The document summarizes a study that evaluated the expression of 11 genes in 32 surgically removed human lung cancer specimens. Ras family genes and c-myc were overexpressed in over 70% and 50% of cancerous tissues, respectively. More than 50% of adenocarcinoma cases showed moderate expression of TGF-α and HER2. Real-time RT-PCR was used to precisely quantify gene expression levels in the specimens. The results suggest that k-ras, c-myc and bcl-2 could be potential therapeutic targets for lung cancer.
Comparing Mutation Detection Sensitivity from Matched FFPE Tissue and Liquid ...Thermo Fisher Scientific
Cancer researchers are avidly working to enable circulating cell free DNA (cfDNA) profiling as a new more sensitive tool to detect and screen for the presence of solid tumors before detection through clinical methods. Despite the high level of interest in cfDNA, researchers still have reservations until enough data has demonstrated complementarity between methodologies. In this study, we examined the data quality and concordance of mutations called for a small number of matched formalin fixed paraffin embedded (FFPE) tissue and plasma samples.
Ion Torrent™ Next Generation Sequencing – Detect 0.1% Low Frequency Somatic V...Thermo Fisher Scientific
Accurate detection of low-frequency somatic mutations as well as low level structural variants such as copy number variation (CNV) in circulating cell-free DNA (cfDNA) using blood samples from subjects previously diagnosed with cancer provides a potential non-invasive approach to monitor cancer status and evaluate cancer evolution in the future. We have previously reported the Oncomine™ Breast cfDNA Assay enables detection of somatic mutations in plasma down to a level of 0.1% variant allelic frequency in breast cancer relevant genes. Here we extend this technology to simultaneously detect single nucleotide variants (SNVs) as well as copy number variation (CNV) from a single cfDNA sample.
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
Recent studies in non-invasive biomarker research have demonstrated the potential of using cell-free nucleic acids isolated from blood plasma to serve as surrogates for solid tumors. Somatic mutations representing the tumors could be successfully detected from cell-free DNA (cfDNA) and cell-free RNA (cfRNA), providing new tumor assessment methods in addition to tissue biopsy. However, the low amount of circulating tumor fragments in the blood presents significant challenges for accurate variant detection with NGS assays. Moreover, utilization of both cfDNA and cfRNA requires methods capable of interrogating both types of analytes to maximize the utility of each blood sample.
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Thermo Fisher Scientific
With recent advances in next-generation sequencing (NGS) technologies, it is now possible to detect somatic mutations with allele frequencies in blood samples as low as 0.1% from circulating tumor DNA. A natural extension to this achievement is adding the ability to simultaneously detect copy number variants and gene fusions. A panel such as this addresses a full repertoire of variant classes found to be linked with certain tumors and would enable researchers additional to profile cancer samples more dynamically thus enriching current diagnostic tool sets. Here, we present progress on such an approach and apply current NGS technology to achieve our goals.
Orthogonal Verification of Oncomine cfDNA Data with Digital PCR Using TaqMan ...Thermo Fisher Scientific
The discovery of circulating tumor DNA (ctDNA) in blood, urine
and other bodily fluids has led to a new type of non-invasive
method of characterizing cancer-causing mutations, the liquid
biopsy. With NGS technologies becoming increasingly
sensitive, down to a Limit of Detection (LOD) of 0.1%, they are
rapidly gaining traction as a valid assay for cancer genotyping
and have potential to direct cancer treatment plans. The wideangle
view provided by NGS panels, combined with digital
PCR’s zoomed-in precision detection of DNA provide a
comprehensive picture of a cancer’s genetic makeup. By
applying these complementary techniques at the appropriate
time based on the disease type and stage, cancer treatment
becomes quicker, more precise and more cost-effective in the
future. NGS and digital PCR (dPCR) together provide a
complete picture of the cancer genome.
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Thermo Fisher Scientific
We identified mutations in eleven cell free
(cf) DNA samples by next generation
sequencing (NGS) using the Ion AmpliSeq™
Colon & Lung Cancer Research Panel and
the Ion PGM™ System. Since detection of
low frequency mutant alleles may not always
be called confidently in NGS, we verified
results by rare mutation analysis using
digital PCR on the QuantStudio™ 3D Digital
PCR System as an independent method.
We show that frequencies detected are
consistent for both methods for low
frequency mutant alleles at and below 1%.
Comparing Mutation Detection Sensitivity from Matched FFPE Tissue and Liquid ...Thermo Fisher Scientific
Cancer researchers are avidly working to enable circulating cell free DNA (cfDNA) profiling as a new more sensitive tool to detect and screen for the presence of solid tumors before detection through clinical methods. Despite the high level of interest in cfDNA, researchers still have reservations until enough data has demonstrated complementarity between methodologies. In this study, we examined the data quality and concordance of mutations called for a small number of matched formalin fixed paraffin embedded (FFPE) tissue and plasma samples.
Ion Torrent™ Next Generation Sequencing – Detect 0.1% Low Frequency Somatic V...Thermo Fisher Scientific
Accurate detection of low-frequency somatic mutations as well as low level structural variants such as copy number variation (CNV) in circulating cell-free DNA (cfDNA) using blood samples from subjects previously diagnosed with cancer provides a potential non-invasive approach to monitor cancer status and evaluate cancer evolution in the future. We have previously reported the Oncomine™ Breast cfDNA Assay enables detection of somatic mutations in plasma down to a level of 0.1% variant allelic frequency in breast cancer relevant genes. Here we extend this technology to simultaneously detect single nucleotide variants (SNVs) as well as copy number variation (CNV) from a single cfDNA sample.
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
Recent studies in non-invasive biomarker research have demonstrated the potential of using cell-free nucleic acids isolated from blood plasma to serve as surrogates for solid tumors. Somatic mutations representing the tumors could be successfully detected from cell-free DNA (cfDNA) and cell-free RNA (cfRNA), providing new tumor assessment methods in addition to tissue biopsy. However, the low amount of circulating tumor fragments in the blood presents significant challenges for accurate variant detection with NGS assays. Moreover, utilization of both cfDNA and cfRNA requires methods capable of interrogating both types of analytes to maximize the utility of each blood sample.
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Thermo Fisher Scientific
With recent advances in next-generation sequencing (NGS) technologies, it is now possible to detect somatic mutations with allele frequencies in blood samples as low as 0.1% from circulating tumor DNA. A natural extension to this achievement is adding the ability to simultaneously detect copy number variants and gene fusions. A panel such as this addresses a full repertoire of variant classes found to be linked with certain tumors and would enable researchers additional to profile cancer samples more dynamically thus enriching current diagnostic tool sets. Here, we present progress on such an approach and apply current NGS technology to achieve our goals.
Orthogonal Verification of Oncomine cfDNA Data with Digital PCR Using TaqMan ...Thermo Fisher Scientific
The discovery of circulating tumor DNA (ctDNA) in blood, urine
and other bodily fluids has led to a new type of non-invasive
method of characterizing cancer-causing mutations, the liquid
biopsy. With NGS technologies becoming increasingly
sensitive, down to a Limit of Detection (LOD) of 0.1%, they are
rapidly gaining traction as a valid assay for cancer genotyping
and have potential to direct cancer treatment plans. The wideangle
view provided by NGS panels, combined with digital
PCR’s zoomed-in precision detection of DNA provide a
comprehensive picture of a cancer’s genetic makeup. By
applying these complementary techniques at the appropriate
time based on the disease type and stage, cancer treatment
becomes quicker, more precise and more cost-effective in the
future. NGS and digital PCR (dPCR) together provide a
complete picture of the cancer genome.
