO operator sequence and therefore inhibited by the lac repressor(lacI).  IPTG induction allows the transcription of the T7RNA polymerase gene whose protein product activates the expression of target gene. After induction sufficient T7 RNA polymerase is produced.
  • 31.
    Expression in Yeast Advantages- 1.Easy to manipulate as E. coli 2. Yeast cell growth is faster, easier and less expensive than other eukaryotic cells 3. Post-translational modifications 4. Gives higher expression levels. Three main species of yeast are used for the production of recombinant proteins – 1. Saccharomyces cerevisiae 2. Pichia pastoris and 3. Schizosaccharomyces pombe
  • 32.
    Baker’s yeast, S.cerevisiae, is- A single-celled eukaryote that grows rapidly (a doubling time of approximately 90 min) in simple, defined media similar to those used for E. coli cell growth. Advantage: Many, but not all, of the post-translation modifications found in higher eukaryotic cells. A number of constitutive promoters for the genes encoding phosphoglycerate kinase (PGK), glyceraldehyde-3-phosphate dehydrogenase (GPD) and alcohol dehydrogenase (ADH1) have been used to produce target proteins, however, these suffer with similar problems as constitutive E. coli expression. 02 Systems have been utilized for inducible expression. Saccharomyces cerevisiae
  • 33.
    1. The GALsystem – In yeast, galactose is converted to glucose -6- phosphate by the enzymes of the Leloir pathway. Each of the Leloir pathway structural genes (collectively called Gal genes) are expressed at a high levels, representing 0.5-1% of the total cellular RNA but ONLY when the cells are grown on galactose as the sole carbon source. Each of the gal genes contains within its promotor at least one or multiple binding sites for the transcriptional activator Gal4p. The binding of Gal4p and its transcriptional activity when bound is regulated by the source of carbon available. When yeast is grown on glucose, transcription of Gal4p is down regulated, so there is less Gal4p and reduced level of activator binding at the promotors of the Gal structural genes. To produce a target protein in S. cerevisiae using galactose induction, the gene encoding the protein must be cloned so that it is under the control of a Gal promotor. The promotor for Gal1 gene encoding galactokinase is most commonly used. Synthestic promotors containing multiple Gal4p binding sites are also available.
  • 34.
    Expression vector istransformed in to yeast cells and protein production is initiated by switching the cells to a galactose containing medium. Protein produced by these methods is usually in low abundance and maximum production may represent 1-5% of the total cell protein. Therefore detection by CBB R 250 ot possible and require western blotting Additional difficulty is brought about by the activator of the GAL genes i.e. Gal4p which is normally present in the yeast cells at very low level. Therefore if expression vector which carries multiple Gal4p binding sites, as a high copy number plasmid, there may not be sufficient Gal4p to activate the expression of all the available target genes to a maximum level. To overcome this yeast strains have been constructed in which the coding sequence of the Gal4 gene has been placed under the GAL promotor control. This results in feedback loop in which induction by galactose results in the production of Gal4p so that more of the target gene may be expressed.
  • 35.
    GAL genes Promoterone / more binding site for transcriptional activator Gal4p Binding of Gal4p to these sites and its transcriptional activity when bound, is regulated by the source of carbon galactose ( galactose in medium) Structural genes (GAL genes) 0.5-1 per cent of the total cellular mRNA Leloir pathway enzymes glucose-6-phosphate
  • 36.
    Less GAL structural genes yeast Glucose(preferred carbon source) less Gal4p raffinose, production Gal4p Gal80p, inhibits
  • 37.
     Galactose induciblegene expression in yeast.  The expression of genes from multicopy vectors under the control of the GAL1 promoter (PGAL1) can be increased substantially if the gene encoding the transcriptional activator of GAL1, GAL4, is also placed under the control of PGAL1.  In this case, induction by galactose will produce more Gal4p and consequently more of the target protein
  • 38.
