SlideShare a Scribd company logo
1 of 34
Epigenetic Mechanisms Regulating the Cellular
                                              !
              Response to Hypoxia!




                    Lorenz Poellinger
                                    !
Dept. Cell Mol. Biol., Karolinska Institute, Stockholm, Sweden!
Cellular Adaptation to Hypoxia

-mediated via hypoxia-inducible factors (HIFs)	


-Three known members, HIF-1α, HIF-2α, and HIF-3α	

-bHLH /PAS transcription factors	

-Dimerization partner Arnt	

-Complexes bind to hypoxia responsive elements (HREs)	


-HIF protein stabilization at low oxygen concentrations	

      	

    	

(HIF-1α, HIF-2α, and HIF-3α)	

-Derepression of HIF function at low oxygen concentrations	

      	

    	

(HIF-1α, and HIF-2α, but not HIF-3α)
Different HIF Functions in Tumor Cells
     (neuroblastoma, breast cancer cells):

- HIF-1: mediator of acute responses to hypoxia

- HIF-2: mediator of long-term (chronic) responses to hypoxia
Differential Utilization of HIFs in Response to Oxygen Shortage	





                                              HIF-1α 1% O2

                                              HIF-2α 1% O2
                HIF activity                  HIF-2α 5% O2




                               4                        72
                                   Time (h)
Inhibitory PAS domain protein - IPAS	





                                   IPAS	

    IPAS/HIF-1α	





                                             HRE
Application of IPAS antisense induces 

angiogenesis in the cornea!

       V!                  S!




       R!                 AS!




     Cornea angiogenesis study!
     5 days after implantation of micro pellet containing !
     2.5 µg of oligonucleotide (arrows)!
     V: vehicle                     R: randomized oligonucleotide!
     S: sense oligonucleotide       AS: antisense oligonucleotide !
IPAS is a splicing variant of the HIF-3α locus!

                bHLH!         PAS domain!                   TAD!

      HIF-3α! 1! 2! 3! 4! 5!         6!    7! 8! 9! 10! 11! 12! 13!14!15!



               1a! 1! 2! 3! 4a!4! 5! 6!   7! 8!   9! 10! 11! 12! 13! 14!15!   16!

     genome!

                  -14!                -87!
           ATG!ATG!                                                    STOP!STOP!




      IPAS! 1a! 2! 3! 4! 5! 6!            16!
                    4a!
Oxygen concentration-dependent expression
of the IPAS-specific splicing product of the
HIF-3α locus in the mouse heart!
Different HIF Functions in Tumor Cells

- HIF-1: mediator of acute responses to hypoxia

- HIF-2: mediator of long-term (chronic) responses to hypoxia

- HIF-3: (negative) modulator of the hypoxic response
         (IPAS splice variant: potent dominant negative regulator)
         (specific splice variants: cornea epithelium; inducible in
          many adult tissues, embryonic forms)
IPAS-/- mice!
(collaboration with Dr. Masayuki Yamamoto, Univ. Tsukuba, Japan)!


- IPAS-GFP expression in heart, lung, kidney and endothelium!

-  IPAS-/- mice: very pronounced Cardiac RV Hypertension!
   (block of negative regulation of endothelin-1 expression during!
    development and postnatally).!
Human Neuroblastoma (childhood tumors derived from	

the sympathetic nervous system)	


Hypoxic human neuroblastoma cells	

 -induce genes traditionally linked to a hypoxic phenotype 	

      	

-(VEGF, GLUT1, GLUT3, HK2, ENO etc.)	

 -lose neuronal/neuroendocrine marker gene expression	

      	

-(GAP-43, SCG-10, NPY, NF, dHAND, HASH-1 etc. are downregulated)	

 -become neural-crest like	

      	

-(increased expression of vimentin, ID2, Notch-1, HES-1, c-kit)
-Hypoxia drives neuroblastoma cells towards an immature,	

 stem cell-like phenotype. 	


-By histopathological criteria, hypoxic breast cancer cells become 	

 dedifferentiated in vivo. These cells express cytokeratin 19, a 	

 stem cell marker.	


-In both neuroblastoma and breast cancer, low differentiation	

 stage correlates with poor prognosis.
In neuroblastoma, high HIF-2α protein levels in
restricted tumor areas are associated with:

- high VEGF production
- tumor vascularization
- poor prognosis
- unfavorable outcome

A small, distinct population of cells determines
outcome

Holmquist-Mengelbier et al., Cancer Cell 2006
A Molecular Model for Hypoxia-induced Dedifferentiation of Neuroblastoma Cells	





                                                                    Id2!
             Normoxia  !