Rare Mutation Analysis Using Digital PCR on QuantStudio™ 3D to Verify Ion Amp...Thermo Fisher Scientific
We identified mutations in eleven cell free
(cf) DNA samples by next generation
sequencing (NGS) using the Ion AmpliSeq™
Colon & Lung Cancer Research Panel and
the Ion PGM™ System. Since detection of
low frequency mutant alleles may not always
be called confidently in NGS, we verified
results by rare mutation analysis using
digital PCR on the QuantStudio™ 3D Digital
PCR System as an independent method.
We show that frequencies detected are
consistent for both methods for low
frequency mutant alleles at and below 1%.
The enzyme Telomerase maintains telomeres at the ends of
chromosomes. The Telomerase Reverse Transcriptase (TERT)
gene codes for the enzyme’s catalytic domain and is not
expressed in normal somatic cells. As a consequence, normal
cells acquire senescence by shortening of their telomeres
during cell division and eventually undergo apoptosis. In
contrast to normal somatic cells, expression of TERT is
reinstated in cancer cells causing escape from senescence and
apoptosis by maintaining the telomeres. It has recently been
shown that mutations in the TERT promoter region play a key
role in regulating and reinstating TERT expression. Up to 90%
of cancers carry a mutation in the TERT promoter region.
Mutations like C228T and C250T create new binding sites for
the E26 transformation-specific (ETS) transcription factor that
regulates TERT expression (1,2). Experimental evidence
showed that the ETS factor GA-binding protein, alpha subunit
(GABPA) binds to the de novo ETS motif and activates TERT
transcription in cancer cells.
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.
Detection of rare mutations in tumor tissue and cell free DNA (cfDNA) allows for monitoring of tumor progression and regression for research purposes. cfDNA isolated from plasma combined with a sensitive detection method like digital PCR is non- invasive and enables earlier detection compared to conventional imaging techniques. Building on the TaqMan based Rare Mutation assay set for detection of rare mutations using digital PCR on the QuantStudio 3D Digital PCR System, we are now developing multiplex assays for simultaneous detection of several mutations. We selected relevant mutations in the EGFR and KRAS genes for our initial multiplex application: EGFR G719, EGFR exon 19 deletions, and
KRAS G12/G13. These mutations may have implications for potential future targeted therapy. Primers and probes of singleplex Rare Mutation Assays were reformulated to generate multiplex assays detecting the EGFR and KRAS mutations. All multiplex assays were tested on template composed of wild-type genomic DNA background mixed with mutant plasmid reflecting each of the mutations detected by the multiplex
assays. Initial experimental results were successful and showed excellent signal intensity and clear cluster separation when analyzed with the QuantStudio 3D AnalysisSuiteTM Cloud Software. The EGFR G719 mutations (COSM6239, COSM6253, COSM6252) were detected using a 3plex assay, EGFR exon 19 deletions (COSM12383, COSM12422, COSM12678, COSM6223, COSM6254, COSM6255) were detected using a 6plex assay, and KRAS G12/G13 mutations (COSM516,
COSM517, COSM518, COSM520, COSM521, COSM522, COSM527, COSM532) were detected using an 8plex. Multiplexing assays for three relevant mutation loci proved feasible and presents an efficient way to assess the presence and the percentage of mutations at these loci.
TaqMan®Advanced miRNA cDNA synthesis kit to simultaneously study expression o...Thermo Fisher Scientific
MicroRNAs (miRNA) are a class of small non-coding RNAs (approximately 21 nt long) that bind complementary sequences in target mRNAs to specifically regulate gene expression. Aberrant regulation of miRNAs and their targets has been associated with several diseases including cancer. The relationship between miRNA and mRNA has been found to be important in cancer development and progression. Simultaneous expression studies of miRNA and mRNA and detection of mutations in mRNA transcripts can be valuable in understanding molecular mechanisms that
have an underlying role in various diseases. We demonstrate the technical verification of a novel method to reverse-transcribe and pre-amplify miRNA and mRNA from sample-limiting serum research samples using the TaqMan® Advanced miRNA cDNA Synthesis Kit. Based on results from previous studies, a signature of 49 mRNA and 37 miRNA targets has been identified that may help distinguish between benign and malignant pancreatic tissues. In this study, these targets and an additional set of transcript mutations were analyzed in serum from normal and test samples. TaqMan assays for miRNA and mRNA targets and custom TaqMan Mutation Detection Assays (TMDAs) were placed on TaqMan Array Cards to facilitate investigation of several samples in a single experiment. Results demonstrate that transcript mutations can be detected and miRNA and mRNA targets can be reliably quantified from a single reverse transcription reaction. For research use only. Not for use in diagnostic purposes.
Treating cancer effectively requires an understanding of the molecular alterations driving each patient’s tumor. Targeted sequencing efforts that characterize prevalent somatic alterations and require limited sample input may provide an effective diagnostic approach. Herein, we describe the design and characterization of the Oncomine™ Cancer Research Panel (OCP) that includes recurrent somatic alterations in solid tumors derived from the Oncomine™ cancer database. Using Ion AmpliSeq™ technology, we designed a DNA panel that includes assays for 73 oncogenes with 1,826 recurrent hotspot mutations, 26 tumor suppressor genes enriched for deleterious mutations, as well as 75 genes subject to recurrent focal copy gain or loss. A complementary RNA panel includes 183 assays for relevant gene fusions involving 22 fusion driver genes. Recommended sample inputs were 10 ng of nucleic acid per pool. Sequencing libraries were analyzed on an Ion Torrent™ Personal Genome Machine™. Initial testing revealed an average read depth of > 1,500X with > 95% uniformity and on target frequency. The panel was shown to reliably detect known hotspots, insertions/deletions, gene copy changes, and gene fusions in molecular standards, cell lines and formalin-fixed paraffin embedded samples. Retrospective analysis of large sample cohorts has been completed and the results of analysis of 100 lung cancer and 100 prostate cancer cases will be summarized. In addition, a prospective cohort of 100 samples from the University of Michigan Molecular Diagnostics laboratory was profiled with OCP. Overall, we achieved >95% sensitivity and specificity for detection of KRAS, EGFR and BRAF mutations and ALK gene fusions.
Noninvasive detection of rare mutations in blood could allow tumor monitoring for
research purposes. Research studies have suggested that cfDNA contains DNA from
tumor cells with somatic mutations that could inform on tumor progression and
therapeutic resistance. Here, we demonstrate a complete workflow from a single tube
of blood through data analysis for research samples down to a 0.1% allelic frequency.
The low abundance tumor mutations found in cfDNA requires sensitive and accurate
mutation detection. We have developed two panels that utilize an amplificationbased
assay that generates tagged DNA copies, which allows detection of low
abundance tumor mutations found in cfDNA. The two panels allow multiplex
interrogation of primary driver and resistance mutations specific to ctDNA from breast
and colon cancer. The Oncomine™ Colon cfDNA panel targets 236 hotspots within
14 genes while the Oncomine Breast cfDNA panel covers 157 hotspot mutations in
10 genes. This workflow was validated from matched single blood tubes, Streck and
K2EDTA. Additionally, the utility for cancer research was demonstrated with
concordance studies using matched FFPE and plasma from oncology samples.
