Recommended
More Related Content
Similar to Chapter_4_Hunt molecular cloning methods.ppt
Similar to Chapter_4_Hunt molecular cloning methods.ppt (20)
Recently uploaded
Recently uploaded (20)
Chapter_4_Hunt molecular cloning methods.ppt
- 1. Chapter 4 Molecular Cloning Methods Jay D. Hunt, Ph.D. Department of Biochemistry and Molecular Biology CSRB 4D1 568-4734 jhunt@lsuhsc.edu
- 3. • Restriction endonucleases – Restriction - Bacterial encoded restriction endonucleases restrict bacteriophages to only one host strain. – Endonuclease - Restriction endonucleases cleave nucleic acids in the middle.
- 4. • Subclasses of restriction endonucleases: – Type I - Recognize specific sequences and cleave DNA at a nonspecific site > than 1,000 bp away – Type II - Recognize palindromic sequences and cleave within the palindrome – Type III - Recognize specific 5-7 bp sequences and cleave 24-27 bp down stream of the site. • Type II restriction endonucleases are the most useful class, as they recognize specific palindromic sequences in DNA and cleave the phospodiester bonds in the ribose backbone within the palindrome
- 5. • A palindrome is anything that reads the same forwards and backwards: – Mom – Dad – Tarzan raised Desi Arnaz rat. – Able was I ere I saw Elba – Doc note I dissent, a fast never prevents a fatness; I diet on cod. – Do good? I? No! Evil anon I deliver. I maim nine more hero-men in Saginaw, sanitary sword a-tuck, Carol, I–lo– rack, cut a drowsy rat in Aswan. I gas nine more hero- men in Miami. Reviled, I (Nona) live on. I do, O God!
- 6. • In DNA, palindromes are defined as double stranded DNA that reads the same 5’ to 3’ • The EcoRI cutting site: – 5'-GAATTC-3' – 3'-CTTAAG-5' • The HindIII cutting site: – 5'-AAGCTT-3' – 3'-TTCGAA-5' Types of recognition sites: 4 bp 6 bp 8 bp 44 = 256 bp 46 = 4,096 bp 48 = 65,536 bp
- 7. Table 4.1
- 8. Figure 4.1
- 9. • Type II restriction endonucleases cut only at specific palindromic sites; therefore, “sticky ends” result from DNA cleavage. Fragments of DNA cut with the same enzyme will hybridize to these sticky ends.
- 10. Always indicate 5’ and 3’ ends of BOTH strands. 3'CTTAAG5' 3'CTTAA5' 3'G5' 5'GGATCC3' 3'CCTAGG5' 5'G3' 5'GATCC3' 3'CCTAG5 3'G5' EcoRI BamHI 5'GAATTC3' 5'G3' 5'AATTC3' HindIII 5'AAGCTT3' 3'TTCGAA5' 5'A3' 5'AGCTT3' 3'TTCGA5' 3'A5' 5’ overhang 5’ overhang 5’ overhang 5'GATATC3' 3'CTATAG5' 5'GAT3' 5'ATC3' 3'CTA5' 3'TAG5' EcoRV Blunt end 3'GACGTC5' 3'G5' 3'ACGTC5' 5'CTGCAG3' 5'CTGCA3' 5'G3' Pst I 3’ overhang
- 11. I. Restriction Endonucleases II. Cloning
- 14. Text Art Page 62
- 16. Figure 4.2
- 17. Figure 4.3 Origin of replication At least one unique restriction site A selectable marker
- 18. Figure 4.4
- 19. Figure 4.5
- 20. Figure 4.6 Multicloning site a-peptide of b-galactosidase
- 21. DNA fragment up to 5 KB can insert orip
- 22. a-peptide of b-galactosidase is encoded by lacZ NH2-terminal portion lacZ is disrupted by insert w-peptide is carried in genetically modified bacterial strains. COOH-terminal portion a-complementation occurs. 5-bromo-4-chloro-3-indolyl-b-D- Galactopyranoside (X-gal) is metabolized resulting in blue colonies No a-complementation occurs. White colonies
- 23. Figure 4.7b Addition of ligase would cause this to seal Without phosphate group, ligation cannot occur Phosphates are donated by the insert Ligation occurs
- 24. Figure 4.7a Note that the phosphate group is required for ligation to occur.
- 26. EcoRI EcoRI Kpn I 5'-G AATTC-3' 3'-CTTAA G-5' Digestion with EcoRI 5'-G C-3' 3'-CTTAA CATGG-5' Digestion with EcoRI & Kpn I
- 27. EcoRI EcoRI Kpn I Digest both insert and vector with EcoRI and Kpn I
- 28. Figure 4.8 Required for lysogenic lifecycle Required for lytic lifecycle (progeny produced) 12 to 20 KB inserts
- 29. Genomic Library Construction cos sites BamHI BamHI 12-20 KB insert BamHI BamHI BamHI BamHI BamHI BamHI BamHI BamHI BamHI ~4 KB Too short, not viable
- 30. Sau3A, ~250 bp -GGATCC- -CCTAGG- BamHI Sau3A -GATC- -CATG- -G -CCTAG GATC- - -GGATC- -CCTAG-
- 31. Digest with BamHI Partial Digest with Sau3A Isolate pieces 12-20 KB in length Combine Package into phage heads
- 32. Figure 4.9
- 34. Figure 4.10
- 35. Figure 4.11 40 to 50 KB inserts
- 36. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones
- 38. CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC GCCGATTCCAGCTAGTCAAGG GCCGATTCCAGCTAGTCAAGG Low stringency hybridization Low stringency washing conditions High salt concentration (0.3 M NaCl) Low temperature (20 to 30°C) Low organic solvent concentrations
- 39. CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC GCCGATTCCAGCTAGTCAAGG GCCGATTCCAGCTAGTCAAGG Low stringency hybridization High stringency washing conditions Low salt concentration (0.03 M NaCl) High temperature (65°C) High organic solvent concentrations
- 40. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones IV. PCR
- 41. Figure 4.12
- 42. Denaturation (94°C) + + Annealing (37-65°C) Extension (72°C) Template Primers dNTPs First round complete
- 44. 1 2 4 8 16 32 64
- 45. 30 rounds of PCR = 1,073,741,824 (1.07 X 109) copies 40 rounds of PCR = 1,099,511,628,000 (1.1 X 1012) copies Exponential Increase in Target DNA From 1 copy of template DNA
- 46. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones IV. PCR V. cDNA cloning
- 47. Figure 4.13
- 48. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones IV. PCR V. cDNA cloning VI. Labeling DNA with nick translation
- 49. Figure 4.14
- 50. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones IV. PCR V. cDNA cloning VI. Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR
- 51. Figure 4.15
- 52. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones IV. PCR V. cDNA cloning VI. Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR VIII.5’ RACE
- 53. Figure 4.16
- 54. I. Restriction Endonucleases II. Cloning III. Probes to detect specific clones IV. PCR V. cDNA cloning VI. Labeling DNA with nick translation VII.Cloning with Reverse Transcriptase-PCR VIII.5’ RACE IX. Expression vectors
- 55. Figure 4.17
- 56. Figure 4.19a
- 57. Figure 4.19b
- 58. Figure 4.20
- 59. Figure 4.21
- 60. Figure 4.22