1) The study found that traumatic brain injury (TBI) caused a transient upregulation of the protein ephrin-B1 in astrocytes in the hippocampus. This upregulation coincided with a decline in glutamatergic synapses in the CA1 region at 3 days post-injury.
2) Ablating ephrin-B1 specifically from astrocytes accelerated the recovery of glutamatergic synapses after TBI, suggesting ephrin-B1 plays a role in injury-induced synapse remodeling.
3) The study provides evidence that astrocytic ephrin-B1 may act through activating STAT3 signaling in astrocytes, as ephrin-B1 activation in cultured
This document summarizes research on recovery of motor function after stroke and spinal cord injury. It discusses evidence that motor function can improve through recovery of marginally functional neurons or relearning via neuroplasticity. Studies in rats and primates found improved motor skills after stroke when rehabilitation was paired with low-frequency stimulation of the injured cortex. A clinical trial also found improvements in hand function in stroke patients receiving motor cortex stimulation during rehabilitation. The document also reviews research attempting to promote regeneration in severed spinal cords by rerouting peripheral nerves, with initial positive results seen in human patients with traumatic paraplegia.
This document summarizes a study that investigated the effects of total knee arthroplasty (TKA) and neuromuscular electrical stimulation (NMES) on mitochondrial subpopulations in skeletal muscle. The study found that TKA caused significant muscle atrophy and loss of both subsarcolemmal (SS) and intermyofibrillar (IMF) mitochondria. NMES prevented muscle atrophy and maintained IMF mitochondrial content but not SS mitochondrial content. Specifically, TKA reduced IMF mitochondrial area by 19% and SS mitochondria per unit of sarcolemma by 64%, while NMES maintained IMF mitochondrial area above baseline and reduced the SS mitochondrial loss to 55%. The results suggest that decreased neural activation following TKA leads to mitochondrial
Testing for the carry-over loss time period of SCI patients via FES in conjun...Emily Koehler
This document discusses functional electrical stimulation (FES) therapy for patients with spinal cord injuries or stroke. It aims to determine if there is a correlation between the duration of FES therapy and how long the "carryover effect" persists. The carryover effect is when patients regain some motor function after therapy ends thought to be from muscle memory retraining. Patients with foot drop will undergo FES therapy for varying durations from 6 months to 1 year. An algorithm will assess their capacity scores before, during, and after therapy to detect if and when the carryover effect occurs. The study hopes to identify a time frame for FES therapy that maximizes the chances of patients regaining voluntary motor control after treatment ends.
This document summarizes research on using stem cells to treat traumatic brain injury (TBI). It discusses how endogenous neural stem cells in the brain respond to TBI by increasing proliferation. It also reviews studies transplanting various stem cell types into TBI models, including mesenchymal stem cells, neural stem cells, and embryonic stem cells, finding improved outcomes. Challenges include ensuring safety and reducing inflammation. Stem cells show promise for enhancing regeneration after TBI.
Edgardo J. Arroyo is an Associate Research Scientist at Yale University School of Medicine who has extensive experience researching various aspects of myelin formation, degradation, and regeneration in the central and peripheral nervous systems. His research has focused on elucidating the cellular mechanisms and microanatomy of neuron-glial interactions using techniques such as immunohistochemistry, confocal microscopy, and biochemistry. He has studied topics such as the effects of spinal cord injury, stem cell transplantation, sodium channel expression after nerve damage, and how demyelination affects the molecular organization of nodes of Ranvier.
1) The study assessed changes in hippocampal dendritic spines of APP/PS1 transgenic mice, a model of Alzheimer's disease.
2) It found a substantial decrease in the frequency of large dendritic spines in plaque-free regions of the dentate gyrus in these mice compared to controls.
3) Dendrites passing through amyloid plaques also showed alterations in spine density and morphology, with lower spine density within plaques and higher density on dendrites contacting plaques.
The temporal branch of the facial nerve is a commonly injured nerve during facial trauma due to its superficial course over the zygomatic arch, and is a commonly damaged nerve during facial surgery.1 We report a case of trauma to the left temporal fossa, and subsequent unilateral forehead paralysis. Early exploration revealed external suture compression as the origin of his paralysis. Removal of the suture led to complete resolution of the neurological deficit. The differential diagnosis did not include the possibility of the compression of the nerve by a suture, however the decision for early exploration led to a full recovery.