                                               dHAND!




                                                                              Hash1!
                                       E2-2!




                                                                     E2-2!
                                                                                                    Neuronal!
                                                                                                    marker genes !
                                          E-box         !                  E-box       !

                           Tumor growth   !                            Id1, Id2!
                                                                       Notch1/3!
                                                                                                                     Notch pathway blocks!
                                                                                                                     Hash1 expression!
                                                                       Hes1, Hey1!
                            Hypoxia!
                                                                       E2-2!
                              HIFs!                                    dHand!
                                                                       Hash1!


                   !
             Hypoxia                                        Id2!
                                                                   E2-2!




                                                                                           Hash1!
                             dHAND!




                                                                             Id2!

                                                   Id1!


                                                                                                    Neuronal!
                                                                                                    marker genes !
                                       E-box        !                E-box          !
Notch Signaling Pathway


Notch ligand	


                     Notch receptor	



   cleavage by 	

   γ-secretase 	

                            Sel-10	

        NICD   	

                                                                +	

                                                                       Hes-1	

                                                    CSL   	

          Hey-2	


                  Proteasome


                                         Inhibition of differentiation
Regulation of the cell differentiation status by hypoxia
    (stem cells, endothelial cells, cancer cells):


- Hypoxia and HIFs are important for stem cell maintenance

- Certain tumor cells de-differentiate under hypoxic conditions
   (correlation with increased tumor aggressiveness)

- Many of the mechanisms regulating the cell differentiation status in hypoxia
   seem to be integrated with the Notch signaling pathway
   (e.g. integration between the Notch and hypoxia signaling pathways in angiogenesis
    and EMT)
Integration between the hypoxia and Notch signaling pathways
Activation of Notch in a Coculture System	

                                                      CSL 	

                                                   binding site	

                     Hey-2	

                                                                              ATG	


                                         -293	

                -118	


                                                      HRE	

                                                                              ATG	

   PGK1	


                                            -274	

                  -95	



  293T -/+Jagged-1	

                                                               Test of species specific primers	





                        C2C12 Fl Notch-1	

                                                                                  Hey-2 promoter	

                                                                                  PGK1 promoter
HIF-1α interacts with Notch	

     on the Hey-2 promoter 	


                             Chromatin IP	


                  N	

 N	

 H	

 H	

                 N	

 N	

 H	

H	

       Ligand:	

 -	

 +	

 -	

 +	

      Ligand:	

 -	

 +	

 -	

 +	

   α-HIF-1α	


α-Notch 1 ICD	

                                        Hey-2	

                            PGK1	

   α-goat IgG	


       input
Epithelial Mesenchymal Transition (EMT), Metastasis!




Hypoxia        Snail        E-cadherin         EMT !
Hypoxia-induced downregulation of E-cadherin 

           requires Notch signaling!
Metastasis!



Hypoxia    Snail     E-cadherin     EMT !




 Does Notch-mediated EMT and E-cadherin
    downregulation proceed via Snail ?!
Hypoxia-dependent upregulation of Snail1 

        requires Notch signaling!




              -       -    -         -   +     DAPT
                     24h   48h   72h     72h
          Normoxia         Hypoxia

                      Snail1!


      Direct transcriptional control ?!
!
                             Notch ICD binds to the Snail promoter
                                                                                                  Snail

                                         ttcacttcctctgggaagtcaccccgacc                      ATG
                                               CSL-binding site

                                                                              ChIP
                                                                      Input    IgG NICD
                  2.5
                        Snail-promoter       Snail-promoter∆CSL
Fold activation




                   2
                  1.5
                   1
                                                                         Normoxia       Hypoxia
                  0.5
        0                                                                           -
                                                                   Ligand +                 +
    Notch 1 ICD
                                                                                                  α-HIF-1α




                                                                      Snail
                                                                                                  α-IgG

                                                                                                  Input
LOX (lysyl oxidase)!

             LOX
                                   	

Erler et al., Nature 2006	




Hypoxia       Notch       Snail          E-cadherin                  EMT !

                                                    LOX


- LOX is upregulated by hypoxia


- LOX stabilizes Snail protein via!                GSK3

  negative regulation of GSK3β	

                  PPPP
                                                    Snail            Snail
Is Notch involved in LOX regulation ?!