    2.The CUP1 System: Copperions (Cu2+ and Cu3+) are essential at appropriate levels, yet toxic at higher levels in all living MOs. Cells must maintain a proper level of copper ions Copper homeostasis in S. cerevisiae involves Distribution Uptake, Detoxification mechanisms. At High concentrations, copper ion detoxification is mediated by a copper ion sensing metelloregulatory transcription factor called Ace1p. Upon interaction with copper, Ace1p binds DNA upstream of the CUP1 gene, which encodes a metallothionin protein and induces its transcription. The transcription of CUP1 is induced rapidly by addition of exogenous copper to the medium. Expression vectors harbouring CUP1 promotor can therefore be used to induce target gene expression in copper dependent fashion.
  • 39.
    Cu ions Ace1p CUP1 gene metallothionein Advantage:Can be grown on rich carbon sources, such as glucose, to high cell density, and protein production is initiated by the addition of copper sulphate (0.5 mM final concentration) to the cultures. Drawback- Due to presence of copper ions in yeast growth media, and indeed in water supplies. Therefore off state in the absence of added copper may still yield significant levels of protein production
  • 40.
    Pichia pastoris Pichia pastorisis a methylotropic yeast capable of metabolizing methanol as its sole carbon source. First step is oxidation of methanol to formaldehyde using molecular o2 utilizing alcohol oxidase (AOX1). Alcohol oxidase has poor affinity for O2 and Pichia pastoris compensates it by producing large amounts of Alcohol oxidase. Therefore, the promotor regulating the production of Alcohol oxidase may be utilized to drive heterologous protein expression in Pichia pastoris since it is tightly regulated and induced by methanol to very high levels. P. pastoric cells containing expression vector, which is usually integrated into the genome as single or multiple copies are grown in gycerol (growth on glucose represses AOX1 transcription, even in the presence of methanol), to extremely high cell density prior to addition of methanol. Once induced, target protein may accumulate at very high levels, often ranging from 0.5-10’s of grams per litre of yeast culture e.g. HBsAg is produced 1g/litre.
  • 41.
    Methylotrophic yeast methanol formaldehyde O2 alcoholoxidase (AOX1 gene) Advantages- Tightly regulated High levels protein production P. pastoris has advantage of glycosylation of secreted proteins Glycoproteins produced in P. pastoris resmble closely the glycoprotein structure of those found in higher eukaryotes.
  • 42.
    Schizosaccharomyces pombe:  Singlecell eukaryotic organism  The properties like codon usage, chromosomal structure and function, cell cycle control and RNA spilcing suggest that S. pombe is an ideal candidate for production of eukaryotic proteins.  Additionally, eukaryotic proteins produced in S. pombe are more likely to be folded properly which reduce protein insolubility.  Protein production in S. pombe is usually controlled by nmt1 promotor.  This promotor is active when cells are grown in absence of thiamine.  In the presence of more than 0.5 uM thiamine, promotor is turned off.  Overall protein production levels- similar to S. cerevisiae. Advantages- expressed proteins are folded properly Solubility more No message in thiamine (nmt1) promoter thiamine > 0.5 μM thiamine, the promoter is turned off.
  • 43.
    Using animal cellsfor recombinant protein production The difficulties inherent in synthesis of a fully active animal protein in a microbial host have prompted biotechnologists to explore the possibility of using animal cells for recombinant protein synthesis. For proteins with complex and essential glycosylation structures, an animal cell might be the only type of host within which the active protein can be synthesized.
  • 44.
    Insect Cell ExpressionSystem • Higher Eukaryotic system than yeast - more complex post- translational modifications . • Folding of mammalian proteins - soluble protein mammalian origin. • The most commonly used vector system - baculovirus. The benefits of protein expression with baculovirus are: Eukaryotic post-translational modification Proper protein folding and function High expression levels
  • 45.
    Expression in InsectCells The expression system is based on the baculoviruses, a group of viruses that are common in insects (& insect cell lines) but do not normally infect vertebrates. The baculovirus genome includes the polyhedrin gene, whose product accumulates in the insect cell as large nuclear inclusion bodies toward the end of the infection cycle . The product of this single gene frequently makes up over 50% of the total cell protein. Similar levels of protein production also occur if the normal gene is replaced by a foreign one. Baculoviruses - rod-shaped viruses. Nuclear polyhedrosis viruses (NPV) - occlusion bodies (polyhedrin). The polyhedrin gene is transcribed at very high levels late in the infection process (3-5 d post-infection). The polyhedrin promoter can be used to drive target gene expression.