This document discusses the relationship between brain-derived neurotrophic factor (BDNF) and physical activity. It finds that regular exercise is associated with increased levels of BDNF and protects against cognitive decline. A study is summarized that measured serum BDNF levels in humans and found higher levels were associated with greater cardio-respiratory fitness and more physical activity. BDNF is synthesized in multiple tissues and stored in platelets, and may be released into the bloodstream during exercise in a dose-dependent manner influenced by fitness levels. Increased BDNF then influences learning, memory, and neuroplasticity through binding to receptors in the brain. More research is still needed to fully understand the acute effects of exercise on BDNF release and gene transcription.
This document summarizes research on recovery of motor function after stroke and spinal cord injury. It discusses evidence that motor function can improve through recovery of marginally functional neurons or relearning via neuroplasticity. Studies in rats and primates found improved motor skills after stroke when rehabilitation was paired with low-frequency stimulation of the injured cortex. A clinical trial also found improvements in hand function in stroke patients receiving motor cortex stimulation during rehabilitation. The document also reviews research attempting to promote regeneration in severed spinal cords by rerouting peripheral nerves, with initial positive results seen in human patients with traumatic paraplegia.
This document summarizes a study that investigated the effects of total knee arthroplasty (TKA) and neuromuscular electrical stimulation (NMES) on mitochondrial subpopulations in skeletal muscle. The study found that TKA caused significant muscle atrophy and loss of both subsarcolemmal (SS) and intermyofibrillar (IMF) mitochondria. NMES prevented muscle atrophy and maintained IMF mitochondrial content but not SS mitochondrial content. Specifically, TKA reduced IMF mitochondrial area by 19% and SS mitochondria per unit of sarcolemma by 64%, while NMES maintained IMF mitochondrial area above baseline and reduced the SS mitochondrial loss to 55%. The results suggest that decreased neural activation following TKA leads to mitochondrial
Testing for the carry-over loss time period of SCI patients via FES in conjun...Emily Koehler
This document discusses functional electrical stimulation (FES) therapy for patients with spinal cord injuries or stroke. It aims to determine if there is a correlation between the duration of FES therapy and how long the "carryover effect" persists. The carryover effect is when patients regain some motor function after therapy ends thought to be from muscle memory retraining. Patients with foot drop will undergo FES therapy for varying durations from 6 months to 1 year. An algorithm will assess their capacity scores before, during, and after therapy to detect if and when the carryover effect occurs. The study hopes to identify a time frame for FES therapy that maximizes the chances of patients regaining voluntary motor control after treatment ends.
This document summarizes research on using stem cells to treat traumatic brain injury (TBI). It discusses how endogenous neural stem cells in the brain respond to TBI by increasing proliferation. It also reviews studies transplanting various stem cell types into TBI models, including mesenchymal stem cells, neural stem cells, and embryonic stem cells, finding improved outcomes. Challenges include ensuring safety and reducing inflammation. Stem cells show promise for enhancing regeneration after TBI.
Edgardo J. Arroyo is an Associate Research Scientist at Yale University School of Medicine who has extensive experience researching various aspects of myelin formation, degradation, and regeneration in the central and peripheral nervous systems. His research has focused on elucidating the cellular mechanisms and microanatomy of neuron-glial interactions using techniques such as immunohistochemistry, confocal microscopy, and biochemistry. He has studied topics such as the effects of spinal cord injury, stem cell transplantation, sodium channel expression after nerve damage, and how demyelination affects the molecular organization of nodes of Ranvier.
1) The study assessed changes in hippocampal dendritic spines of APP/PS1 transgenic mice, a model of Alzheimer's disease.
2) It found a substantial decrease in the frequency of large dendritic spines in plaque-free regions of the dentate gyrus in these mice compared to controls.
3) Dendrites passing through amyloid plaques also showed alterations in spine density and morphology, with lower spine density within plaques and higher density on dendrites contacting plaques.