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...Thermo Fisher Scientific
Research has shown that circulating tumor DNA (ctDNA) is
informative of tumor load and tumor evolution in both solid and
hematological cancer. The ability to detect mutations in ctDNA
holds the promise for an accurate and non-invasive approach to
assess minimum residual disease as well as treatment
response in the future. However, as ctDNA often makes up only
a small fraction of cell-free DNA recovered from the plasma,
traditional methods of targeted sequencing research often face
a poor signal-to-noise ratio that cannot be overcome with deep
coverage.
Here we present a novel research method that is capable of
detecting ultra-rare mutations at allelic frequency below 0.5%.
This approach leverages target multiplexing capabilities of the
Ion AmpliSeq™ technology with some important modifications
to the sample preparation procedures. The new protocol
requires as little as 20 ng of input DNA and offers a sample-toanswer
turn-around time in under 24 hours. To support the
analysis of this new approach, we have further developed a
novel Bayesian statistics that models the propagation of
potential artifacts introduced during amplification and sampling
effects during sequencing to differentiate false positives
(variants observed in sequencing data that were not present in
input DNA) from true mutations that were present at very low
levels in the original research sample.
We successfully applied this new method to detect spike-in
mutant DNA in both cell line (Coriell GM24385) and cfDNA
samples. Specifically, we demonstrated the detection of 140
COSMIC genomic aberrations found in 23 frequently mutated
genes. In preliminary study, the method achieved greater 90%
sensitivity and specificity.
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...QIAGEN
Epithelial ovarian cancer is the fifth leading cause of cancer-related deaths of women in the United States and Europe and ranks as the second most common type of gynecological malignancy. Most cases are diagnosed in advanced stages and although the response rates to platinum-based chemotherapy are high, the majority of patients nevertheless have poor survival rates. Although the reasons for these poor outcomes are likely to be multifactorial, one particular area of interest has recently focused on hematogenous tumor cell dissemination that has been shown to originate from disseminated tumor cells (DTCs) in the bone marrow (BM) and circulating tumor cells (CTCs) in the blood. Here, we demonstrate that the negative prognostic impact of CTCs and DTCs arise from specific cellular phenotypes and are associated with platinum-resistance and stem cell-associated proteins.
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
The tumor microenvironment (TME) is the intersection between tumor cells and
surrounding non-transformed cells. It contains immune cells, signaling molecules,
stromal and extracellular matrix. Research has shown the TME is often associated
with tumor growth. However, the function and regulatory mechanism of each
constituent is still poorly understood. The presence of PD-L1 is a promising marker
to predict positive response for T cell checkpoint therapy. Current IHC methods to
measure PD-L1 are subjective and highly variable. A higher-throughput and
standardized method that can systematically measure gene expression of cells
present in the TME has emerged to be a more desirable solution.
We applied the OncomineTM Immune Response Research Assay to measure the
expression of 395 genes in non-small cell lung cancer (NSCLC) research samples
from 40 matched FFPE and fresh frozen sample types. This assay covers genes
involved in checkpoint pathway, T cell regulation, cytokine and interferon signaling
pathways, and markers of different tumor infiltrating lymphocyte (TIL) subsets, as
well as tumor markers. With an input requirement of 10 ng of total RNA, libraries
were generated, templated on the Ion ChefTM and sequenced on the Ion S5TM
System. Sequencing data was analyzed and mapped with Torrent Suite Software
and differential expression analysis was conducted with AffymetrixTM Transcriptome
Analysis Console.
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
CTC Detection and Molecular Characterization – Challenges and SolutionsQIAGEN
Circulating Tumor Cells (CTCs) have been extensively explored as circulating biomarkers in various cancers. Due to their rarity, heterogeneity and stem cell-like properties, detecting and profiling CTCs from blood samples is very challenging. In this webinar, Dr. Siegfried Hauch will introduce the well-known AdnaTests, which uses the Combination of Combinations Principle (COCP) to enable enriching and detecting CTCs in whole blood with high specificity and sensitivity, and how to overcome challenges in CTC enrichment and detection. The AdnaTests combine an immunomagnetic capturing method that increases purity, and is followed by molecular profiling of the captured CTCs. In addition, leukocyte contamination is another issue in CTCs detection and may lead to false positive results due to illegitimate expression of target genes or false interpretation. The AdnaWash is developed to reduce leukocyte contamination to such a level that whole gene panels can be analyzed while maintaining the required specificity and sensitivity.
Cystic Fibrosis is an autosomal recessive genetic disease that is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which has important roles in ion exchange.
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Thermo Fisher Scientific
DNA sequence variants play an important role in the initiation and progression of many different cancer types. The detection of germline variants at a fixed ratio by gold-standard Sanger sequencing has been well established; however, the detection of somatic mutations, especially in heterogeneous tumor samples where variants may be present at a lower level, has been more challenging. Minor Variant Finder Software (MVF) enables calling of low frequency variants at a detection level as low as 5% using Sanger sequencing.
We have developed gene-specific Sanger sequencing panels covering the entire coding region (all exons) of specific genes (e.g., TP53, KRAS, and NRAS) implicated in tumorigenesis. We initially determined variants of TP53 and KRAS from lung tumor FFPE samples by NGS using the Ion PGM™ System. We confirmed the identity and minor allele frequency of these variants by gene-specific Sanger sequencing panels analyzed by MVF.
To demonstrate the robustness and flexibility of using Sanger sequencing for oncology research, we also included variants across many different solid tumor types in a pan-cancer panel. We tested this workflow with lower amounts of DNA input (10ng, 3ng, 1ng, 0.1ng). Additionally, we have built an extended RAS panel including eight amplicons covering the most important codons (12-13, 59-61, 117 and 146) of KRAS and NRAS genes. The entire workflow and data analysis using MVF was validated on thirty-five FFPE samples derived from colon cancer biopsies by OmniSeq LLC, Buffalo, NY.
A next Generation Sequencing Approach to Detect Large Rearrangements in BRCA1...Thermo Fisher Scientific
We have developed an amplicon-based NGS approach for FFPE
samples that can detect SNVs, small mutations and LRs
simultaneously. We have implemented a comprehensive
bioinformatics algorithm that detects LRs at high sensitivity, even in
the absence of control sample(s). This significantly reduces the cost
and labor for BRCA1/2 genetic analyses.
miRNA profiling from blood challenges and recommendations - Download the articleQIAGEN
The discovery of stable miRNA species circulating in blood has led to increased research focus on disease-related variations in serum and plasma miRNA expression and the possibility that such variations could serve as noninvasive biomarkers for disease. Working with serum and plasma miRNA presents various challenges in purification and characterization. In this paper, we outline QIAGEN recommendations for robust purification and quantification, as well as reliable data normalization and analysis.
The enzyme Telomerase maintains telomeres at the ends of
chromosomes. The Telomerase Reverse Transcriptase (TERT)
gene codes for the enzyme’s catalytic domain and is not
expressed in normal somatic cells. As a consequence, normal
cells acquire senescence by shortening of their telomeres
during cell division and eventually undergo apoptosis. In
contrast to normal somatic cells, expression of TERT is
reinstated in cancer cells causing escape from senescence and
apoptosis by maintaining the telomeres. It has recently been
shown that mutations in the TERT promoter region play a key
role in regulating and reinstating TERT expression. Up to 90%
of cancers carry a mutation in the TERT promoter region.
