SlideShare a Scribd company logo
1 of 24
Restriction Fragment Length
Polymorphism (RFLP)
Dr. Abdul Hameed,PhD
Chief Scientific Officer
Institute of Biomedical and Genetic Engineering (IBGE),
24-Mauve Area, G-9/1, Islamabad, Pakistan
ahameed0786@hotmail.com
RFLP – Restriction Fragment Length Polymorphism
 Variation in the DNA sequence of a genome
detected by cutting DNA into pieces with
restriction enzymes.
 Important tool in genome mapping, localization of
genetic disease genes, determination of risk for a
disease, genetic fingerprinting and paternity testing
etc.
Restriction Enzymes
Restriction Endonucleases
Also called restriction enzymes
1962: “molecular scissors” discovered in bacteria
3,000 enzymes have been identified, around 200 have
unique properties, many are purified and available
commercially
Restriction Endonucleases
Named for bacterial genus, species, strain, and type
Example: EcoR1
Genus: Escherichia
Species: coli
Strain: R
Order discovered: 1
Restriction Endonucleases
Enzymes recognize specific 4-8 bp sequences
Some enzymes cut in a staggered fashion - “sticky ends”
EcoRI 5’…GAATTC…3’
3’…CTTAAG…5’
Some enzymes cut in a direct fashion – “blunt ends”
PvuII 5’…CAGCTG…3’
3’…GTCGAC…5’
Uses for Restriction Enzymes
RFLP analysis (Restriction Fragment Length
Polymorphism)
DNA sequencing
DNA storage – libraries
Transformation
Large scale analysis – gene chips
Restriction Fragment Length
Polymorphism Analysis
1. DNA digestion with restriction enzyme(s)
2. Separation of Digested DNA on gel
electrophoresis
• Smear - Many DNA fragments with
slight differences in length
3. Denaturing the double-stranded DNA to make
it single-stranded by treating the gel
chemically
4. Southern blotting (Transfer of single stranded
DNA on to a positively charged nylon
membrane
RFLP Analysis
4. Southern blotting:
i. Transfer DNA from gel to
nylon membrane
ii. Expose nylon membrane to
solution with radioactive
complementary nucleotide
probes that hybridize to
specifically chosen DNA
sequences on nylon
membrane
iii. Place nylon membrane
against X-ray film, where
hybridized radioactive
probes cause exposure of
X-ray film, producing an
autoradiogram
http://www.cbs.dtu.dk/staff/dave/roanoke/genetics980211.html
Genotyping a biallelic RFLP
marker in a family.
• PCR amplification
• Digestion with restriction enzyme
• Separation of digested DNA fragments by agarose gel
electrophoresis
• Staining the gel with ethidium Bromide (Fluoresce under
UV-illumination only when bound to DNA
NPHS2 Mutation Identified By
DNA Sequencing
NPHS2 Gene: NORMAL Exon 5 Sequence
 cataggaaaggagcccaagaatcaagcctgtcatccaaacttttttctgcctagATCGTGACCAAAGA
CATGTTTATAATGGAGATAGATGCCATTTGCTACTACCGAATGGAAAATGCC
TCTCTTCTCCTAAGCAGTCTTGCTCATGTATCTAAAGCTGTGCAATTCCTTG
TGCAAACCACTATGAAGCGTCTCCTAGCACATCGATCCCTCACTGAAATTCT
TCTAGAGAGGAAGAGCATCGCCCAAGATGCAAAGgtacttagataaacataatggcca
atatgctgaaa
NPHS2 Gene: MUTANT exon 5 Sequence (9bp Del)
 cataggaaaggagcccaagaatcaagcctgtcatccaaacttttttctgcctagATCGTGACCAAAGA
CATGTTTATAATGGAGATAGATGCCATTTGCTACTACCGAATGGAAAATGCC
TCTCTTCTCCTAAGCAGTCTTGCTCATGTATCTAAAGCTGTGCAATTCCTTG
TGCAAACCACTATGAAGCGTCTCCTAGCACATCGATCCCTCACTGAAATTCT
GAAGAGCATCGCCCAAGATGCAAAGgtacttagataaacataatggccaatatgctgaaa
PCR-RFLP (NPHS2 Exon 5)
R.E Mapping (NEBcutter)
http://nc2.neb.com/NEBcutter2/
NPHS2, Ex.5 Restriction Maps
PCR-RFLP Steps
 PCR Amplification (NPHS2 Gene Ex.5)
 Digestion with R.E (XbaI)
 Agarose Gel Electrophoresis
 Gel Staining with Ethidium Bromide
 Gel Photograph Under UV-illumination
Figure 2: Molecular basis of nephrotic syndrome. (A) Pedigree of NPHS family
shows consanguineous family with three male patients (filled boxes). (B) RFLP
analysis of PCR fragment amplified from exon 5 of the NPHS2 gene utilizing Xba I
restriction enzyme. The 293bp PCR product of exon 5 for all family members was
digested with Xba I restriction enzyme. Fragments were resolved on 2.0% agarose
gel. Individuals with a single fragment of 284bp were identified as homozygous
mutant since they did not contain the restriction site for XbaI. Those with two
fragments (225bp and 68 bp) were heterozygous normal/carriers for the mutation. M:
DNA size standard, UC: Undigested control PCR product.
Choosing the Restriction Enzyme for your SNP
http://watcut.uwaterloo.ca/template.php
Paste FASTA sequence here
SNP in the sequence
[g/a]
Click
Click
Restriction Database (rebase)
 http://rebase.neb.com/rebase/rebase.ht
ml
HMD_PCR-RFLP_KIBGE_KCHI.pptx
HMD_PCR-RFLP_KIBGE_KCHI.pptx