The temporal branch of the facial nerve is a commonly injured nerve during facial trauma due to its superficial course over the zygomatic arch, and is a commonly damaged nerve during facial surgery.1 We report a case of trauma to the left temporal fossa, and subsequent unilateral forehead paralysis. Early exploration revealed external suture compression as the origin of his paralysis. Removal of the suture led to complete resolution of the neurological deficit. The differential diagnosis did not include the possibility of the compression of the nerve by a suture, however the decision for early exploration led to a full recovery.
This document discusses the relationship between brain-derived neurotrophic factor (BDNF) and physical activity. It finds that regular exercise is associated with increased levels of BDNF and protects against cognitive decline. A study is summarized that measured serum BDNF levels in humans and found higher levels were associated with greater cardio-respiratory fitness and more physical activity. BDNF is synthesized in multiple tissues and stored in platelets, and may be released into the bloodstream during exercise in a dose-dependent manner influenced by fitness levels. Increased BDNF then influences learning, memory, and neuroplasticity through binding to receptors in the brain. More research is still needed to fully understand the acute effects of exercise on BDNF release and gene transcription.
Review on Feature Extraction and Classification of Neuromuscular DisordersIJMTST Journal
Electromyography is an efficient tool for the diagnosis of neuromuscular diseases. There are wide variety
of neuromuscular diseases that affects the muscles and nervous system, in which the most important are
Amyotrophic Lateral Sclerosis (ALS) and Myopathy. These diseases change the shape and characteristic of
motor unit action potentials (MUAPs). By analyzing the EMG signals and MUAPs neuromuscular diseases can
be diagnosed. This paper gives a brief review of various techniques used in the analysis of EMG signals for
the diagnosis of neuromuscular diseases. Various features that are extracted from the signals in time
domain, frequency domain and time-frequency domain and different classification techniques and their
performance are also studied in this paper
This study assessed sub-chronic neuropathological and biochemical changes in the mouse visual system 3 weeks after repetitive mild traumatic brain injury (r-mTBI). Histological analysis found increased cellularity and areas of demyelination in the optic nerves of r-mTBI mice compared to repetitive sham controls. The number of retinal ganglion cells was also decreased by about 25% in r-mTBI mice. Proteomic analysis of optic nerves showed changes indicating effects on neuronal processes like microtubule depolymerization and filament disassembly. Lipidomic analysis found changes in phospholipid species, including an increase in lysophosphatidylcholine, a demyelinating agent. The results indicate
This document summarizes a thesis that investigated the effects of zinc supplementation on behavioral outcomes following traumatic brain injury (TBI) using rat models. The thesis tested whether zinc supplementation could improve depression-like behavior in the Porsolt swim test, open field behaviors, and novel object recognition memory after TBI. It also examined whether these effects were mediated by the hippocampus by irradiating the hippocampus to prevent neuronal proliferation. The thesis found that the Porsolt swim test was not appropriate for measuring depression-like behavior in TBI models. TBI impaired novel object recognition but zinc supplementation did not improve this. Irradiating the hippocampus increased anxiety and reduced activity, and zinc did not improve these either. Therefore, zinc's effects on
Neural adaptations to aerobic and resistance exercise training in geriatric p...Mohammad azharuddin
The document discusses several neural adaptations that can occur with anaerobic training:
1) Increased motor cortex activity leads to greater motor unit activation and recruitment of fast-twitch motor units.
2) Adaptations in the spinal cord allow for enhanced recruitment of fast-twitch motor units to support higher force production.
3) Motor units can adapt through increased firing rates and recruitment of more motor units to generate greater force. Orderly recruitment is governed by the size principle from low to high threshold motor units.
4) The neuromuscular junction may also adapt through changes induced by high-intensity versus low-intensity exercise training.
This document discusses the neural hypothesis of tendon overuse injuries. It proposes that biochemical mediators released by nerve endings in the tendon can stimulate nociceptors and cause pain. Substance P and glutamate have been found in tendon tissue and are known to be pain mediators. The neural hypothesis suggests that overstimulation of nerves in the tendon by these mediators leads to tissue breakdown over time. Chronic tendon pain may be caused by these mediators irritating nociceptors in or around the tendon. The neural hypothesis provides an alternative to previous mechanical and vascular theories of tendinopathy.