  Notch potentiates
        HIF-1α-binding to the

hypoxia-induced LOX
          LOX promoter is

     expression!            potentiated by Notch!
                                                            LOX

                                                         ATG
                                    HRE


                               Normoxia       Hypoxia
                            3T3-B   +     +        -
                            3T3-J   -     -        +
                                                        α-HIF-1α

                                                        α-IgG



                             LOX
                                                        Input
Metastasis!


Notch
          LOX


Hypoxia   Notch     Snail   E-cadherin   EMT !
Metastasis!


Notch
          LOX


Hypoxia   Notch     Snail   E-cadherin   EMT !
Category	

     Late response	

                  Continuous response	


Model Gene	

    CA9	

                            PGK1	





Gene-specific roles of HIF/HRE in chromatin dynamics	

 •  Establishment of hypoxia-dependent NFR in promoter regions	

    (e.g. CA9)	

 •  HIF binding to HRE in NFR to enhance transcription 	

   	

(e.g. PGK1)
Chromatin remodeling
during hypoxia-responsive transcription

                 Inducible NFR	

 I	



  Normoxia	

 HRE	

                      Stabilization	

                                          Activation	


                                            Hypoxia	

               Remodeling	

             CBP	




            HRE	

                                    Degradation	

           Reoxygenation
Conserved core hypoxia gene expression signatures common to seven cancer cell lines




                                                    Jmjd1a is a JmjC domain-containing	

                                                                                	
                                                        histone H3K9 demethylase.




                                                   Lendahl U, Lee KL, Yang H, and Poellinger L.
                                                                                              	

                                                                         Nat Rev Genet. (2009)
The Epigenetic landscape of Cells in Hypoxia?	



            Silence
                  	

   HYPOXIA	

           Active
                                                  	

                                      H3K9
Me   H3K9




                            	
                            A
            Active
                 	

                         Silence
                                                   	

     H3K9                        Me   H3K9
G9a / GLP (Eu-HMTase 1) vs Jmjd1a (Jhdm2a, Kdm3a)

                                                        Cystein Rich     Ankyrin
                                                                               哺乳類のヒストン・リジン・
                                               Poly E     Region                   SET domain
                                                                         Repeat メチル化酵素
              Repressor	

                                                              	

                                   G9a
                  G9a             1,172 a.a.
                                                                         Dimerization
                                                  Poly ED
                  GLP
                                  GLP
                                  1,296 a.a.
   Adds me1 or me2	
                             G9a / GLP function as a heterodimer	

                                                Cooperate with Dnmts to silence genes	

                                               K79	

  K4	

            K9	

      K27	

 K36	

    H3	

        H4	

                K20	


Removes me1 or me2	
                                                              Zinc Finger-like    JmjC-domain

                 Jmjd1a
                              Jmjd1a
               Activator	

     1,323 a.a.

More Related Content

More from MAASTRO clinic

Knowledge Engineering in Oncology
Knowledge Engineering in OncologyKnowledge Engineering in Oncology
Knowledge Engineering in OncologyMAASTRO clinic
 
General information course 2.3
General information course 2.3General information course 2.3
General information course 2.3MAASTRO clinic
 
Carbonic Anhydrase IX: regulation and role in cancer
Carbonic Anhydrase IX: regulation and role in cancerCarbonic Anhydrase IX: regulation and role in cancer
Carbonic Anhydrase IX: regulation and role in cancerMAASTRO clinic
 
Measuring of biological parameters of the tumor microenvironment – advantages...
Measuring of biological parameters of the tumor microenvironment – advantages...Measuring of biological parameters of the tumor microenvironment – advantages...
Measuring of biological parameters of the tumor microenvironment – advantages...MAASTRO clinic
 
Principles of 3D Fitting of Molecules
Principles of 3D Fitting of MoleculesPrinciples of 3D Fitting of Molecules
Principles of 3D Fitting of MoleculesMAASTRO clinic
 
Clinical Imaging Hypoxia
Clinical Imaging HypoxiaClinical Imaging Hypoxia
Clinical Imaging HypoxiaMAASTRO clinic
 
Global & local oxygen control in in vitro systems
Global & local oxygen control in in vitro systemsGlobal & local oxygen control in in vitro systems
Global & local oxygen control in in vitro systemsMAASTRO clinic
 