Mutations like C228T and C250T create new binding sites for
the E26 transformation-specific (ETS) transcription factor that
regulates TERT expression (1,2). Experimental evidence
showed that the ETS factor GA-binding protein, alpha subunit
(GABPA) binds to the de novo ETS motif and activates TERT
transcription in cancer cells.
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.
Detection of rare mutations in tumor tissue and cell free DNA (cfDNA) allows for monitoring of tumor progression and regression for research purposes. cfDNA isolated from plasma combined with a sensitive detection method like digital PCR is non- invasive and enables earlier detection compared to conventional imaging techniques. Building on the TaqMan based Rare Mutation assay set for detection of rare mutations using digital PCR on the QuantStudio 3D Digital PCR System, we are now developing multiplex assays for simultaneous detection of several mutations. We selected relevant mutations in the EGFR and KRAS genes for our initial multiplex application: EGFR G719, EGFR exon 19 deletions, and
KRAS G12/G13. These mutations may have implications for potential future targeted therapy. Primers and probes of singleplex Rare Mutation Assays were reformulated to generate multiplex assays detecting the EGFR and KRAS mutations. All multiplex assays were tested on template composed of wild-type genomic DNA background mixed with mutant plasmid reflecting each of the mutations detected by the multiplex
assays. Initial experimental results were successful and showed excellent signal intensity and clear cluster separation when analyzed with the QuantStudio 3D AnalysisSuiteTM Cloud Software. The EGFR G719 mutations (COSM6239, COSM6253, COSM6252) were detected using a 3plex assay, EGFR exon 19 deletions (COSM12383, COSM12422, COSM12678, COSM6223, COSM6254, COSM6255) were detected using a 6plex assay, and KRAS G12/G13 mutations (COSM516,
COSM517, COSM518, COSM520, COSM521, COSM522, COSM527, COSM532) were detected using an 8plex. Multiplexing assays for three relevant mutation loci proved feasible and presents an efficient way to assess the presence and the percentage of mutations at these loci.
TaqMan®Advanced miRNA cDNA synthesis kit to simultaneously study expression o...Thermo Fisher Scientific
MicroRNAs (miRNA) are a class of small non-coding RNAs (approximately 21 nt long) that bind complementary sequences in target mRNAs to specifically regulate gene expression. Aberrant regulation of miRNAs and their targets has been associated with several diseases including cancer. The relationship between miRNA and mRNA has been found to be important in cancer development and progression. Simultaneous expression studies of miRNA and mRNA and detection of mutations in mRNA transcripts can be valuable in understanding molecular mechanisms that
have an underlying role in various diseases. We demonstrate the technical verification of a novel method to reverse-transcribe and pre-amplify miRNA and mRNA from sample-limiting serum research samples using the TaqMan® Advanced miRNA cDNA Synthesis Kit. Based on results from previous studies, a signature of 49 mRNA and 37 miRNA targets has been identified that may help distinguish between benign and malignant pancreatic tissues. In this study, these targets and an additional set of transcript mutations were analyzed in serum from normal and test samples. TaqMan assays for miRNA and mRNA targets and custom TaqMan Mutation Detection Assays (TMDAs) were placed on TaqMan Array Cards to facilitate investigation of several samples in a single experiment. Results demonstrate that transcript mutations can be detected and miRNA and mRNA targets can be reliably quantified from a single reverse transcription reaction. For research use only. Not for use in diagnostic purposes.
Treating cancer effectively requires an understanding of the molecular alterations driving each patient’s tumor. Targeted sequencing efforts that characterize prevalent somatic alterations and require limited sample input may provide an effective diagnostic approach. Herein, we describe the design and characterization of the Oncomine™ Cancer Research Panel (OCP) that includes recurrent somatic alterations in solid tumors derived from the Oncomine™ cancer database. Using Ion AmpliSeq™ technology, we designed a DNA panel that includes assays for 73 oncogenes with 1,826 recurrent hotspot mutations, 26 tumor suppressor genes enriched for deleterious mutations, as well as 75 genes subject to recurrent focal copy gain or loss. A complementary RNA panel includes 183 assays for relevant gene fusions involving 22 fusion driver genes. Recommended sample inputs were 10 ng of nucleic acid per pool. Sequencing libraries were analyzed on an Ion Torrent™ Personal Genome Machine™. Initial testing revealed an average read depth of > 1,500X with > 95% uniformity and on target frequency. The panel was shown to reliably detect known hotspots, insertions/deletions, gene copy changes, and gene fusions in molecular standards, cell lines and formalin-fixed paraffin embedded samples. Retrospective analysis of large sample cohorts has been completed and the results of analysis of 100 lung cancer and 100 prostate cancer cases will be summarized. In addition, a prospective cohort of 100 samples from the University of Michigan Molecular Diagnostics laboratory was profiled with OCP. Overall, we achieved >95% sensitivity and specificity for detection of KRAS, EGFR and BRAF mutations and ALK gene fusions.
Noninvasive detection of rare mutations in blood could allow tumor monitoring for
research purposes. Research studies have suggested that cfDNA contains DNA from
tumor cells with somatic mutations that could inform on tumor progression and
therapeutic resistance. Here, we demonstrate a complete workflow from a single tube
of blood through data analysis for research samples down to a 0.1% allelic frequency.
The low abundance tumor mutations found in cfDNA requires sensitive and accurate
mutation detection. We have developed two panels that utilize an amplificationbased
assay that generates tagged DNA copies, which allows detection of low
abundance tumor mutations found in cfDNA. The two panels allow multiplex
interrogation of primary driver and resistance mutations specific to ctDNA from breast
and colon cancer. The Oncomine™ Colon cfDNA panel targets 236 hotspots within
14 genes while the Oncomine Breast cfDNA panel covers 157 hotspot mutations in
10 genes. This workflow was validated from matched single blood tubes, Streck and
K2EDTA. Additionally, the utility for cancer research was demonstrated with
concordance studies using matched FFPE and plasma from oncology samples.
Successful detection of 40 COSMIC hotspot mutations at allelic frequency belo...Thermo Fisher Scientific
Research has shown that circulating tumor DNA (ctDNA) is
informative of tumor load and tumor evolution in both solid and
hematological cancer. The ability to detect mutations in ctDNA
holds the promise for an accurate and non-invasive approach to
assess minimum residual disease as well as treatment
response in the future. However, as ctDNA often makes up only
a small fraction of cell-free DNA recovered from the plasma,
traditional methods of targeted sequencing research often face
a poor signal-to-noise ratio that cannot be overcome with deep
coverage.
Here we present a novel research method that is capable of
detecting ultra-rare mutations at allelic frequency below 0.5%.
This approach leverages target multiplexing capabilities of the
Ion AmpliSeq™ technology with some important modifications
to the sample preparation procedures. The new protocol
requires as little as 20 ng of input DNA and offers a sample-toanswer
turn-around time in under 24 hours. To support the
analysis of this new approach, we have further developed a
novel Bayesian statistics that models the propagation of
potential artifacts introduced during amplification and sampling
effects during sequencing to differentiate false positives
(variants observed in sequencing data that were not present in
input DNA) from true mutations that were present at very low
levels in the original research sample.
We successfully applied this new method to detect spike-in
mutant DNA in both cell line (Coriell GM24385) and cfDNA
samples. Specifically, we demonstrated the detection of 140
COSMIC genomic aberrations found in 23 frequently mutated
genes. In preliminary study, the method achieved greater 90%
sensitivity and specificity.
