The document discusses various Linux commands for working with files and directories, downloading data from FTP servers, and running BLAST to analyze sequence data. It provides examples of using commands like ls, mkdir, cp, mv, rm, cd, tar, gzip, lftp, formatdb, and blastall. The document walks through cloning BLAST from an FTP site, preparing yeast sequence files for analysis, and running BLASTN and TBLASTX searches to identify matches between a sample sequence and the yeast database.

1. •
•
•

2. •
•
•
•

3. •
•
•
•
•

4. •
•
•
•
•
•
•
•
•
•
•
•

5. agcaaaagaa

7. •
•
•
•
•
•
•

8. •
•
•
•
•
•
•
•
•
•
•
•

9. $ rm -r arg1 arg2

10. -u
Date DATE

11. ✴
✴
✴
✴$ man man
✴
✴
✴
✴
$ man date

12. •
•
•
•
•
•
/
C:
usr Volume
WINDOWS Program Files
bin lib cdrom
system
CD-ROM
D:
pics
CD-ROM
pics

13. •
•
•
•
•
•
•
•
/
usr Volume /
bin lib cdrom pics

14. •
•
• $ pwd
•
•
•
•
•
•
• ~ $HOME
•
•

15. • /usr/lib
/
•
•
• usr/lib
usr Users
•
• /
• /Users/sesejun
bin lib sesejun
•
usr
• /Users/sesejun/
• .
• . /Users/sesejun
lib
• ./usr/lib
• ..
• .. /Users
• ../../usr/lib

16. • cd destination-dir
• destination-dir
• cd ..
jsmbp:~ sesejun$ pwd
/Users/sesejun
jsmbp:~ sesejun$ cd /usr/
jsmbp:/usr sesejun$ pwd
/usr
jsmbp:/usr sesejun$ cd lib
jsmbp:/usr/lib sesejun$ pwd
/usr/lib
jsmbp:/usr/lib sesejun$ cd /usr/bin/
jsmbp:/usr/bin sesejun$ pwd
/usr/bin
jsmbp:/usr/bin sesejun$ cd
jsmbp:~ sesejun$ pwd
/Users/sesejun
jsmbp:~ sesejun$

17. •
•
•
•
• -a:
• -F:
• -l:
sesembp:~ sesejun$ ls
Desktop Music test
Documents
Pictures ??????????????????
Library Public
Movies Sites
sesembp:~ sesejun$ ls -F
Desktop/ Music/ test/
Documents/
Pictures/ ??????????????????@
Library/ Public/
Movies/ Sites/

19. •
• mkdir [options] directory ...
• MaKe DIRectory
• test $ mkdir test
•
• rmdir [options] directory ...
•
• test
$ rmdir test

20. • cp [options] source-file ... directory
• cp [options] source-file new-file
•
• -i:
• -r:
• text1.txt text2.txt
jsmbp:~ sesejun$ cp text1.txt text2.txt
• text1.txt text2.txt tmp
jsmbp:~ sesejun$ mkdir tmp
jsmbp:~ sesejun$ ls tmp
jsmbp:~ sesejun$ cp text1.txt text2.txt tmp/
jsmbp:~ sesejun$ ls tmp
text1.txt text2.txt

21. • mv [options] source-file ... directory
• mv [options] old-path new-path
• text1.txt text2.txt
jsmbp:~ sesejun$ mv text1.txt text2.txt
• text1.txt text2.txt tmp
jsmbp:~/test sesejun$ ls
text1.txt text2.txt
jsmbp:~/test sesejun$ mkdir tmp
jsmbp:~/test sesejun$ mv text1.txt text2.txt tmp/
jsmbp:~/test sesejun$ ls
tmp
jsmbp:~/test sesejun$ ls tmp/
text1.txt text2.txt

22. • rm [options] file ...
•
• -r:
• -i:
• text1.txt text2.txt
jsmbp:~ sesejun$ rm text1.txt text2.txt
• tmp
jsmbp:~/test sesejun$ ls
tmp
jsmbp:~/test sesejun$ ls tmp/
text1.txt text2.txt
jsmbp:~/test sesejun$ rm -r tmp/
jsmbp:~/test sesejun$ ls
jsmbp:~/test sesejun$
•

23. •
•
• /Users/yourname
• Terminal
• mkdir work
• ls
• mkdir work/blast
• cd work/blast
•
•
•
•
•

25. •
•
•
•
•

26. •
•
•
•
•
•

27. •
•
•
•
jsmbp:~ sesejun$ sudo port -d install lftp
(
(
jsmbp:~ sesejun$ which lftp
/opt/local/bin/lftp
•
•
•
•

28. •
•
•
•
•
•
jsmbp:~ sesejun$ cd work/blast
jsmbp:~/work/blast sesejun$ lftp ftp.ncbi.nih.gov
lftp> cd blast/executables/release/2.2.16
lftp> mget blast-2.2.16-universal-macosx.tar.gz
( )
lftp> quit
jsmbp:~/work/blast sesejun$ tar zxvf blast-2.2.16-universal-
macosx.tar.gz
( )

29. jsmbp:~/work/blast sesejun$ lftp ftp.ncbi.nih.gov
lftp> cd blast/db/FASTA
lftp> ls
(
lftp> mget yeast.nt.gz
( )
lftp> quit
jsmbp:~/work/blast sesejun$ gzip -d yeast.nt.gz
•
•
•
•
•
•
•

30. •
•
•
•
•
•
jsmbp:~/work/blast sesejun$ mv ~/Desktop/myseq.fasta .

31. •
•
•
•
•
jsmbp:~/work/blast sesejun$ ls
( )
jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb -i yeast.nt
-p F -o T
jsmbp:~/work/blast sesejun$ ls
(8
)

32. jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb -i yeast.nt
-p F -o T ( )
jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb -i yeast.nt
-p T -o T ( )
jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb --help (
)

33. •
•
•
•
•
jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/blastall -p blastn -d
yeast.nt -i myseq.fasta
(blastn )
jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/blastall -p blastn -d
yeast.nt -i myseq.fasta -o myseq.out
(blastn myseq.out )
jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/blastall -p tblastx -
d yeast.nt -i myseq.fasta
(tblastx )

34. BLASTN 2.2.16 [Mar-25-2007]
Score E
Sequences producing significant alignments: (bits) Value
1
ref|NC_001142.1| Saccharomyces cerevisiae chromosome X, complete... 698 0.0
ref|NC_001145.1| Saccharomyces cerevisiae chromosome XIII, compl... 34 0.32
2
ref|NC_001136.2| Saccharomyces cerevisiae chromosome IV, complet... 32 1.3
>ref|NC_001142.1| Saccharomyces cerevisiae chromosome X, complete chromosome sequence
1 Length = 745440
Score = 698 bits (352), Expect = 0.0
Identities = 361/364 (99%)
Strand = Plus / Plus
Query: 177 tactcatcacgcgggcttaccgcaatggtctaatagcatggctagtcaccattttcccaa 236
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 545951 tactcatcacgcgggcttaccgcaaaggtctaatagcatggctagtcaccattttcccaa 546010
>ref|NC_001145.1| Saccharomyces cerevisiae chromosome XIII, complete chromosome sequence
Length = 924430
2 = 34.2 bits (17), Expect = 0.32
Score
Identities = 17/17 (100%)
Strand = Plus / Minus