Microglia-Derived ExosomalmicroRNA-151-3p enhances functional Healing After Spinal Cord Injury by attenuating Neuronal Apoptosis via Regulating the p53/p21/ CDK1 Signaling Pathway
This document discusses the relationship between angiogenesis, neurogenesis, and learning/memory in the context of aerobic exercise. It notes that exercise promotes both angiogenesis (growth of new blood vessels) and neurogenesis (growth of new neurons) in brain areas involved in learning and memory. However, the specific contributions of angiogenesis versus neurogenesis to improved cognitive performance with exercise are unclear. The study aimed to investigate this by pharmacologically blocking angiogenesis or neurogenesis separately in exercising animals, and then assessing spatial memory performance. Results showed that blocking angiogenesis impaired memory, while blocking neurogenesis unexpectedly enhanced memory, suggesting angiogenesis may be more important than neurogenesis for normal learning and memory with exercise.
This master's thesis explores long-latency post-stimulus effects (PStEs) observed in stimulus-triggered averages of electromyography (EMG) recordings following intracortical microstimulation of the primary motor cortex in rhesus monkeys. The author develops a novel statistical method to identify significant long-latency PStEs up to 60ms after stimulation. Facilitatory PStEs were bimodal at 16ms and 46ms, while suppressive PStEs were bimodal at 14ms and 29ms. This work takes initial steps to characterize long-latency PStEs and investigate the neural pathways that may generate them.
This document discusses the challenges of using neuroimaging techniques like fMRI to map mental phenomena to brain functions. It outlines issues like lack of gold standards in psychiatry diagnoses, identifying subtle pathological features, validating imaging markers, and dealing with noise, artifacts, and multiple comparisons in analysis. It proposes a framework for developing reliable neuroimaging biomarkers, including identifying clinically relevant questions, ensuring markers measure intended biological processes, demonstrating predictive value, promoting transparent/reproducible research, and standardizing methods. Overall, the document analyzes the limitations of neuroimaging and offers solutions to strengthen its use in psychiatry.
Peripheral nerve injury in the upper extremity is common and can result from repetitive strain, direct trauma, or compression. The most common site of injury is the carpal tunnel. A thorough history and physical exam is important to determine the location and nature of symptoms in order to establish a differential diagnosis. While imaging and electrodiagnostic testing may be warranted for persistent or worsening symptoms, most nerve injuries are initially treated conservatively with splinting, injections, or activity modification. Recovery depends on the severity of injury, with mild injuries having better prognosis.
1. The study investigated whether an axonal targeting sequence exists in the survival motor neuron (SMN) protein by analyzing a truncated form of SMN (SMN236) containing exons 2, 3 and 6.
2. The results showed that SMN236 co-localized with Gemin3 in axonal granules in neuroblastoma cells, similarly to full-length SMN. Granules containing SMN236 also exhibited bidirectional movement along axons comparable to granules containing full-length SMN.
3. These findings suggest that an axonal targeting sequence is located within exons 2, 3 and/or 6 of SMN. Identifying this sequence could help further characterize SMN's role
Body Burden of Aluminum in Chronic Fatigue Syndrome v2zq
Body Burden of Aluminum in Chronic Fatigue Syndrome - Resources for Healthy Children www.scribd.com/doc/254613619 - For more information, Please see Organic Edible Schoolyards & Gardening with Children www.scribd.com/doc/254613963 - Gardening with Volcanic Rock Dust www.scribd.com/doc/254613846 - Double Food Production from your School Garden with Organic Tech www.scribd.com/doc/254613765 - Free School Gardening Art Posters www.scribd.com/doc/254613694 - Increase Food Production with Companion Planting in your School Garden www.scribd.com/doc/254609890 - Healthy Foods Dramatically Improves Student Academic Success www.scribd.com/doc/254613619 - City Chickens for your Organic School Garden www.scribd.com/doc/254613553 - Huerto Ecológico, Tecnologías Sostenibles, Agricultura Organica www.scribd.com/doc/254613494 - Simple Square Foot Gardening for Schools - Teacher Guide www.scribd.com/doc/254613410 - Free Organic Gardening Publications www.scribd.com/doc/254609890 ~
1) Musculoskeletal pain can cause changes in motor activity and control, including both increases and decreases in muscle activity.
2) Experimental evidence shows that nociception affects motor function through changes in muscle activity, neuronal control mechanisms, proprioception, and local muscle morphology.