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...QIAGEN
Epithelial ovarian cancer is the fifth leading cause of cancer-related deaths of women in the United States and Europe and ranks as the second most common type of gynecological malignancy. Most cases are diagnosed in advanced stages and although the response rates to platinum-based chemotherapy are high, the majority of patients nevertheless have poor survival rates. Although the reasons for these poor outcomes are likely to be multifactorial, one particular area of interest has recently focused on hematogenous tumor cell dissemination that has been shown to originate from disseminated tumor cells (DTCs) in the bone marrow (BM) and circulating tumor cells (CTCs) in the blood. Here, we demonstrate that the negative prognostic impact of CTCs and DTCs arise from specific cellular phenotypes and are associated with platinum-resistance and stem cell-associated proteins.
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
The tumor microenvironment (TME) is the intersection between tumor cells and
surrounding non-transformed cells. It contains immune cells, signaling molecules,
stromal and extracellular matrix. Research has shown the TME is often associated
with tumor growth. However, the function and regulatory mechanism of each
constituent is still poorly understood. The presence of PD-L1 is a promising marker
to predict positive response for T cell checkpoint therapy. Current IHC methods to
measure PD-L1 are subjective and highly variable. A higher-throughput and
standardized method that can systematically measure gene expression of cells
present in the TME has emerged to be a more desirable solution.
We applied the OncomineTM Immune Response Research Assay to measure the
expression of 395 genes in non-small cell lung cancer (NSCLC) research samples
from 40 matched FFPE and fresh frozen sample types. This assay covers genes
involved in checkpoint pathway, T cell regulation, cytokine and interferon signaling
pathways, and markers of different tumor infiltrating lymphocyte (TIL) subsets, as
well as tumor markers. With an input requirement of 10 ng of total RNA, libraries
were generated, templated on the Ion ChefTM and sequenced on the Ion S5TM
System. Sequencing data was analyzed and mapped with Torrent Suite Software
and differential expression analysis was conducted with AffymetrixTM Transcriptome
Analysis Console.
Detection and quantification of mutant alleles in tumor tissue allow for research disease monitoring and the research of drug efficacy. Detection of emerging secondary mutations in the same tumor tissue causing resistance to potential treatment will help guide decisions on future treatment plans. Testing for the presence of mutations in cell free DNA (cfDNA) is a less invasive research method than using tumor tissue. We created a research tool for mutation detection at a sensitivity level of 1% and below. This allows researchers to find correlation between types of mutations and types of tumors and determination of potential secondary mutations.
The tool combines TaqMan® SNP Genotyping Assays with digital PCR. A set of assays was optimized for use
in digital PCR with the QuantStudio® 3D Digital PCR System. In digital PCR, partitioning the sample into many individual reaction wells facilitates detection and quantification of rare mutant alleles. TaqMan® SNP Genotyping Assays ensure reliable discrimination of mutant and wild-type allele. Our current set of 60 assays covers mutations commonly found in tumor tissues, such as: BRAF V600E, mutations in EGFR exons 19, 20 and 21, KRAS codons 12 and 13, PIK3CA exons 9 and 20, and the JAK2 V617F mutations. All assays were wet-lab tested at a 10% mutation rate and a 1% mutation rate using mutant plasmid spiked into wild-type genomic DNA. Additionally, selected assays were tested at the 0.1% mutation rate using mutant cell lines spiked into wild-type genomic DNA. Wet-lab results confirm that all assays showed superior performance discriminating mutant and wild-type alleles. Mutant alleles were successfully detected as low as 0.1%.
CTC Detection and Molecular Characterization – Challenges and SolutionsQIAGEN
Circulating Tumor Cells (CTCs) have been extensively explored as circulating biomarkers in various cancers. Due to their rarity, heterogeneity and stem cell-like properties, detecting and profiling CTCs from blood samples is very challenging. In this webinar, Dr. Siegfried Hauch will introduce the well-known AdnaTests, which uses the Combination of Combinations Principle (COCP) to enable enriching and detecting CTCs in whole blood with high specificity and sensitivity, and how to overcome challenges in CTC enrichment and detection. The AdnaTests combine an immunomagnetic capturing method that increases purity, and is followed by molecular profiling of the captured CTCs. In addition, leukocyte contamination is another issue in CTCs detection and may lead to false positive results due to illegitimate expression of target genes or false interpretation. The AdnaWash is developed to reduce leukocyte contamination to such a level that whole gene panels can be analyzed while maintaining the required specificity and sensitivity.
Cystic Fibrosis is an autosomal recessive genetic disease that is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which has important roles in ion exchange.
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Thermo Fisher Scientific
DNA sequence variants play an important role in the initiation and progression of many different cancer types. The detection of germline variants at a fixed ratio by gold-standard Sanger sequencing has been well established; however, the detection of somatic mutations, especially in heterogeneous tumor samples where variants may be present at a lower level, has been more challenging. Minor Variant Finder Software (MVF) enables calling of low frequency variants at a detection level as low as 5% using Sanger sequencing.
We have developed gene-specific Sanger sequencing panels covering the entire coding region (all exons) of specific genes (e.g., TP53, KRAS, and NRAS) implicated in tumorigenesis. We initially determined variants of TP53 and KRAS from lung tumor FFPE samples by NGS using the Ion PGM™ System. We confirmed the identity and minor allele frequency of these variants by gene-specific Sanger sequencing panels analyzed by MVF.
To demonstrate the robustness and flexibility of using Sanger sequencing for oncology research, we also included variants across many different solid tumor types in a pan-cancer panel. We tested this workflow with lower amounts of DNA input (10ng, 3ng, 1ng, 0.1ng). Additionally, we have built an extended RAS panel including eight amplicons covering the most important codons (12-13, 59-61, 117 and 146) of KRAS and NRAS genes. The entire workflow and data analysis using MVF was validated on thirty-five FFPE samples derived from colon cancer biopsies by OmniSeq LLC, Buffalo, NY.
A next Generation Sequencing Approach to Detect Large Rearrangements in BRCA1...Thermo Fisher Scientific
We have developed an amplicon-based NGS approach for FFPE
samples that can detect SNVs, small mutations and LRs
simultaneously. We have implemented a comprehensive
bioinformatics algorithm that detects LRs at high sensitivity, even in
the absence of control sample(s). This significantly reduces the cost
and labor for BRCA1/2 genetic analyses.
miRNA profiling from blood challenges and recommendations - Download the articleQIAGEN
The discovery of stable miRNA species circulating in blood has led to increased research focus on disease-related variations in serum and plasma miRNA expression and the possibility that such variations could serve as noninvasive biomarkers for disease. Working with serum and plasma miRNA presents various challenges in purification and characterization. In this paper, we outline QIAGEN recommendations for robust purification and quantification, as well as reliable data normalization and analysis.
An oncogene is a gene that has the potential to cause cancer. In tumor cells, they are mutated or expressed at high levels. Most normal cells undergo a programmed form of rapid cell death (apoptosis) when critical functions are altered.