Tumour Hypoxia - detection and prognostic significance
Tumour Hypoxia - detection and prognostic significanceTumour Hypoxia - detection and prognostic significance
Tumour Hypoxia - detection and prognostic significanceMAASTRO clinic
 
Biological responses to tumor hypoxia & their potential as therapeutic targets
Biological responses to tumor hypoxia & their potential as therapeutic targetsBiological responses to tumor hypoxia & their potential as therapeutic targets
Biological responses to tumor hypoxia & their potential as therapeutic targetsMAASTRO clinic
 
HIF in cell Biology & Physiology
HIF in cell Biology & PhysiologyHIF in cell Biology & Physiology
HIF in cell Biology & PhysiologyMAASTRO clinic
 
METOXIA Framework and Hypoxia and Acidosis in Human Physiology and Diseases
METOXIA Framework and Hypoxia and Acidosis in Human Physiology and DiseasesMETOXIA Framework and Hypoxia and Acidosis in Human Physiology and Diseases
METOXIA Framework and Hypoxia and Acidosis in Human Physiology and DiseasesMAASTRO clinic
 

More from MAASTRO clinic (11)

Knowledge Engineering in Oncology
Knowledge Engineering in OncologyKnowledge Engineering in Oncology
Knowledge Engineering in Oncology
 
General information course 2.3
General information course 2.3General information course 2.3
General information course 2.3
 
Carbonic Anhydrase IX: regulation and role in cancer
Carbonic Anhydrase IX: regulation and role in cancerCarbonic Anhydrase IX: regulation and role in cancer
Carbonic Anhydrase IX: regulation and role in cancer
 
Measuring of biological parameters of the tumor microenvironment – advantages...
Measuring of biological parameters of the tumor microenvironment – advantages...Measuring of biological parameters of the tumor microenvironment – advantages...
Measuring of biological parameters of the tumor microenvironment – advantages...
 
Principles of 3D Fitting of Molecules
Principles of 3D Fitting of MoleculesPrinciples of 3D Fitting of Molecules
Principles of 3D Fitting of Molecules
 
Clinical Imaging Hypoxia
Clinical Imaging HypoxiaClinical Imaging Hypoxia
Clinical Imaging Hypoxia
 
Global & local oxygen control in in vitro systems
Global & local oxygen control in in vitro systemsGlobal & local oxygen control in in vitro systems
Global & local oxygen control in in vitro systems
 
Tumour Hypoxia - detection and prognostic significance
Tumour Hypoxia - detection and prognostic significanceTumour Hypoxia - detection and prognostic significance
Tumour Hypoxia - detection and prognostic significance
 
Biological responses to tumor hypoxia & their potential as therapeutic targets
Biological responses to tumor hypoxia & their potential as therapeutic targetsBiological responses to tumor hypoxia & their potential as therapeutic targets
Biological responses to tumor hypoxia & their potential as therapeutic targets
 
HIF in cell Biology & Physiology
HIF in cell Biology & PhysiologyHIF in cell Biology & Physiology
HIF in cell Biology & Physiology
 
METOXIA Framework and Hypoxia and Acidosis in Human Physiology and Diseases
METOXIA Framework and Hypoxia and Acidosis in Human Physiology and DiseasesMETOXIA Framework and Hypoxia and Acidosis in Human Physiology and Diseases
METOXIA Framework and Hypoxia and Acidosis in Human Physiology and Diseases
 

Recently uploaded

Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17Celine George
 
Framing an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdf
Framing an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdfFraming an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdf
Framing an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdfUjwalaBharambe
 
Types of Journalistic Writing Grade 8.pptx
Types of Journalistic Writing Grade 8.pptxTypes of Journalistic Writing Grade 8.pptx
Types of Journalistic Writing Grade 8.pptxEyham Joco
 
Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...Jisc
 
Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...jaredbarbolino94
 
Presiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha electionsPresiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha electionsanshu789521
 
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️9953056974 Low Rate Call Girls In Saket, Delhi NCR
 
What is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPWhat is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPCeline George
 
Full Stack Web Development Course for Beginners
Full Stack Web Development Course  for BeginnersFull Stack Web Development Course  for Beginners
Full Stack Web Development Course for BeginnersSabitha Banu
 
Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17Celine George
 
Employee wellbeing at the workplace.pptx
Employee wellbeing at the workplace.pptxEmployee wellbeing at the workplace.pptx
Employee wellbeing at the workplace.pptxNirmalaLoungPoorunde1
 