  • 46.
    Baculoviruses are rod-shaped virusesthat infect insects and insect cell lines. They have double-stranded circular DNA genomes in the range of 90–180 kbp (Ayres et al., 1994). Viral infection results in cell lysis, usually 3–5 d after the initial infection, and the subsequent death of the infected insect. The NUCLEAR POLYHEDROSIS VIRUSES are a class of baculoviruses that produce occlusion bodies in the nucleus of infect cells. These occlusion bodies consist primarily of a single protein, polyhedrin, which surrounds the viral particles and protects them from harsh environments. Crystalline inclusion bodies in the nuclei of insect cells infected with a baculovirus.
  • 47.
    Most viruses ofthis type need to be eaten by the insect before infection will occur, and the occlusion body protects the viral particles from degradation in the insect gut. The polyhedrin gene is transcribed at very high levels late in the infection process (2–4 d post-infection). In cultured insect cells, the production of inclusion bodies is not essential for viral infection or replication. Consequently, the polyhedrin promoter can be used to drive target gene expression. The baculovirus Autographa californica nuclear polyhedrosis virus (AcNPV) has become a popular tool of the production recombinant proteins in insect cells (Fraser, 1992). It is used in conjunction with insect cell lines derived from the moth Spodoptera frugiperda. These cell lines (e.g. Sf9 and Sf21) are readily cultured in the laboratory.
  • 48.
    The size ofthe baculoviral genome generally precludes the cloning of target genes directly onto it. Instead, the target gene is cloned downstream of the polyhedrin promoter in a transfer plasmid (Lopez-Ferber, Sisk and Possee, 1995). The transfer plasmid also contains the sequences of baculovirus genomic DNA that flank the polyhedrin gene, both upstream and downstream. To produce recombinant viruses, the recombinant transfer plasmid is co-transfected with linearized baculovirus vector DNA into insect cells. The flanking regions of the transfer plasmid participate in homologous recombination with the viral DNA sequences and introduce the target gene into the baculovirus genome. The recombination process also results in the repair of the circular viral DNA and allows viral replication to proceed through the re-formation of ORF1629 (a viral capsid associated protein that is essential for the production of viral particles). Recombinant viral infection can be observed microscopically by viewing viral plaques on a lawn of insect cells.
  • 49.
    Plaques containing recombinantvirus will be unable to form occlusion bodies due to the lack of a functional polyhedrin protein (Smith, Summers and Fraser, 1983). Screening plaques this way is, however, technically difficult. Therefore, the transfer plasmids also usually contain the lacZ gene, or another readily observable reporter gene, which allows for the visual identification of recombinant plaques by their blue appearance after staining with X-Gal. Following transfection and plaque purification to remove any contaminating parental virus, a high-titre virus stock is prepared, and used to infect large-scale insect cell culture for protein production. The infected cells undergo a burst of target protein production, after which the cells die and may lyse. Protein production in baculovirus infected insect cells has the advantage that very high levels of protein can be produced relative to other eukaryotic expression systems, and that the glycosylation pattern obtained is similar, but not identical, to that found in higher eukaryotes (Possee, 1997; Joshi et al., 2000). Baculoviruses also have the advantage that multiple genes can be expressed from a single virus. This allows the production of protein complexes whose individual components may not be stable when expressed on their own (Roy et al., 1997 ).
  • 50.
     Baculovirus isa very large DNA virus (genome of about 150 kb) that infects insect cells.  To express a foreign gene in baculovirus, the gene of interest is cloned in place of the viral coat- protein gene in a plasmid carrying a small part of the viral genome.  The recombinant plasmid is cotransfected into insect cells with wild-type baculovirus DNA.  At a low frequency, the plasmid and viral DNAs recombine through homologous sequences, resulting in the insertion of the foreign gene into the viral genome.  Virus plaques develop, and the plaques containing recombinant virus look different because they lack the coat protein.  The plaques with recombinant virus are picked and expanded.  This virus stock is then used to infect a fresh culture of insect cells, resulting in high expression of the foreign protein. Baculovirus Expression System
  • 51.
