This document summarizes a study evaluating the efficacy of differentiating mouse embryonic stem cells (mESCs) into hepatocyte-like cells. The researchers found that cell cycle synchronization of mESCs prior to differentiation led to decreased expression of the pluripotency marker Oct4 and increased expression of endoderm and hepatic progenitor markers, indicating improved differentiation. Assays of stem cell-derived hepatocyte-like cells showed production of the liver proteins albumin and urea, though urea levels decreased over time, suggesting further optimization is needed to generate fully functional hepatocytes from mESCs. The researchers concluded cell cycle synchronization enhanced differentiation but that identifying additional progenitor factors could improve hepatic function of the derived cells.

1. TEMPLATE DESIGN © 2008
www.PosterPresentations.com
Evaluating the Efficacy of Hepatocyte-like cells from Mouse Embryonic Stem Cells (mESCs)
Abstract Results Discussion
Conclusion
Illustration of the Primer sets used for Undifferentiated, Endoderm/Hepatic
progenitor, Primitive endoderm cells, and Housekeeping
Acknowledgements
Objective
Materials and Methods
A. Hasegawa
Department of Life Science (Multidisciplinary) McGill University Montreal, QB
Undifferentiated cells
OCT4
left ctgcagaaggagctagaaca
right gctagttcgctttctcttcc
SOX2
left gagaaggggagagattttca
right tagtcccccaaaaagaagtc
NANOG
left agccctgattcttctaccag
right tagctcaggttcagaatgga
Endoderm & Hepatic
progenitor
SOX17
left tacacacaacctccagcttt
right gtgctgctcattgtatccat
Foxa2
left gagaggctgagtggagactt
right gacttttctgcaacaacagc
AFP
left agcaaaatagcagagtgctg
right ttgtcctgacatccaggtag
ALB
left cctagtcctgattgcctttt
right gtacagcagtcagccagttc
Primitive endoderm SOX7
left aacttctgggagacatggat
right ctccattcctccagctctat
Housekeeping
B-actin
left ctgaagtaccccattgaaca
right gtacgaccagaggcatacag
GAPDH
left gacatcaagaaggtggtgaa
right ctgttgctgtagccgtattc
For the qPCR
Figure 1: Results of Cycle Threshold (ddCT) of
Experimental Samples after Normalization with d0
Figure 2: Results of Cycle Threshold (ddCT) of Control
Samples after Normalization with d0
Figure 3: Results of Cycle Threshold
(ddCT) of Foxa2 (an endoderm
progenitor transcription factor) after
normalization with d0
Figure 4: Results of Cycle Threshold (ddCT) for
Co-culture treated plates; comparing initiating the
activation of the transcription factors with results 7
days later
For Urea and Albumin ELISA Assays
Mouse embryonic stem cells (mESCs) are cells that are derived from the inner cell mass (ICM) of a developing fertilized
mouse embryo. These cells are obtained from a developing blastula, 4-5 days after fertilization.
Embryonic stem cells are commonly used in research due to their pluripotent nature and their ability to replicate
indefinitely. Embryonic stem cells have the ability to differentiate into any type of cell except from cells that make up
placental tissue. Their pluripotent nature makes them versatile to conduct experiments on individual cells or on tissue.
When they are left undifferentiated, mESCs are able to continue replicating indefinitely as long as they are provided
with the proper environmental conditions.
In our project, we are looking at the proper differentiation of mESCs into endodermic tissue, specifically hepatocytes.
Currently, researchers have a substantial understanding of early primer genes required for endodermic differentiation.
For instance, we know that Oct4 gene is present in undifferentiated cells, whereas Sox17, Foxa2, and AFP are present
in primary endodermic progenitor cells. We use B-actin as a housekeeping gene, because it is present in all stages of
cells and will help eliminate any background signals that may be produced.
We will use two different methods to test the efficacy of the mESC-derived hepatocyte-like cells:
1.qPCR on Hepatocytes-like cells and Co-culture plates: use a cDNA replication method to test the hepatocyte-like
cells and co-culture plates for the presence of common hepatocyte primers: Sox17, AFP, Foxa2 and Oct4. Use B-
actin as a housekeeping gene.