Lung cancer: a 2014 update with information about immunotherapiesZeena Nackerdien
In 2006, Dana Reeve – actress, activist, and non-smoker – died of lung cancer. In 2009, Valerie Harper – actress and “Dancing with the Stars” contestant – was diagnosed with lung cancer that has since metastasized to the brain. They are the famous faces of a disease that is the leading cause of cancer deaths. Five-year survival rates for lung cancer, the leading cause of cancer deaths, are very low. Please take a look at some of the ASCO 2014 lung cancer updates on my blog: http://norwalk.patch.com/groups/zeena-nackerdiens-blog/p/american-society-of-clinical-oncology-annual-meeting-2014-key-lung-cancer-abstracts.
Der digitale Arbeitsplatz ist zeitlich und örtlich flexibel. Das gibt Arbeitskräften viel Freiheit, Gestaltungsspielraum und auch Verantwortung. „Mit dieser Freiheit umzugehen ist gar nicht so einfach“, sagt Hannes Moser, Lehrender und Forscher an der Fachhochschule Salzburg im Bereich MultiMediaTechnology, sowie Partner bei „Die Netzarchitekten“.
„Für einige bedeutet der Schritt in die digitale Arbeitswelt, einen Paradigmenwechsel zu vollziehen, der sich auf alle Lebensbereiche auswirkt. Nur die Möglichkeit eines zeitlich und örtlich nicht näher definierten Arbeitsplatzes zu haben führt nicht immer zwangsläufig zur großen Lebensumstellung. Viele tauchen in die Welt des digitalen Arbeitens unbewusst ein. unbewusst ein, haben Teile ihrer Arbeit digitalisiert, ohne darüber nachzudenken.“
Als Nutzer stehen uns die vielfältigen Möglichkeiten des WWW nun seit über 20 Jahren zur Verfügung. Wir seien dennoch eine Übergangsgesellschaft, die gerade
recht intensiv lerne, zwischen zwei Jahrhunderten, eigentlich sogar zwei Jahrtausenden zu leben, erklärt Moser. „Der digitale Wandel am Arbeitsplatz betrifft uns alle oder wird uns noch betreffen. Der digitale Arbeitsplatz ist vielfältig, unterhaltsam, bietet Freiheit, fordert Disziplin und ist eine Chance, keine Bedrohung für unsere Zukunft.“
Aegon Retirement Readiness Report - The New Flexible RetirementAegon
The concept of retirement is rapidly changing. As people live longer, retirement will become a more active life stage, with more people looking to blend work and leisure. But not all countries are acting on this global trend.
Plastics have woven their way into our daily lives and now pose a tremendous threat to the environment. Over a 100million tones of plastics are produced annually worldwide, and the used products have become a common feature at overflowing bins and landfills. Though work has been done to make futuristic biodegradable plastics, there have not been many conclusive steps towards cleaning up the existing problem. Here, the process of converting waste plastic into value added fuels is explained as a viable solution for recycling of plastics. Thus two universal problems such as problems of waste plastic and problems of fuel shortage are being tackled simultaneously. In this study, plastic wastes were used for the pyrolysis to get fuel oil that has the same physical properties as the fuels like petrol, diesel etc. Pyrolysis runs without oxygen and in high temperature of about 300°C which is why a reactor was fabricated to provide the required temperature for the reaction. The waste plastics are subjected to depolymerisation, pyrolysis, thermal cracking and distillation to obtain different value added fuels such as petrol, kerosene, and diesel, lube oil etc. Converting waste plastics into fuel hold great promise for both the environmental and economic scenarios.
NSCLC: diagnóstico molecular, pronóstico y seguimiento; CTCMauricio Lema
Lo nuevo en diagnóstico molecular, pronóstico y seguimiento en NSCLC, y el impacto pronóstico de las Células Tumorales Circulantes. Para evento de cirugía de tórax, Hotel Intercontinental, Medellín, 22.05.2018 (se complementa con las la presentación de lo nuevo en terapia sistémica en NSCLC).
Molecular Detection of Epstein-Barr Virus and Human Cytomegalovirus Antigen E...CrimsonpublishersCancer
Breast cancer is a leading cause of death among women worldwide. The association between Epstein-Barr Virus (EBV) and Human Cytomegalovirus (HCMV) and breast cancer risk still remains controversial making it difficult to determine whether either, both or neither virus is causally associated with breast cancer. The aim of this study was to detect EBV and the expression of the Immediate Early Antigen (IE) of HCMV in breast cancer in Sudanese women.
Genotyping of 27 Human Papillomavirus Types by Using L1 Consensus PCR Product...Alberto Cuadrado
Amplification of human papillomavirus (HPV) DNA by L1 consensus primer systems (e.g., MY09/11 or
GP51/61) can detect as few as 10 to 100 molecules of HPV targets from a genital sample. However, genotype
determination by dot blot hybridization is laborious and requires at least 27 separate hybridizations for
substantive HPV-type discrimination. A reverse blot method was developed which employs a biotin-labeled
PCR product hybridized to an array of immobilized oligonucleotide probes. By the reverse blot strip analysis,
genotype discrimination of multiple HPV types can be accomplished in a single hybridization and wash cycle.
Twenty-seven HPV probe mixes, two control probe concentrations, and a single reference line were immobilized
to 75- by 6-mm nylon strips. Each individual probe line contained a mixture of two bovine serum albuminconjugated
oligonucleotide probes specific to a unique HPV genotype. The genotype spectrum discriminated on
this strip includes the high-risk, or cancer-associated, HPV genotypes 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 55,
56, 58, 59, 68 (ME180), MM4 (W13B), MM7 (P291), and MM9 (P238A) and the low-risk, or non-cancerassociated,
genotypes 6, 11, 40, 42, 53, 54, 57, 66, and MM8 (P155). In addition, two concentrations of b-globin
probes allowed for assessment of individual specimen adequacy following amplification. We have evaluated the
performance of the strip method relative to that of a previously reported dot blot format (H. M. Bauer et al.,
p. 132–152, in C. S. Herrington and J. O. D. McGee (ed.), Diagnostic Molecular Pathology: a Practical Approach,
(1992), by testing 328 cervical swab samples collected in Digene specimen transport medium (Digene Diagnostics,
Silver Spring, Md.). We show excellent agreement between the two detection formats, with 92%
concordance for HPV positivity (kappa 5 0.78, P < 0.001). Nearly all of the discrepant HPV-positive samples
resulted from weak signals and can be attributed to sampling error from specimens with low concentrations
(<1 copy/ml) of HPV DNA. The primary advantage of the strip-based detection system is the ability to rapidly
genotype HPVs present in genital samples with high sensitivity and specificity, minimizing the likelihood of
misclassification.
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
In recent years, advances in next-generation sequencing (NGS) technologies have enabled faster and cheaper methods for uncovering the genetic basis of disease. For cancer, NGS based screening for known tumour subtypes can inform diagnosis and allow the clinician to tailor a specific therapy based on testing outcome. Here we present the validation of one such NGS based kit approved for CE-IVD* use to screen for specific chromosomal translocations in non-small cell lung cancer (NSCLC) samples by targeting specific breakpoints in known fusion transcripts.