3) Various models have been proposed to explain motor responses to pain, including the vicious cycle model and pain adaptation model, but these do not fully capture the complex scenario seen clinically, particularly in chronic pain.
This document summarizes key aspects of acetylcholine (ACh) signaling at the neuromuscular junction. It discusses how ACh is synthesized from choline and acetyl-CoA by the enzyme choline acetyltransferase and degraded by acetylcholinesterase into choline and acetate. It describes the composition of the nicotinic acetylcholine receptor as having alpha, beta, gamma, delta or epsilon subunits. Common disorders that affect ACh signaling like myasthenia gravis and inherited disorders are also mentioned. The document poses review questions about ACh synthesis, degradation, the acetylcholine receptor, and associated disorders.
- Corazonin, AKH, and ACP are present in clusters of cells in the central nervous system of Rhodnius prolixus. AKH is also present in the corpus cardiacum.
- AKH increases lipid levels in the haemolymph, while corazonin increases heartbeat frequency. No effects were observed for ACP.
- The distribution and physiological roles of these neuropeptides in R. prolixus were mapped through immunohistochemistry and assays measuring lipid mobilization and heart contraction frequency.
1) Amyloid precursor protein (APP) is an integral transmembrane protein coded for on chromosome 21 that is overproduced in Alzheimer's disease and Down syndrome.
2) Cleavage of APP by proteases normally produces signaling peptides, but overproduction leads to accumulation of amyloid plaques that can cause neuron death.
3) The plaques are especially problematic in the hippocampus and impair functions like learning and memory.
This document discusses various materials and therapies for peripheral nerve regeneration. It covers guidance therapies using nerve conduits made from natural and synthetic biomaterials. Biomolecular therapies involve delivering growth factors to promote regeneration. Cellular therapies utilize Schwann cells, stem cells, and genetically modified cells. Advanced techniques include nerve conduits fabricated using 3D printing, injection molding and aligned polymer fibers. Future areas of focus are multi-chamber conduits and stem cell therapies to further enhance regeneration.
Scientists have identified a protein called Erk that is necessary for wrapping nerve fibers with myelin, an insulating substance that allows messages to travel from the brain to the body. Erk is important for neurodevelopment and genetic mutations linked to it have been associated with neurodevelopmental disorders. Researchers also discovered that a microRNA called miR-96 regulates hair cell development in the inner ear and is responsible for coordinating hearing; a mutation in miR-96 has been shown to cause deafness in humans. These findings provide insights into neurodevelopmental disorders and hearing loss, and could lead to new therapies.
Review on Feature Extraction and Classification of Neuromuscular DisordersIJMTST Journal
Electromyography is an efficient tool for the diagnosis of neuromuscular diseases. There are wide variety
of neuromuscular diseases that affects the muscles and nervous system, in which the most important are
Amyotrophic Lateral Sclerosis (ALS) and Myopathy. These diseases change the shape and characteristic of
motor unit action potentials (MUAPs). By analyzing the EMG signals and MUAPs neuromuscular diseases can
be diagnosed. This paper gives a brief review of various techniques used in the analysis of EMG signals for
the diagnosis of neuromuscular diseases. Various features that are extracted from the signals in time
domain, frequency domain and time-frequency domain and different classification techniques and their
performance are also studied in this paper
This study assessed sub-chronic neuropathological and biochemical changes in the mouse visual system 3 weeks after repetitive mild traumatic brain injury (r-mTBI). Histological analysis found increased cellularity and areas of demyelination in the optic nerves of r-mTBI mice compared to repetitive sham controls. The number of retinal ganglion cells was also decreased by about 25% in r-mTBI mice. Proteomic analysis of optic nerves showed changes indicating effects on neuronal processes like microtubule depolymerization and filament disassembly. Lipidomic analysis found changes in phospholipid species, including an increase in lysophosphatidylcholine, a demyelinating agent. The results indicate
This document summarizes a thesis that investigated the effects of zinc supplementation on behavioral outcomes following traumatic brain injury (TBI) using rat models. The thesis tested whether zinc supplementation could improve depression-like behavior in the Porsolt swim test, open field behaviors, and novel object recognition memory after TBI. It also examined whether these effects were mediated by the hippocampus by irradiating the hippocampus to prevent neuronal proliferation. The thesis found that the Porsolt swim test was not appropriate for measuring depression-like behavior in TBI models. TBI impaired novel object recognition but zinc supplementation did not improve this. Irradiating the hippocampus increased anxiety and reduced activity, and zinc did not improve these either. Therefore, zinc's effects on
Neural adaptations to aerobic and resistance exercise training in geriatric p...Mohammad azharuddin
The document discusses several neural adaptations that can occur with anaerobic training:
1) Increased motor cortex activity leads to greater motor unit activation and recruitment of fast-twitch motor units.