2.Co-culture plates: form hepatocyte/collagen sandwich plates and add mESC cells to the surface; take samples after
14 days and test if cells have differentiate into hepatocyte-like cells. We will test these cells using an Albumin ELISA
assay and a Urea Assay in order to make sure the cells are functioning metabolically correctly.
Objective 1: qPCR, we used Invitrogen™ SuperScript II First-Strand synthesis SuperMix for qRT-PCR (cat. No 11752-050) and
Platinum SYBR Green qPCR SuperMix-UDG with Rox (cat no. 11744-100) in order to conduct our experiments (look in
Attachments for procedures of the two kits
Preparing samples
We had 2 sets of 12 well plates (6 experiment, 6 control). We wanted to prove that the efficacy mESC differentiated hepatocytes
increases when cell cycle synchronization occurs initially. We have two sets of groups (Experiment: cell cycle synchronized via
serum starvation; Control: cells grown without synchronization.
Cell seeding
*note sample lysating occurs using RNAse H before plating (d0)
1.Plate cells at 10,000 cells/cm2 in gelatin coated 12 well plates; incubate overnight (24 hrs); take sample (d1)
Cell cycle synchronization
2. Synchronization of the cell cycle occurs by adding Activin incubating them in serum free media overnight (24 hrs); Sample
cell lysates (Experiment and Control) at end of synchronization (d2)
Induce endoderm differentiation
3.Add 100 ng/ml activin A into the media for 3 days; take sample cell lysate (experiment and control) at end of activin
treatment (d5)
* Activin is a protein complex that triggers increase FSH levels and differentiation
4. Add 50 ng/ml of basic fibroblast growth factor (bFGF) into media for 2 days
Images obtained from Basak Uygun, Center for Engineering in Medicine
Objective 2: For preparing the Hepatocytes: We want to create an ex vivo model of endodermic tissue. We will create
a sandwich within each of the wells comprise of collagen/Dulbecco's Modified Eagle Medium (DMEM) layered with
primary hepatocytes. On top of the hepatocytes, we will layer another coat of collagen/DMEM. We will layer mESC
cells on top of the sandwich for each plate and take samples of each of the wells over the course of two weeks.
We will use two different assays in order to testing metabolic processes in our stem cell derived hepatocytes. First, we
will conduct a Urea Assay; urea is a by-product of waste produce by hepatocytes. Second, we will conduct an Albumin
ELISA assay. Albumin is the most important protein produced by Hepatocytes and is vital for hepatocyte viability.
For the albumin assay, we used an in-house protocol.
Coating plates
Prepare 10 ml/plate of albumin at 50 µg/ml in PBS + 1 ml extra
Add 100 µl of the albumin solution to each well of the plate.
Cover with adhesive plate sealer.
Incubate at 4ºC overnight
Prepare standards
Make a concentrated stock solution in PBS of approximately 1 mg/ml
Dilute to 50 µg/ml in culture medium (make 2 ml).
Dilute 100 µg/ml solution to make 1 ml each of (100, 50, 25, 12.5, 5, 1, 0.5, 0) µg/ml in culture medium.
Prepare antibody solution
Thaw one vial of albumin antibody from -80ºC freezer.
Prepare needed volume of solution of 1:10000 in PBS –Tween. 5 ml per plate is needed, plus a little extra.
Prepare plate.
Empty plate and wash 4x100 µl with PBS-Tween.
Add 50 µl of sample or standard per well.
Each plate must have standards.
Both samples and standards should be done in triplicate.
Add 50 µl of antibody solution to each well.
Cover with adhesive plate sealer.
Incubate overnight at 4ºC or 1.5 hrs at 37ºC.
Develop plate
Substrate is dangerous. Wear gloves!
Dissolve one pill OPD (10 mg) in 25 ml substrate buffer at room temperature.
Meanwhile, wash plate 4x100 µl with PBS-Tween.
Add 10 µl 30% H2O2 to OPD solution.
Add 100 µl/well of OPD solution one column at a time using a micropipette. Fill columns at regular intervals.