The kit tested (Oncomine™ Solid Tumour Fusion Transcript Kit) included a single primer poolcontaining amplicon designs to simultaneously screen for over 75 specific rearrangements involving the receptor tyrosine kinase (RTK) genes ALK, RET and ROS1 as well as NTRK1. The panel was compatible with formalin-fixed paraffin-embedded (FFPE) lung tumour samples and achieved high sensitivity down to 10 ng of RNA input. In addition, amplicon assays designed at the 5’ and 3’ ends the RTK genes provide non-specific evidence that a translocation exists in a sample by comparing expression imbalance between the two ends. Validation testing was carried out at three external clinical laboratories (CLIA, CAP, INAB). In addition to positive and negative control samples, each site contributed FFPE lung tumour samples for which ALK fusion status was known prior to NGS library preparation carried out using the Ion AmpliSeq workflow. For site-specific samples (n=144, 16 samples per sequencing run), high concordance, sensitivity and specificity were measured at 97.2%, 90.5% and 98.4%, respectively.
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
EACR-P0ster-17
1. Template provided by: “posters4research.com”
Total of 32 surgically removed human lung cancer specimens were evaluated for the expression of 11
selected genes. The pathological evaluation confirmed that majority of our specimens were NSCLC,
most of which were adenocarcinoma subtypes (60%). The gene expression signature results are
shown in Table 1. Ras family genes (ki-ras and c-ha-ras) are overexpressed in over 70% of
cancerous tissues. C-myc oncogene seems to play a major role in lung cancer as well (~50%). More
than 50% of adenocarcinoma cases show a moderate expression of both TGF-α and HER2, while
30% of carcinoid tissues had over-expression of these genes. Expression of k-ras, c-ha-ras and c-
myc were significantly high in SCC specimens.
Gene expression profiling is being proposed to address some of the very important clinical issues
such as therapeutic decisions based on molecular cause of cancers. Real-time RT-PCR is a new
technology used to precisely quantitate gene expression levels1. This technology is now
recognized as the technology of choice for the precise measurement of gene expression levels2.
Thus we can identify genes that affect disease prognosis and could serve as therapeutic targets
for personalized therapy. Gene expression profiling examines the composition of cellular
messenger RNA populations. The identity and the number of these transcripts in the cell provide
information about the global activity of genes that give rise to them. RT-PCR is a molecular biology
technique that combines reverse transcription with real-time PCR. This technology allows the
quantification of a defined RNA molecule. Complimentary DNA is made from a specific RNA by
reverse transcription and amplified using PCR. The quantification of the DNA produced, is
accomplished by the use of fluorescent dyes. The traditional RT-PCR is a semi-quantitative
technique and is more likely to produce false positive results3-12. Real-time RT-PCR on the other
hand, can precisely quantitate gene expression levels13. This technique is proven to be extremely
sensitive and it is widely used as the method of choice for quantifying absolute changes in gene
expression. This technique is also the preferred method for validating microarray analyses and
other techniques that evaluate gene expression profiling. We have used this technique to evaluate
the levels of gene expression in surgically removed human lung normal and cancerous tissues.
Our hypothesis was that real-time RT-PCR is reliable to differentiate gene expression levels in
normal and cancer tissues. This eleven gene panel may serve as a guide to personalized therapy.
ABSTRACT
INTRODUCTION
CONCLUSIONS
REFERENCES
TITLE: An Eleven Gene Signature Of Normal & Cancerous Lung Tissues
Authors: Sheikhnejad1 Reza, Shadmehr2 M.Behgam, Turkinejad1 Fahimeh, Zohri1 Mastaneh
Affiliations: 1Molecular and Cancer Biology, TOFIGH DARU, Research and Drug Engineering Company Tehran/Iran
2Trachial Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical
Sciences, Tehran/Iran
Current paradigms suggest lung cancers are caused by gene transcriptional
activation/or progression events. Gene expression profiling has been used as molecular
diagnostic tool for classification and staging of cancers. It can be also effectively used to
determine the molecular targets for personalized treatment. We have used a panel of 11
genes expression signature to characterize surgically removed human lung cancers
specimens as well as patient’s noncancerous lung tissues. The panel includes 6 well
studied oncogenes such as bcl-2, c-myc, ki-ras, c-ha-ras, her-2/neu and Tgf-α that
represent excellent therapeutic targets. Other genes are, p53 (best known tumor
suppressor), MDM2 (known for regulating p53), Mmp1 and Mmp14 (metastatic genes) and
MDR1 (a well known drug resistant gene). We have evaluated 32 pairs of noncancerous
lung tissue and corresponding primary lung tumor tissues from lung cancer patients
who had undergone surgical resection from 2008 to 2009. All tissues were collected
fresh, snap-frozen and stored at -80 0C. Total RNA was isolated from all tissues with
RNeasy mini kit (Qiagen) according to manufacturer’s instructions. The cDNAs were then
used for qRT-PCR analysis using, Step OnePlusTM (ABI). The expression profile of 11
genes was quantified with the use of Power SYBR Green PCR master Mix (ABI). Human
b-actin was used as an endogenous control. Relative quantitation of gene expression
was determined, using comparative CT method of (DDCT). Roughly over 70% of lung
cancer patients show elevation in the expression of at least one apoptotic target genes
(ki-ras, bcl2 and c-myc) with k-ras being overexpressed in about 50% of our patients. In
conclusion specific inhibitors of k-ras, c-myc and bcl-2 could provide more effective
tools to combat lung cancer with little or no side effect.
Tissue Specimens
Lung Cancerous and normal tissues were obtained from patients who underwent surgery with
informed consent approved by Institutional Review Board (Medical University of Shahid Beheshti).
Fresh tissue specimens were immediately placed in RNAlater solution to protect against RNase
activity prior to RNA extraction. Routine histopathology analysis was performed at the hospital
(Masihe Daneshvari) and the clinical data was received after RT-PCR was performed for all specimens.
RNA Isolation
The tissues were homogenized in1ml of Tripure isolation reagent (Roche) using IKA-ULTRA-TURRAX®
T25 basic. Total RNA extraction was carried out using the RNeasy plus Mini Kit (Qiagen). Pelleted RNA
was resuspended in DEPC-treated water and RNA yield was determined by spectroscopy. RNA quality
was also evaluated by denaturing formaldehyde agarose gel electrophoresis. In an attempt to reduce
product degradation, we introduced a two-step protocol, i.e., cDNA synthesis and PCR amplification in
separate tubes. First strand cDNA was synthesized from one microgram of DNase-I-treated total RNA,
using random hexamers and RevertAidTM M-MuLV Reverse Transcriptase according to the
manufacturer (Fermentase). Complementary DNA was made from 1 µg of total RNA using M-MuLV
Reverse Transcriptase according to the manufacturer (Fermentase).
Real-time RT-PCR
Real-time RT-PCR was performed on a StepOnePlusTM ABI system. Power SYBR ® Green PCR Master
Mix is optimized for real-time PCR analysis using SYBR ® Green 1 Dye, AmpliTaq Gold ® DNA
Polymerase LD, dNTPs with dUTP/dTTP blend, Passive Reference 1 and optimized buffer components.
Each reaction (20 µl) contained 2 µl of the respective cDNA dilution, primers at 10pmol/µl, and MgCl2
at4 µmol/µl. The amplification program consisted of 1 cycle of 95°C with 10 min hold (“hot start”)
followed by 40 cycles of 95°C with 15-second hold, specified annealing temperature with 1 min hold,
60°C with1 min hold. Amplification was followed by melting curve analysis using the program run for
one cycle at 95°C with 15-second hold, 60°C with1 min hold, and 95°C with 15-second hold at the step
acquisition mode. All reactions were performed in triplicates. Threshold for cycle of threshold (Ct)
analysis of all samples were set at 0.1 relative fluorescence units. Real-time PCR efficiencies were
calculated from the given slopes in ABI Step one plus software. The corresponding real-time PCR
efficiency (E) of one cycle in the exponential phase was calculated according to: E = 10[–1/slope].