More Related Content

Similar to HMD_PCR-RFLP_KIBGE_KCHI.pptx

Markers: Based on hybridization and PCR
Markers: Based on hybridization and PCRMarkers: Based on hybridization and PCR
Markers: Based on hybridization and PCRSachin Kumar
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptxArdiansyahPrayitno2
 
marker system presentation shiv shankar.pptx
marker system presentation shiv shankar.pptxmarker system presentation shiv shankar.pptx
marker system presentation shiv shankar.pptxShivshankarLoniya
 
DNA Fingerprinting for Taxonomy and Phylogeny.pptx
DNA Fingerprinting for Taxonomy and Phylogeny.pptxDNA Fingerprinting for Taxonomy and Phylogeny.pptx
DNA Fingerprinting for Taxonomy and Phylogeny.pptxsharanabasapppa
 
GENE KNOCKOUT
GENE KNOCKOUTGENE KNOCKOUT
GENE KNOCKOUTRANA SAHA
 
Recombinant DNA Technology and Drug Discovery
Recombinant DNA Technology and Drug DiscoveryRecombinant DNA Technology and Drug Discovery
Recombinant DNA Technology and Drug DiscoveryDivya V
 
Molecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansariMolecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansariTahura Mariyam Ansari
 
Role of biomarkers and dna fingerprinting in herbal drug standardisation
Role of biomarkers and dna fingerprinting in herbal drug standardisationRole of biomarkers and dna fingerprinting in herbal drug standardisation
Role of biomarkers and dna fingerprinting in herbal drug standardisationRoshni Ann
 
Hybridization based molecular markers 1
Hybridization based molecular markers 1Hybridization based molecular markers 1
Hybridization based molecular markers 1Faiza Khalid
 
RFLP - Restriction Fragment Length Polymorphism
RFLP - Restriction Fragment Length PolymorphismRFLP - Restriction Fragment Length Polymorphism
RFLP - Restriction Fragment Length PolymorphismDeepa Arumugam
 
Recombinant Dna technology, Restriction Endonucleas and Vector
Recombinant Dna technology, Restriction Endonucleas and Vector Recombinant Dna technology, Restriction Endonucleas and Vector
Recombinant Dna technology, Restriction Endonucleas and Vector Dr. Priti D. Diwan
 
Rflp wrt Restriction enzymes and pcr
Rflp   wrt Restriction enzymes and pcr Rflp   wrt Restriction enzymes and pcr
Rflp wrt Restriction enzymes and pcr pratik mahadwala
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISHtcha163
 
Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops Tabinda Wani
 
Congreso de Biotecnología Arequipa Perú June 2011
Congreso de Biotecnología Arequipa Perú June 2011Congreso de Biotecnología Arequipa Perú June 2011
Congreso de Biotecnología Arequipa Perú June 2011Mills Cbst
 

Similar to HMD_PCR-RFLP_KIBGE_KCHI.pptx (20)

Markers: Based on hybridization and PCR
Markers: Based on hybridization and PCRMarkers: Based on hybridization and PCR
Markers: Based on hybridization and PCR
 