ECONOMIC CONTEXT - LONG FORM TV DRAMA - PPT
ECONOMIC CONTEXT - LONG FORM TV DRAMA - PPTECONOMIC CONTEXT - LONG FORM TV DRAMA - PPT
ECONOMIC CONTEXT - LONG FORM TV DRAMA - PPTiammrhaywood
 
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdfssuser54595a
 
Crayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon ACrayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon AUnboundStockton
 
CELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptxCELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptxJiesonDelaCerna
 
Introduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptxIntroduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptxpboyjonauth
 
Roles & Responsibilities in Pharmacovigilance
Roles & Responsibilities in PharmacovigilanceRoles & Responsibilities in Pharmacovigilance
Roles & Responsibilities in PharmacovigilanceSamikshaHamane
 

Recently uploaded (20)

Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17Difference Between Search & Browse Methods in Odoo 17
Difference Between Search & Browse Methods in Odoo 17
 
Framing an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdf
Framing an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdfFraming an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdf
Framing an Appropriate Research Question 6b9b26d93da94caf993c038d9efcdedb.pdf
 
ESSENTIAL of (CS/IT/IS) class 06 (database)
ESSENTIAL of (CS/IT/IS) class 06 (database)ESSENTIAL of (CS/IT/IS) class 06 (database)
ESSENTIAL of (CS/IT/IS) class 06 (database)
 
Types of Journalistic Writing Grade 8.pptx
Types of Journalistic Writing Grade 8.pptxTypes of Journalistic Writing Grade 8.pptx
Types of Journalistic Writing Grade 8.pptx
 
Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...Procuring digital preservation CAN be quick and painless with our new dynamic...
Procuring digital preservation CAN be quick and painless with our new dynamic...
 
Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...Historical philosophical, theoretical, and legal foundations of special and i...
Historical philosophical, theoretical, and legal foundations of special and i...
 
Presiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha electionsPresiding Officer Training module 2024 lok sabha elections
Presiding Officer Training module 2024 lok sabha elections
 
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
call girls in Kamla Market (DELHI) 🔝 >༒9953330565🔝 genuine Escort Service 🔝✔️✔️
 
What is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERPWhat is Model Inheritance in Odoo 17 ERP
What is Model Inheritance in Odoo 17 ERP
 
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
TataKelola dan KamSiber Kecerdasan Buatan v022.pdfTataKelola dan KamSiber Kecerdasan Buatan v022.pdf
TataKelola dan KamSiber Kecerdasan Buatan v022.pdf
 
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Tilak Nagar Delhi reach out to us at 🔝9953056974🔝
 
Full Stack Web Development Course for Beginners
Full Stack Web Development Course  for BeginnersFull Stack Web Development Course  for Beginners
Full Stack Web Development Course for Beginners
 
Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17Computed Fields and api Depends in the Odoo 17
Computed Fields and api Depends in the Odoo 17
 
Employee wellbeing at the workplace.pptx
Employee wellbeing at the workplace.pptxEmployee wellbeing at the workplace.pptx
Employee wellbeing at the workplace.pptx
 
ECONOMIC CONTEXT - LONG FORM TV DRAMA - PPT
ECONOMIC CONTEXT - LONG FORM TV DRAMA - PPTECONOMIC CONTEXT - LONG FORM TV DRAMA - PPT
ECONOMIC CONTEXT - LONG FORM TV DRAMA - PPT
 
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
 
Crayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon ACrayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon A
 
CELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptxCELL CYCLE Division Science 8 quarter IV.pptx
CELL CYCLE Division Science 8 quarter IV.pptx
 
Introduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptxIntroduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptx
 
Roles & Responsibilities in Pharmacovigilance
Roles & Responsibilities in PharmacovigilanceRoles & Responsibilities in Pharmacovigilance
Roles & Responsibilities in Pharmacovigilance
 