    The production ofa recombinant baculoviral genome for the production of proteins in insect cells.  The target gene is cloned under the control of the polyhedrin promoter into a transfer vector that also contains regions of the viral genome that flank the polyhedrin locus.  The vector is then co- transfected into insect cells with a viral genome that has been linearized using restriction enzymes (RE) that cut in several places.  Homologous recombination between the linear genome and the vector will result in formation of a functional viral genome that is capable of producing viral particles.  The inclusion of lacZ in the transfer vector allows for visual screening of viral plaques to identify recombinants
  • 52.
     The maindisadvantages of producing proteins in this way is that the construction and purification of recombinant baculovirus vectors for the expression of target genes in insect cells can take as long as 4–6 weeks, and that the cells grow slowly (increasing the risk of contamination) in expensive media.  An alternative approach to recombinant viral genome production uses site-specific transposition in E. coli rather than homologous recombination in insect cells (Luckow et al., 1993 ). E. coli Baculovirus Shuttle Vector - Bacmids
  • 53.
    • It isbased on site-specific transposition of an expression cassette into a baculovirus shuttle vector (bacmid) propagated in E. coli. • The bacmid contains the entire baculovirus genome, a low-copy number E. coli F-plasmid origin of replication and the attachment site for the bacterial transposon Tn7. • The bacmid propagates in E. coli as a large plasmid. • Recombinant bacmids are constructed by transposing a Tn7 element from a donor plasmid, which contains the target gene to be expressed, to the attachment site on the bacmid – a helper plasmid encoding the transposase is required for this function. • The recombinant bacmid can be isolated from E. coli and transfected directly into insect cells.
  • 54.
    E. coli BaculovirusShuttle Vector - Bacmids •Shuttle vectors allow ease of transfer between systems •Genetic manipulations in one system, expression in another
  • 55.
    Advantages • The polyhedringene is not required for the continuous production of infectious virus in insect cell culture. Its sequence is replaced with that of the heterologous gene. • The polyhedrin gene promoter is very strong. This determines a very high level of production of recombinant protein. • Very late expression allows for the production of very toxic proteins. • This system is capable of post-translational modifications.
  • 56.
    Disadvantages  Expensive.  Glycosylationin insect cells is different (insect cells unable to produce complex N-linked side chains with penultimate galactose and terminal sialic acid) from that in vertebrate cells, therefore, a problem for therapeutic proteins.  A large fraction of the RP can be poorly processed and accumulates as aggregates.  Discontinuous expression: baculovirus infection of insect cells kills the host and hence the need to re-infect fresh cultures for each round of protein synthesis.  Inefficient for production on a commercial scale
  • 57.
    Modifying the InsectCell Host  Genetic engineering of the host for proper expression  Add missing glycosylation enzymes  Add proteolytic processing enzymes
  • 58.
    Expression in Higher-EukaryoticCells For the production of mammalian proteins, mammalian cells have an obvious advantage. Mammalian cell lines derived from humans or hamsters have been used in synthesis of several recombinant proteins, and in most cases these proteins have been processed correctly and are indistinguishable from the non-recombinant versions. Two modes of expression - transient and stable. Three cell types are dominant in transient expression: human embryonic kidney (HEK), COS and baby hamster kidney (BHK), whilst CHO (Chinese hamster ovary) cells are used predominantly for stable expression. Note: The acronym "COS" is derived from the cells being CV-1 (simian) in Origin, and carrying the SV40 genetic material.[2] Two forms of COS cell lines commonly used are COS-1 and COS-7.
  • 59.