2) Adaptations in the spinal cord allow for enhanced recruitment of fast-twitch motor units to support higher force production.
3) Motor units can adapt through increased firing rates and recruitment of more motor units to generate greater force. Orderly recruitment is governed by the size principle from low to high threshold motor units.
4) The neuromuscular junction may also adapt through changes induced by high-intensity versus low-intensity exercise training.
This document discusses the neural hypothesis of tendon overuse injuries. It proposes that biochemical mediators released by nerve endings in the tendon can stimulate nociceptors and cause pain. Substance P and glutamate have been found in tendon tissue and are known to be pain mediators. The neural hypothesis suggests that overstimulation of nerves in the tendon by these mediators leads to tissue breakdown over time. Chronic tendon pain may be caused by these mediators irritating nociceptors in or around the tendon. The neural hypothesis provides an alternative to previous mechanical and vascular theories of tendinopathy.
Microglia-Derived ExosomalmicroRNA-151-3p enhances functional Healing After Spinal Cord Injury by attenuating Neuronal Apoptosis via Regulating the p53/p21/ CDK1 Signaling Pathway
This document discusses the relationship between angiogenesis, neurogenesis, and learning/memory in the context of aerobic exercise. It notes that exercise promotes both angiogenesis (growth of new blood vessels) and neurogenesis (growth of new neurons) in brain areas involved in learning and memory. However, the specific contributions of angiogenesis versus neurogenesis to improved cognitive performance with exercise are unclear. The study aimed to investigate this by pharmacologically blocking angiogenesis or neurogenesis separately in exercising animals, and then assessing spatial memory performance. Results showed that blocking angiogenesis impaired memory, while blocking neurogenesis unexpectedly enhanced memory, suggesting angiogenesis may be more important than neurogenesis for normal learning and memory with exercise.
This master's thesis explores long-latency post-stimulus effects (PStEs) observed in stimulus-triggered averages of electromyography (EMG) recordings following intracortical microstimulation of the primary motor cortex in rhesus monkeys. The author develops a novel statistical method to identify significant long-latency PStEs up to 60ms after stimulation. Facilitatory PStEs were bimodal at 16ms and 46ms, while suppressive PStEs were bimodal at 14ms and 29ms. This work takes initial steps to characterize long-latency PStEs and investigate the neural pathways that may generate them.
This document discusses the challenges of using neuroimaging techniques like fMRI to map mental phenomena to brain functions. It outlines issues like lack of gold standards in psychiatry diagnoses, identifying subtle pathological features, validating imaging markers, and dealing with noise, artifacts, and multiple comparisons in analysis. It proposes a framework for developing reliable neuroimaging biomarkers, including identifying clinically relevant questions, ensuring markers measure intended biological processes, demonstrating predictive value, promoting transparent/reproducible research, and standardizing methods. Overall, the document analyzes the limitations of neuroimaging and offers solutions to strengthen its use in psychiatry.
Peripheral nerve injury in the upper extremity is common and can result from repetitive strain, direct trauma, or compression. The most common site of injury is the carpal tunnel. A thorough history and physical exam is important to determine the location and nature of symptoms in order to establish a differential diagnosis. While imaging and electrodiagnostic testing may be warranted for persistent or worsening symptoms, most nerve injuries are initially treated conservatively with splinting, injections, or activity modification. Recovery depends on the severity of injury, with mild injuries having better prognosis.
1. The study investigated whether an axonal targeting sequence exists in the survival motor neuron (SMN) protein by analyzing a truncated form of SMN (SMN236) containing exons 2, 3 and 6.
2. The results showed that SMN236 co-localized with Gemin3 in axonal granules in neuroblastoma cells, similarly to full-length SMN. Granules containing SMN236 also exhibited bidirectional movement along axons comparable to granules containing full-length SMN.