Epigenetic Mechanisms Regulating the Cellular Response to Hypoxia

  • 1. Epigenetic Mechanisms Regulating the Cellular ! Response to Hypoxia! Lorenz Poellinger ! Dept. Cell Mol. Biol., Karolinska Institute, Stockholm, Sweden!
  • 2. Cellular Adaptation to Hypoxia -mediated via hypoxia-inducible factors (HIFs) -Three known members, HIF-1α, HIF-2α, and HIF-3α -bHLH /PAS transcription factors -Dimerization partner Arnt -Complexes bind to hypoxia responsive elements (HREs) -HIF protein stabilization at low oxygen concentrations (HIF-1α, HIF-2α, and HIF-3α) -Derepression of HIF function at low oxygen concentrations (HIF-1α, and HIF-2α, but not HIF-3α)
  • 3. Different HIF Functions in Tumor Cells (neuroblastoma, breast cancer cells): - HIF-1: mediator of acute responses to hypoxia - HIF-2: mediator of long-term (chronic) responses to hypoxia
  • 4. Differential Utilization of HIFs in Response to Oxygen Shortage HIF-1α 1% O2 HIF-2α 1% O2 HIF activity HIF-2α 5% O2 4 72 Time (h)
  • 5. Inhibitory PAS domain protein - IPAS IPAS IPAS/HIF-1α HRE
  • 6. Application of IPAS antisense induces 
 angiogenesis in the cornea! V! S! R! AS! Cornea angiogenesis study! 5 days after implantation of micro pellet containing ! 2.5 µg of oligonucleotide (arrows)! V: vehicle R: randomized oligonucleotide! S: sense oligonucleotide AS: antisense oligonucleotide !
  • 7.
  • 8. IPAS is a splicing variant of the HIF-3α locus! bHLH! PAS domain! TAD! HIF-3α! 1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 13!14!15! 1a! 1! 2! 3! 4a!4! 5! 6! 7! 8! 9! 10! 11! 12! 13! 14!15! 16! genome! -14! -87! ATG!ATG! STOP!STOP! IPAS! 1a! 2! 3! 4! 5! 6! 16! 4a!
  • 9. Oxygen concentration-dependent expression of the IPAS-specific splicing product of the HIF-3α locus in the mouse heart!
  • 10. Different HIF Functions in Tumor Cells - HIF-1: mediator of acute responses to hypoxia - HIF-2: mediator of long-term (chronic) responses to hypoxia - HIF-3: (negative) modulator of the hypoxic response (IPAS splice variant: potent dominant negative regulator) (specific splice variants: cornea epithelium; inducible in many adult tissues, embryonic forms)
  • 11. IPAS-/- mice! (collaboration with Dr. Masayuki Yamamoto, Univ. Tsukuba, Japan)! - IPAS-GFP expression in heart, lung, kidney and endothelium! -  IPAS-/- mice: very pronounced Cardiac RV Hypertension! (block of negative regulation of endothelin-1 expression during! development and postnatally).!
  • 12. Human Neuroblastoma (childhood tumors derived from the sympathetic nervous system) Hypoxic human neuroblastoma cells -induce genes traditionally linked to a hypoxic phenotype -(VEGF, GLUT1, GLUT3, HK2, ENO etc.) -lose neuronal/neuroendocrine marker gene expression -(GAP-43, SCG-10, NPY, NF, dHAND, HASH-1 etc. are downregulated) -become neural-crest like -(increased expression of vimentin, ID2, Notch-1, HES-1, c-kit)
  • 13. -Hypoxia drives neuroblastoma cells towards an immature, stem cell-like phenotype. -By histopathological criteria, hypoxic breast cancer cells become dedifferentiated in vivo. These cells express cytokeratin 19, a stem cell marker. -In both neuroblastoma and breast cancer, low differentiation stage correlates with poor prognosis.
  • 14. In neuroblastoma, high HIF-2α protein levels in restricted tumor areas are associated with: - high VEGF production - tumor vascularization - poor prognosis - unfavorable outcome A small, distinct population of cells determines outcome Holmquist-Mengelbier et al., Cancer Cell 2006
  • 15. A Molecular Model for Hypoxia-induced Dedifferentiation of Neuroblastoma Cells Id2! Normoxia ! dHAND! Hash1! E2-2! E2-2! Neuronal! marker genes ! E-box ! E-box ! Tumor growth ! Id1, Id2! Notch1/3! Notch pathway blocks! Hash1 expression! Hes1, Hey1! Hypoxia! E2-2! HIFs! dHand! Hash1! ! Hypoxia Id2! E2-2! Hash1! dHAND! Id2! Id1! Neuronal! marker genes ! E-box ! E-box !