Blotting techniques ppt
Blotting techniques pptBlotting techniques ppt
Blotting techniques ppt
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx
 
marker system presentation shiv shankar.pptx
marker system presentation shiv shankar.pptxmarker system presentation shiv shankar.pptx
marker system presentation shiv shankar.pptx
 
DNA Fingerprinting for Taxonomy and Phylogeny.pptx
DNA Fingerprinting for Taxonomy and Phylogeny.pptxDNA Fingerprinting for Taxonomy and Phylogeny.pptx
DNA Fingerprinting for Taxonomy and Phylogeny.pptx
 
GENE KNOCKOUT
GENE KNOCKOUTGENE KNOCKOUT
GENE KNOCKOUT
 
Recombinant DNA Technology and Drug Discovery
Recombinant DNA Technology and Drug DiscoveryRecombinant DNA Technology and Drug Discovery
Recombinant DNA Technology and Drug Discovery
 
Molecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansariMolecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansari
 
Role of biomarkers and dna fingerprinting in herbal drug standardisation
Role of biomarkers and dna fingerprinting in herbal drug standardisationRole of biomarkers and dna fingerprinting in herbal drug standardisation
Role of biomarkers and dna fingerprinting in herbal drug standardisation
 
Hybridization based molecular markers 1
Hybridization based molecular markers 1Hybridization based molecular markers 1
Hybridization based molecular markers 1
 
Recombinant DNA
Recombinant DNARecombinant DNA
Recombinant DNA
 
Molecular methods
Molecular methodsMolecular methods
Molecular methods
 
RFLP - Restriction Fragment Length Polymorphism
RFLP - Restriction Fragment Length PolymorphismRFLP - Restriction Fragment Length Polymorphism
RFLP - Restriction Fragment Length Polymorphism
 
Recombinant Dna technology, Restriction Endonucleas and Vector
Recombinant Dna technology, Restriction Endonucleas and Vector Recombinant Dna technology, Restriction Endonucleas and Vector
Recombinant Dna technology, Restriction Endonucleas and Vector
 
markers and their role
markers and their rolemarkers and their role
markers and their role
 
Rflp wrt Restriction enzymes and pcr
Rflp   wrt Restriction enzymes and pcr Rflp   wrt Restriction enzymes and pcr
Rflp wrt Restriction enzymes and pcr
 
Blotting techniques
Blotting techniquesBlotting techniques
Blotting techniques
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISH
 
Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops Marker and marker assisted breeding in flower crops
Marker and marker assisted breeding in flower crops
 
Congreso de Biotecnología Arequipa Perú June 2011
Congreso de Biotecnología Arequipa Perú June 2011Congreso de Biotecnología Arequipa Perú June 2011
Congreso de Biotecnología Arequipa Perú June 2011
 

Recently uploaded

(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomdiscovermytutordmt
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...vidya singh
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Servicevidya singh
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...narwatsonia7
 
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...indiancallgirl4rent
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...astropune
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...tanya dube
 
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...narwatsonia7
 
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escortsvidya singh
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...narwatsonia7
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...narwatsonia7
 
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore EscortsVIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escortsaditipandeya
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...parulsinha
 

Recently uploaded (20)

(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
 
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
 
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
 
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...
 
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Tirupati Just Call 8250077686 Top Class Call Girl Service Available
 
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore EscortsVIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escorts
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 