    Mammalian expression vectors Eukaryoticorigin of replication is from an animal virus: e.g. Simian virus 40 (SV40). Popular markers for selection are the bacterial gene Neor (encodes neomycin phosphotransferase), which confers resistance to G418 (Geneticin), and the gene, encoding dihydropholate reductase (DHFR). When DHFR is used, the recipient cells must have a defective DHFR gene, which makes them unable to grow in the presence of methotrexate (MTX), unlike transfected cells with a functional DHFR gene. Promoter sequences that drive expression of both marker and cloned heterologous gene, and the transcription termination (polyadenyation signals) are usually from animal viruses (human CMV, SV40, herpes simplex virus) or mammalian genes (bovine growth hormone, thymidine kinase).
  • 60.
    Mammalian Expression Vector “I” is an intron that enhances expression  Other signals similar to insect and prokaryotic vectors
  • 61.
    Translation Control Elements K - Kozak Sequence (equivalent to RBS)  S - For secretion signal peptide  T - tag peptide for purification  P - Proteolytic cleavage sequence  SC - Stop codon for translation  3’UTR - proper sequences for efficient translation and mRNA stability (e.g. polyadenylation sequence)
  • 62.
    Two Vector ExpressionSystem • Useful for proteins of two different polypeptides
  • 63.
  • 64.
    Selectable Markers forMammalian Systems • Most commonly used to select for transformed cells (killing non-resistant ones) • Can be used for increasing expression of heterologous proteins
  • 65.
    Selective marker genesystems for mammalian cells
  • 66.
    Use of SelectableMarkers for Increasing Heterologous Protein Production in Mammalian Systems • Methotrexate (MTX ) inhibits dihydrofolate reductase (DHFR) • DHFR -ve host cell with DHFR gene on cloning vector (i.e. linked to target gene) • Gradually increase MTX concentration in culture • Gene copy number of DHFR and linked target gene increase to compensate for inhibition of DHFR (more protein that is less active gives cell enough metabolic through put to survive)
  • 67.
     However, thisis the most expensive approach to recombinant protein production, especially as the possible co-purification of viruses with the protein means that rigorous quality control procedures must be employed to ensure that the product is safe.  The major problem with expressing genes in mammalian cells is that expression levels like those we have discussed above are simply not currently available.  For many years protein production in mammalian cells has utilized strong constitutive promoters to elicit transcription of target genes.  Promoters, such as those derived from the SV40 early promoter, the Rous sarcoma virus (RSV) long terminal repeat promoter and the cytomegalovirus (CMV) immediate early promoter, will all constitutively drive the expression of genes placed under their control.  Inducible systems can also be used e.g. heat-shock promoters or glucocorticoid hormone inducible systems have been used to express target genes (Wurm, Gwinn and Kingston, 1986; Hirt et al., 1992).  These systems, however suffer from leaky gene expression in the absence of induction and potentially damaging induction conditions.  To overcome some of the problems of using endogenous promoters to drive target gene expression, systems have been imported from bacteria to control gene expression in mammalian cells.
  • 68.
    Tet-on/Tet-off System The controlof transcriptional initiation is fundamentally different between eukaryotes and prokaryotes. An activator from prokaryotes is unable to bring about a transcriptional response in eukaryotes and vice versa.  DNA binding is, however, species independent. The tightly regulated DNA binding properties of prokaryotic activators can be used to direct eukaryotic activation domains to drive the expression of target genes. One such system exploits the DNA properties of the E. coli tetracycline repressor. • The E. coli tet operon was originally identified as a transposon (Tn10) that confers resistance to the antibiotic tetracycline (Foster et al., 1981). • The TetR protein, in a similar fashion to the lac repressor protein (LacI), binds to the operator of the tetracycline-resistance operon and prevents RNA polymerase from initiating transcription.
  • 69.
     Activation ofthe tetracycline-resistance operon occurs when tetracycline itself binds to the repressor and induces a conformational change that inhibits its DNA binding activity.  The TetR protein has a very high affinity for the antibiotic (association constant ∼3 × 10−9 M−1) and will dissociate from its DNA binding site when tetracycline is present at low concentrations (Takahashi, Degenkolb and Hillen, 1991).  The regulated DNA binding activity of TetR cannot itself elicit a transcriptional response in eukaryotes, but can if the protein is fused to a eukaryotic transcriptional activator domain.  The use of the tet system to drive target gene expression in eukaryotes relies on the insertion of two recombinant DNA molecules into the host cell.