  • 16. Notch Signaling Pathway Notch ligand Notch receptor cleavage by γ-secretase Sel-10 NICD + Hes-1 CSL Hey-2 Proteasome Inhibition of differentiation
  • 17. Regulation of the cell differentiation status by hypoxia (stem cells, endothelial cells, cancer cells): - Hypoxia and HIFs are important for stem cell maintenance - Certain tumor cells de-differentiate under hypoxic conditions (correlation with increased tumor aggressiveness) - Many of the mechanisms regulating the cell differentiation status in hypoxia seem to be integrated with the Notch signaling pathway (e.g. integration between the Notch and hypoxia signaling pathways in angiogenesis and EMT)
  • 18. Integration between the hypoxia and Notch signaling pathways
  • 19. Activation of Notch in a Coculture System CSL binding site Hey-2 ATG -293 -118 HRE ATG PGK1 -274 -95 293T -/+Jagged-1 Test of species specific primers C2C12 Fl Notch-1 Hey-2 promoter PGK1 promoter
  • 20. HIF-1α interacts with Notch on the Hey-2 promoter Chromatin IP N N H H N N H H Ligand: - + - + Ligand: - + - + α-HIF-1α α-Notch 1 ICD Hey-2 PGK1 α-goat IgG input
  • 21. Epithelial Mesenchymal Transition (EMT), Metastasis! Hypoxia Snail E-cadherin EMT !
  • 22. Hypoxia-induced downregulation of E-cadherin 
 requires Notch signaling!
  • 23. Metastasis! Hypoxia Snail E-cadherin EMT ! Does Notch-mediated EMT and E-cadherin downregulation proceed via Snail ?!
  • 24. Hypoxia-dependent upregulation of Snail1 
 requires Notch signaling! - - - - + DAPT 24h 48h 72h 72h Normoxia Hypoxia Snail1! Direct transcriptional control ?!
  • 25. ! Notch ICD binds to the Snail promoter Snail ttcacttcctctgggaagtcaccccgacc ATG CSL-binding site ChIP Input IgG NICD 2.5 Snail-promoter Snail-promoter∆CSL Fold activation 2 1.5 1 Normoxia Hypoxia 0.5 0 - Ligand + + Notch 1 ICD α-HIF-1α Snail α-IgG Input
  • 26. LOX (lysyl oxidase)! LOX Erler et al., Nature 2006 Hypoxia Notch Snail E-cadherin EMT ! LOX - LOX is upregulated by hypoxia
 - LOX stabilizes Snail protein via! GSK3 negative regulation of GSK3β PPPP Snail Snail
  • 27. Is Notch involved in LOX regulation ?! Notch potentiates
 HIF-1α-binding to the
 hypoxia-induced LOX
 LOX promoter is
 expression! potentiated by Notch! LOX ATG HRE Normoxia Hypoxia 3T3-B + + - 3T3-J - - + α-HIF-1α α-IgG LOX Input
  • 28. Metastasis! Notch LOX Hypoxia Notch Snail E-cadherin EMT !
  • 29. Metastasis! Notch LOX Hypoxia Notch Snail E-cadherin EMT !
  • 30. Category Late response Continuous response Model Gene CA9 PGK1 Gene-specific roles of HIF/HRE in chromatin dynamics •  Establishment of hypoxia-dependent NFR in promoter regions (e.g. CA9) •  HIF binding to HRE in NFR to enhance transcription (e.g. PGK1)
  • 31. Chromatin remodeling during hypoxia-responsive transcription Inducible NFR I Normoxia HRE Stabilization Activation Hypoxia Remodeling CBP HRE Degradation Reoxygenation
  • 32. Conserved core hypoxia gene expression signatures common to seven cancer cell lines Jmjd1a is a JmjC domain-containing histone H3K9 demethylase. Lendahl U, Lee KL, Yang H, and Poellinger L. Nat Rev Genet. (2009)
  • 33. The Epigenetic landscape of Cells in Hypoxia? Silence HYPOXIA Active H3K9 Me H3K9 A Active Silence H3K9 Me H3K9
  • 34. G9a / GLP (Eu-HMTase 1) vs Jmjd1a (Jhdm2a, Kdm3a) Cystein Rich Ankyrin 哺乳類のヒストン・リジン・ Poly E Region SET domain Repeat メチル化酵素 Repressor G9a G9a 1,172 a.a. Dimerization Poly ED GLP GLP 1,296 a.a. Adds me1 or me2 G9a / GLP function as a heterodimer Cooperate with Dnmts to silence genes K79 K4 K9 K27 K36 H3 H4 K20 Removes me1 or me2 Zinc Finger-like JmjC-domain Jmjd1a Jmjd1a Activator 1,323 a.a.