HMD_PCR-RFLP_KIBGE_KCHI.pptx

  • 1. Restriction Fragment Length Polymorphism (RFLP) Dr. Abdul Hameed,PhD Chief Scientific Officer Institute of Biomedical and Genetic Engineering (IBGE), 24-Mauve Area, G-9/1, Islamabad, Pakistan ahameed0786@hotmail.com
  • 2. RFLP – Restriction Fragment Length Polymorphism  Variation in the DNA sequence of a genome detected by cutting DNA into pieces with restriction enzymes.  Important tool in genome mapping, localization of genetic disease genes, determination of risk for a disease, genetic fingerprinting and paternity testing etc.
  • 4. Restriction Endonucleases Also called restriction enzymes 1962: “molecular scissors” discovered in bacteria 3,000 enzymes have been identified, around 200 have unique properties, many are purified and available commercially
  • 5. Restriction Endonucleases Named for bacterial genus, species, strain, and type Example: EcoR1 Genus: Escherichia Species: coli Strain: R Order discovered: 1
  • 6. Restriction Endonucleases Enzymes recognize specific 4-8 bp sequences Some enzymes cut in a staggered fashion - “sticky ends” EcoRI 5’…GAATTC…3’ 3’…CTTAAG…5’ Some enzymes cut in a direct fashion – “blunt ends” PvuII 5’…CAGCTG…3’ 3’…GTCGAC…5’
  • 7. Uses for Restriction Enzymes RFLP analysis (Restriction Fragment Length Polymorphism) DNA sequencing DNA storage – libraries Transformation Large scale analysis – gene chips
  • 8. Restriction Fragment Length Polymorphism Analysis 1. DNA digestion with restriction enzyme(s) 2. Separation of Digested DNA on gel electrophoresis • Smear - Many DNA fragments with slight differences in length 3. Denaturing the double-stranded DNA to make it single-stranded by treating the gel chemically 4. Southern blotting (Transfer of single stranded DNA on to a positively charged nylon membrane
  • 9. RFLP Analysis 4. Southern blotting: i. Transfer DNA from gel to nylon membrane ii. Expose nylon membrane to solution with radioactive complementary nucleotide probes that hybridize to specifically chosen DNA sequences on nylon membrane iii. Place nylon membrane against X-ray film, where hybridized radioactive probes cause exposure of X-ray film, producing an autoradiogram http://www.cbs.dtu.dk/staff/dave/roanoke/genetics980211.html
  • 10. Genotyping a biallelic RFLP marker in a family. • PCR amplification • Digestion with restriction enzyme • Separation of digested DNA fragments by agarose gel electrophoresis • Staining the gel with ethidium Bromide (Fluoresce under UV-illumination only when bound to DNA
  • 11. NPHS2 Mutation Identified By DNA Sequencing
  • 12. NPHS2 Gene: NORMAL Exon 5 Sequence  cataggaaaggagcccaagaatcaagcctgtcatccaaacttttttctgcctagATCGTGACCAAAGA CATGTTTATAATGGAGATAGATGCCATTTGCTACTACCGAATGGAAAATGCC TCTCTTCTCCTAAGCAGTCTTGCTCATGTATCTAAAGCTGTGCAATTCCTTG TGCAAACCACTATGAAGCGTCTCCTAGCACATCGATCCCTCACTGAAATTCT TCTAGAGAGGAAGAGCATCGCCCAAGATGCAAAGgtacttagataaacataatggcca atatgctgaaa NPHS2 Gene: MUTANT exon 5 Sequence (9bp Del)  cataggaaaggagcccaagaatcaagcctgtcatccaaacttttttctgcctagATCGTGACCAAAGA CATGTTTATAATGGAGATAGATGCCATTTGCTACTACCGAATGGAAAATGCC TCTCTTCTCCTAAGCAGTCTTGCTCATGTATCTAAAGCTGTGCAATTCCTTG TGCAAACCACTATGAAGCGTCTCCTAGCACATCGATCCCTCACTGAAATTCT GAAGAGCATCGCCCAAGATGCAAAGgtacttagataaacataatggccaatatgctgaaa PCR-RFLP (NPHS2 Exon 5)
  • 15. PCR-RFLP Steps  PCR Amplification (NPHS2 Gene Ex.5)  Digestion with R.E (XbaI)  Agarose Gel Electrophoresis  Gel Staining with Ethidium Bromide  Gel Photograph Under UV-illumination
  • 16. Figure 2: Molecular basis of nephrotic syndrome. (A) Pedigree of NPHS family shows consanguineous family with three male patients (filled boxes). (B) RFLP analysis of PCR fragment amplified from exon 5 of the NPHS2 gene utilizing Xba I restriction enzyme. The 293bp PCR product of exon 5 for all family members was digested with Xba I restriction enzyme. Fragments were resolved on 2.0% agarose gel. Individuals with a single fragment of 284bp were identified as homozygous mutant since they did not contain the restriction site for XbaI. Those with two fragments (225bp and 68 bp) were heterozygous normal/carriers for the mutation. M: DNA size standard, UC: Undigested control PCR product.
  • 17.
  • 18. Choosing the Restriction Enzyme for your SNP http://watcut.uwaterloo.ca/template.php
  • 20. SNP in the sequence [g/a] Click
  • 21. Click
  • 22. Restriction Database (rebase)  http://rebase.neb.com/rebase/rebase.ht ml