Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.



Published on

Published in: Technology
  • Be the first to comment

  • Be the first to like this


  1. 1. • • • • •
  2. 2. • • GCATGCAT A C G T T C G T
  3. 3. • • • • • • • •
  4. 4. • • • BLASTN 2.2.16 [Mar-25-2007] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programsquot;, Nucleic Acids Res. 25:3389-3402. Query= ORFN:12 Multiple, Contig c912 1285-2874 reverse complement (1590 letters) Database: yeast.nt 17 sequences; 12,155,026 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value ref|NC_001143.1| Saccharomyces cerevisiae chromosome XI, complet... 72 4e-12 ref|NC_001133.1| Saccharomyces cerevisiae chromosome I, complete... 72 4e-12
  5. 5. >ref|NC_001143.1| Saccharomyces cerevisiae chromosome XI, complete chromosome sequence Length = 666445 Score = 71.9 bits (36), Expect = 4e-12 Identities = 75/88 (85%) Strand = Plus / Plus Query: 946 attactgttacttcctgtgagtctggtgtctgctctgaaaccgcttctcccgctattgtt 1005 ||||| |||||||| ||||||||||||||||| || ||||| ||||| || ||||| ||| Sbjct: 648979 attacggttacttcttgtgagtctggtgtctgttccgaaactgcttcacctgctatcgtt 649038 Query: 1006 tccacagccacaaccaccatcaatgatg 1033 || |||||||| | ||| ||||||||| Sbjct: 649039 tcgacagccactgctaccgtcaatgatg 649066 Score = 71.9 bits (36), Expect = 4e-12 Identities = 75/88 (85%) Strand = Plus / Plus Query: 1099 attactgttacttcctgtgagtctggtgtctgctctgaaaccgcttctcccgctattgtt 1158 ||||| |||||||| ||||||||||||||||| || ||||| ||||| || ||||| ||| Sbjct: 648979 attacggttacttcttgtgagtctggtgtctgttccgaaactgcttcacctgctatcgtt 649038 Query: 1159 tccacagccacaaccaccatcaatgatg 1186 || |||||||| | ||| ||||||||| Sbjct: 649039 tcgacagccactgctaccgtcaatgatg 649066 Score = 44.1 bits (22), Expect = 0.001 Identities = 31/34 (91%) Strand = Plus / Plus Query: 1479 atctagcaccgcctctttagaaatgtcaagctac 1512 |||||| || ||||||||||| ||||||||||||
  6. 6. $ cd ~/work/blast/bayanus/ $ curl -o 12.genome.fasta quot; efetch.fcgi? db=genome&id=NC_001143.1&seq_start=648879&seq_stop=649166&strand=1&rettype=fastaquot; >gi|6322623:648879-649066 Saccharomyces cerevisiae chromosome XI, complete chromosome sequence CATCAATGGGATTACCACTGAATATACTACATGGTGCCCTCTTTCTGCTACGGAATTAACAACGGTAAGT AAATTAGAGTCAGAAGAAAAAACCACCCTAATTACGGTTACTTCTTGTGAGTCTGGTGTCTGTTCCGAAA CTGCTTCACCTGCTATCGTTTCGACAGCCACTGCTACCGTCAATGATG
  7. 7. • • • • • • • • • •
  8. 8. • • • • • jsmbp:~ sesejun$ sudo port -d selfupdate ( PC jsmbp:~ sesejun$ sudo port -d install ImageMagick jsmbp:~ sesejun$ sudo port -d install ghostscript
  9. 9. • • • jsmbp:~ sesejun$ mkdir bin jsmbp:~ sesejun$ cd bin jsmbp:~/bin sesejun$ lftp lftp> mget EMBOSS-5.0.0.tar.gz ( lftp> quit jsmbp:~/bin sesejun$ tar zxvf EMBOSS-5.0.0.tar.gz ( jsmbp:~/bin sesejun$ cd EMBOSS-5.0.0 jsmbp:~/bin sesejun$ ./configure ( jsmbp:~/bin sesejun$ make (
  10. 10. • • • • • • • • • •
  11. 11. • • $ ~/bin/EMBOSS-5.0.0/emboss/dotmatcher 12.genome.fasta 12.fasta -graph ps -threshold 35 -goutfile 12.fasta $ convert 12.fasta.png ImageMagick $ open 12.fasta.png 12.fasta.png
  12. 12. A T G C S W R Y K M B V H D N U A 5 -4 -4 -4 -4 1 1 -4 -4 1 -4 -1 -1 -1 -2 -4 T -4 5 -4 -4 -4 1 -4 1 1 -4 -1 -4 -1 -1 -2 5 G -4 -4 5 -4 1 -4 1 -4 1 -4 -1 -1 -4 -1 -2 -4 C -4 -4 -4 5 1 -4 -4 1 -4 1 -1 -1 -1 -4 -2 -4 S -4 -4 1 1 -1 -4 -2 -2 -2 -2 -1 -1 -3 -3 -1 -4 W 1 1 -4 -4 -4 -1 -2 -2 -2 -2 -3 -3 -1 -1 -1 1 R 1 -4 1 -4 -2 -2 -1 -4 -2 -2 -3 -1 -3 -1 -1 -4 Y -4 1 -4 1 -2 -2 -4 -1 -2 -2 -1 -3 -1 -3 -1 1 K -4 1 1 -4 -2 -2 -2 -2 -1 -4 -1 -3 -3 -1 -1 1 M 1 -4 -4 1 -2 -2 -2 -2 -4 -1 -3 -1 -1 -3 -1 -4 B -4 -1 -1 -1 -1 -3 -3 -1 -1 -3 -1 -2 -2 -2 -1 -1 V -1 -4 -1 -1 -1 -3 -1 -3 -3 -1 -2 -1 -2 -2 -1 -4 H -1 -1 -4 -1 -3 -1 -3 -1 -3 -1 -2 -2 -1 -2 -1 -1 D -1 -1 -1 -4 -3 -1 -1 -3 -1 -3 -2 -2 -2 -1 -1 -1 N -2 -2 -2 -2 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -2 U -4 5 -4 -4 -4 1 -4 1 1 -4 -1 -4 -1 -1 -2 5
  13. 13. • • • • • • • • • • •
  14. 14. #!/bin/bash for i in *.fasta.result;do n=`echo $i | sed 's/..*//'` echo $n url=`ruby blastparse.rb $n.fasta.result` case $url in http*) echo $url curl -s -o $n.genome.fasta $url ~/bin/EMBOSS-5.0.0/emboss/dotmatcher $n.genome.fasta $n.fasta -graph ps -threshold 35 -goutfile $n.fasta convert $ $n.fasta.png ;; esac done 10 db=genome&id=NC_001142.1&seq_start=722530&seq_stop=723085&strand =2&rettype=fasta Displays a thresholded dotplot of two sequences Created 101 db=genome&id=NC_001146.1&seq_start=57506&seq_stop=57900&strand=1 &rettype=fasta Displays a thresholded dotplot of two sequences Created
  15. 15. • • • 1. 2. 3. 4. • •