  • 70.
     Regulator plasmid– produces a version of the E. coli tetracycline repressor (TetR) that is fused to the transcriptional activation domain of the herpes simplex virus VP16 protein. The fusion protein is constitutively produced in the host cell from the CMV promoter.  Response plasmid – contains the target gene cloned downstream of multimerised copies of the tetracycline operator (tetO) DNA sequence that form a tetracycline response element (TRE) cloned into a minimal CMV promoter that is not, on its own, able to support gene activation.
  • 71.
    Figure: Tetracycline regulated gene expressionfor protein production in mammalian cells.  The Tet-off and Tet- on systems differ in their transcriptional response to added tetracycline.  The Tet-off system turns transcription of the target gene off in response to tetracycline, whereas the Tet-on system, which contains a mutant version of TetR with altered DNA binding properties, activates gene expression in response to tetracycline addition
  • 72.
    • In theabsence of tetracycline, the TetR-VP16 fusion protein will bind to the TRE and activate transcription of the target gene. • Upon the addition of tetracycline to the cells, however, TetR will dissociate and target gene transcription will be turned off (Gossen and Bujard, 1992). • That is, the addition of tetracycline turns target gene expression off. • The use of the tet system has become more prevalent due to the existence of a mutant version of TetR.
  • 73.
    • The mutanttetracycline repressor contains four amino acid changes (E71K, D95N, L101S and G102D) from the wild-type protein that radically alter its DNA binding properties. • Rather than tetracycline inhibiting its DNA binding properties, the mutant protein, called rTetR for reverse tetracycline repressor, will only bind DNA in the presence of tetracycline (Gossen et al., 1995). • This means that, with the appropriate TetR fusion to the activation domain of VP16, target gene expression can either be inhibited or activated in the presence of tetracycline.
  • 74.
    • Tet-off usesthe wild-type TetR protein fused to VP16. Target gene expression is active in the absence of tetracycline but not in its presence. • Tet-on uses the mutant rTetR proteins fused to VP16. Target gene expression is active in the presence of tetracycline but not in its absence.
  • 75.
    The advantage ofthis on and off switching system is that host cells do not need to be exposed for long times to the antibiotic prior to the induction of either gene expression or gene silencing. Additionally, the control over target gene activation achieved using the Tet system is very tight. For example, transgenic mice have been produced that carry the diptheria toxin A gene under the control for a TRE promoter. Small quantities of the toxin, perhaps as little as a single molecule, will lead to cell death. When fed with water containing tetracycline, mice containing a Tet-off version of the regulator in conjunction with the diptheria toxin responder are healthy until tetracycline is removed, when death ensues as a result of toxin production (Lee et al., 1998).
  • 76.
    Advantages:  There areno examples of higher eukaryotic proteins, which could not be made in detectable levels, and in a form identical to the natural host (that includes all types of post-translational modifications). Disadvantages:  Cultures characterized by lower cell densities and lower growth rates.  Maintenance and growing very expensive.  Gene manipulations are very difficult.  Mammalian cells might contain oncogenes or viral DNA, so recombinant protein products must be tested more extensively
  • 77.
    Pharming - recombinantprotein from live animals and plants • The use of silkworms for recombinant protein production is an example of the process Often referred to as pharming, where a transgenic organism acts as the host for protein synthesis. • Pharming is a recent and controversial innovation in gene cloning.
  • 78.
    Applications • Eukaryotic expressionsystems are frequently employed for the production of recombinant proteins as therapeutics as well as research tools. • Functional analysis of cloned genes. • Gene cloning in yeast systems. • Protein expression trials. • Protein purification.
  • 79.
    Recombinant Proteins Successfully Producedin S. cerevisiae For a range of reasons as expressed previously each of these represented a better product than was obtainable using a prokaryotic expression system
  • 80.
    Examples of ProteinsSuccessfully Produced by Baculovirus Systems
  • 81.
    Thanks Acknowledgement: All thematerial/presentations available online on the subject are duly acknowledged. Disclaimer: The author bear no responsibility with regard to the source and authenticity of the content. Questions???