Investigated transcripts showed high real-time PCR efficiency rates; for each assay, we analyzed 5
serial dilution from 0.001 to 10 cDNA (n = 12) with high linearity (correlation coefficient r > 0.95).
METHODS RESULTS
Martell M, Gomez J, Esteban JI, Sauleda S, Quer J, Cabot B, et al. High-throughput real-time reverse
transcription-PCR quantitation of
hepatitis C virus RNA. J Clin Microbiol; 37:327–32,1999
Bieche I, Olivi M, Champeme MH, Vidaud D, Lidereau R, Vidaud M. Novel approach to quantitative
polymerase chain reaction using realtime detection: application to the detection of gene
amplification inbreast cancer. Int J Cancer;78:661– 6, 1998.
Datta YH, Adams PT, Drobyski WR, Ethier SP, Terry VH, Roth MS. Sensitive detection of occult breast
cancer by the reverse transcriptase polymerase chain reaction. J Clin Oncol;12:475– 82,1994.
Bostick PJ, Chatterjee S, Chi DD, Huynh KT, Giuliano AE, Cote R, et al. Limitations of specific
reverse-transcriptase polymerase chain
reaction markers in the detection of metastases in the lymph nodes and blood of breast cancer
patients. J Clin Oncol;16:2632– 40,1998.
Eltahir EM, Mallinson DS, Birnie GD, Hagan C, George WD, Purushotham AD. Putative markers for
the detection of breast carcinoma cells in blood. Br J Cancer;77:1203–7, 1998.
Giesing M, Austrup F, Bockmann B, Driesel G, Eder C, Kusiak I, et al. Independent prognostication
and therapy monitoring of breast
cancer patients by DNA/RNA typing of minimal residual cancer cells.
Int J Biol Markers;15:94 –9, 2000.
Goeminne JC, Guillaume T, Salmon M, Machiels JP, D’Hondt V, Symann M. Unreliability of
carcinoembryonic antigen (CEA) reverse
transcriptase-polymerase chain reaction (RT-PCR) in detecting contaminating breast cancer cells in
peripheral blood stem cells due to induction of CEA by growth factors. Bone Marrow
Transplant;24:769 –75, 1999.
Gunn J, McCall JL, Yun K, Wright PA. Detection of micrometastases in colorectal cancer patients by
K19 and K20 reverse-transcription
polymerase chain reaction. Lab Invest;75:611– 6, 1996.
Lopez-Guerrero JA, Gilabert PB, Gonzalez EB, Sanz Alonso MA, Perez JP, Talens AS, et al. Use of
reverse-transcriptase polymerase
chain reaction (RT-PCR) for carcinoembryonic antigen, cytokeratin19, and maspin in the detection of
tumor cells in leukapheresis
products from patients with breast cancer: comparison with immunocytochemistry. J
Hematother;8:53– 61, 1999.
Merrie AE, Yun K, Gunn J, Phillips LV, McCall JL. Analysis of potential markers for detection of
submicroscopic lymph node metastases in breast cancer. Br J Cancer;80:2019 –24, 1999.
Zach O, Kasparu H, Krieger O, Hehenwarter W, Girschikofsky M, Lutz D. Detection of circulating
mammary carcinoma cells in the peripheral blood of breast cancer patients via a nested reverse
transcriptase polymerase chain reaction assay for mammaglobin mRNA. J Clin Oncol;17:2015–9,
1999.
Zhong XY, Kaul S, Diel I, Eichler A, Bastert G. Analysis of sensitivity and specificity of cytokeratin 19
reverse transcriptase/polymerase chain reaction for detection of occult breast cancer in bone
marrow and leukapheresis products. J Cancer Res Clin Oncol;125:286 –91, 1999.
Nakao M, Janssen JW, Flohr T, Bartram CR. Rapid and reliable quantification of minimal residual
disease in acute lymphoblastic
leukemia using rearranged immunoglobulin and T-cell receptor loci by LightCycler technology.
Cancer Res;60:3281–9, 2000.
Due to the small number of specimens and lack of exclusive pathological information,
our results are not statistically significant. However our main goal was to determine if
11 gene expression signatures can provide us with a useful tool to identify specific
molecular and/or pharmaceutical targets for personalized therapy. Based on our
reliable and repeatable RT-PCR technique, we have shown that each cancer patient
has a unique gene expression signature. Our selected 6 oncogenes are known to be
valuable therapeutical targets. More than 70% of our lung cancer patients have at least
one such oncogene, over-expressed that may serve as a therapeutical target. This
test can be used to screen lung cancer patients to identify any specific target if a
specific gene targeted drug is available. Molecular diagnostic is a prerequisite for our
future molecular therapy of cancers.
Table1. 32 surgically removed lung cancer tissues were examined by real-time RT-PCR for
the expression of 11 genes to evaluate disease prognosis and molecular therapy targets.
Genes Highly
Expressed
(% of tissues )
Moderately
Expressed
(% of tissues )
Low
Expression
(% of tissues )
Ki-Ras 42 28 17
C-Ha-Ras 38.5 24.5 31.5
BCL2 21 24.5 24.5
C-MYC 49 14 24.5
HER-2 21 56 7
TGF-alpha 24.5 21 38.5
MmP1 10.5 10.5 28
MmP14 17.5 24.5 7
MDM2 14 10.5 28
P53 35 42 14
MDR1 0 3.5 42
GENES Forward Primers Reverse Primers
K-Ras TTCCTCAGGGCTCAAGAGAA ATTGGGCAGCAAAGAGATGT
H-Ras TGCCATCAACAACACCAAGT AGCCAGGTCACACTTGTTCC
BCL2 GTCTGGGAATCGATCTGGAA CATAAGGCAACGATCCCATC
C-MYC TAGTGGAAAACCAGCAGCCT GTGGAAAACCAGCAGCCT
HER2 AGTACCTGGGTCTGGACGTG AGCCAGGTCACACTTGTTCC
TGF-α TAGGCATTTCAGGCCAAATC TTAATAAAGCCGGCATCCTG
MmP1 CTTTTGATGGACCTGGAGGA AGTTCATGAGCTGCAACACG
MmP14 ACACAAACGAGGAATGAGGG CACTGGTGAGACAGGCTTGA
MDM2 CCAGCTTCGGAACAAGAGAC TTTCACAGAGAAGCTTGGCA
P53 GGCCCACTTCACCGTACTAA GTGGTTTCAAGGCCAGATGT
MDR1 GTGGGGCAAGTCAGTTCATT TTCCAATGTGTTCGGCATTA
β-Actin CCACACCTTCTACAATGAGC CATGATCTGGGTCATCCTCTCG
Gene-specific sequences were obtained from NCBI. All primers were designed to be intron-spaning
to preclude amplification of genomic DNA using primer3 software. The size of the amplicon was
restricted to 100-250 bp. The best primer was selected by NCBI primer design blast program for
covering all alternative splicing. To normalized relative levels of expression, ß-actin was used as a
reliable internal reference control for this analysis.
0
50
100
150
200
250
BAC BCL2 C-MYC HER2 H-RAS K-RAS MDM2 MMP1 MMP14 P53 TGF
Figure 4. Gene Expression of Cancer/Normal
Patient # 28
Change