At t = 5 mins (from initial start), begin adding 50 µl/well of 8 N H2SO4, again one column at a time at the same
regular intervals as before. If intensity is low, you can wait longer than 5 mins. Check the standards for
decision.
Read on the plate reader at 490-650 nm.
For the urea assay, we used a BUN Urea test kit from Stanbio Labs.
*Note, it is IMPORTANT to use a high binding plate when conducting Urea Assay; if not used, may lead to inaccurate
reading of signals
*Plates must be incubate with Urea antibodies overnight (24 hrs) before preparing plates
Preheat water bath to 60°C
Prepare standards
diluted in C+H media (200, 100, 50, 25, 12.5, 6.25, 3.125, 0) ug/ml
Pipette standards into clear bottom (non-binding) 96-well plate
Prepare the acid and Color reagent solution
Mix two BUN reagents as the following ratio: Bun Color reagent and
BUN acid reagent (1:2)
Running Experiment and placing Standards and Samples in high-binding 96-wel plate
Pipette 150 ul into each well
Seal plate and incubate at 60°C for 90 minutes
Read absorbance using a Bioreader analyzer instrument. (endpoint range from 520-650 nm)
Image obtained from Basak Uygun, Center for Engineering in Medicine
Exp. Control
d0 d1 d0 d1
d2 d5 d2 d5
d7 d7
Figure 5: Calculated ug/ul for
Experiment and Control Samples in
Urea assay
We were able to obtain data results that fit our hypothesis. As hypothesized, we noted decreased levels of Oct4 and
were able to obtained increase levels of endoderm and hepatic progenitors: Foxa2 and AFP (see Figures 1 and 2).
Although we have decrease fold in our levels of Sox17 after normalized with d0, we noted that the levels were still
higher than those of Oct4.
Also, we see a trend in increase levels of ddCT (cycle threshold) in Foxa2 (see Figure 3). As we hypothesized we have
increased levels of expression in experiment samples verses control samples. This means that our experiment
samples were able to survive and initiate differentiate better than those that were under control (see Figure 3 again).
Looking at Figure 4, we notice that average Co-culture samples increase as much as 1x between control and
experiment. This indicates that the transcription factors were able to differentiate in a matter of a week.
For the Urea assay, we noticed decreased concentrations of Urea produced over time (see Figure 5) . At this point in
time, we expect stem-cell derived hepatocytes to perform lower than normal hepatocytes physiologically, because we
have not completely identified all the progenitor transcription factors needed to differentiate mESCs into fully functional
hepatocytes.
While I was in the lab, I had the opportunity to witness a number of
different experiments such as subnormothermic preservation (and
cryopreservation of primary hepatocytes). Our lab also conducted a
number of surgeries on rats. We had conducted a number of transplant
surgeries for our rats (both orthotropic and heterotopic) on extracellular
matrices that were heparinized and repopulated with stem cell derived
hepatocytes.
On the left is an image of the abdominal cavity of a
rat. Notice the liver (in red) is full oxygenized.
Objective 1: We were able to prove our hypothesis for the experiment; we had decreased levels of Oct4 at the end of
d7, and increased levels of AFP and Soxa2. The next step would be exploring other hepatic progenitors to see if we
would obtain the same results (i.e. see an increase in fold differentiation over time)
Objective 2: Results for the Urea Assay were not as expected. Average concentration of urea produce decreased
over time. Also, we noticed that the levels of control sample outnumbers that of experiment. Our recommendation
would be to repeat the experiment, though over the course of a short amount of time to see where urea
concentrations decrease. Also, with the discovery of new hepatic progenitor transcription factors, we may be able to
increase the yield of Urea produced in stem-cell derived hepatocytes
I would like to thank the entire research team at the Center for Engineering in Medicine for refining my laboratory
techniques this summer. I would especially like to thank Dr. Basak Uygun, my supervisor, for taking me under her wing
and giving me the opportunity to explore the field of stem cell derived tissue that I am very passionate about. Also, I
would especially like to thank Sinan Ozer and Dr. Berk Usta for teaching me aseptic techniques for culturing
mammalian cell lines..