3. These findings suggest that an axonal targeting sequence is located within exons 2, 3 and/or 6 of SMN. Identifying this sequence could help further characterize SMN's role
Body Burden of Aluminum in Chronic Fatigue Syndrome v2zq
Body Burden of Aluminum in Chronic Fatigue Syndrome - Resources for Healthy Children www.scribd.com/doc/254613619 - For more information, Please see Organic Edible Schoolyards & Gardening with Children www.scribd.com/doc/254613963 - Gardening with Volcanic Rock Dust www.scribd.com/doc/254613846 - Double Food Production from your School Garden with Organic Tech www.scribd.com/doc/254613765 - Free School Gardening Art Posters www.scribd.com/doc/254613694 - Increase Food Production with Companion Planting in your School Garden www.scribd.com/doc/254609890 - Healthy Foods Dramatically Improves Student Academic Success www.scribd.com/doc/254613619 - City Chickens for your Organic School Garden www.scribd.com/doc/254613553 - Huerto Ecológico, Tecnologías Sostenibles, Agricultura Organica www.scribd.com/doc/254613494 - Simple Square Foot Gardening for Schools - Teacher Guide www.scribd.com/doc/254613410 - Free Organic Gardening Publications www.scribd.com/doc/254609890 ~
1) Musculoskeletal pain can cause changes in motor activity and control, including both increases and decreases in muscle activity.
2) Experimental evidence shows that nociception affects motor function through changes in muscle activity, neuronal control mechanisms, proprioception, and local muscle morphology.
3) Various models have been proposed to explain motor responses to pain, including the vicious cycle model and pain adaptation model, but these do not fully capture the complex scenario seen clinically, particularly in chronic pain.
This document summarizes key aspects of acetylcholine (ACh) signaling at the neuromuscular junction. It discusses how ACh is synthesized from choline and acetyl-CoA by the enzyme choline acetyltransferase and degraded by acetylcholinesterase into choline and acetate. It describes the composition of the nicotinic acetylcholine receptor as having alpha, beta, gamma, delta or epsilon subunits. Common disorders that affect ACh signaling like myasthenia gravis and inherited disorders are also mentioned. The document poses review questions about ACh synthesis, degradation, the acetylcholine receptor, and associated disorders.
- Corazonin, AKH, and ACP are present in clusters of cells in the central nervous system of Rhodnius prolixus. AKH is also present in the corpus cardiacum.
- AKH increases lipid levels in the haemolymph, while corazonin increases heartbeat frequency. No effects were observed for ACP.
- The distribution and physiological roles of these neuropeptides in R. prolixus were mapped through immunohistochemistry and assays measuring lipid mobilization and heart contraction frequency.
1) Amyloid precursor protein (APP) is an integral transmembrane protein coded for on chromosome 21 that is overproduced in Alzheimer's disease and Down syndrome.
2) Cleavage of APP by proteases normally produces signaling peptides, but overproduction leads to accumulation of amyloid plaques that can cause neuron death.
3) The plaques are especially problematic in the hippocampus and impair functions like learning and memory.
This document discusses various materials and therapies for peripheral nerve regeneration. It covers guidance therapies using nerve conduits made from natural and synthetic biomaterials. Biomolecular therapies involve delivering growth factors to promote regeneration. Cellular therapies utilize Schwann cells, stem cells, and genetically modified cells. Advanced techniques include nerve conduits fabricated using 3D printing, injection molding and aligned polymer fibers. Future areas of focus are multi-chamber conduits and stem cell therapies to further enhance regeneration.
Scientists have identified a protein called Erk that is necessary for wrapping nerve fibers with myelin, an insulating substance that allows messages to travel from the brain to the body. Erk is important for neurodevelopment and genetic mutations linked to it have been associated with neurodevelopmental disorders. Researchers also discovered that a microRNA called miR-96 regulates hair cell development in the inner ear and is responsible for coordinating hearing; a mutation in miR-96 has been shown to cause deafness in humans. These findings provide insights into neurodevelopmental disorders and hearing loss, and could lead to new therapies.
Este documento presenta una breve biografía de Heracles (Hércules) desde su nacimiento hasta sus principales hazañas. Nace en Tebas como hijo de Zeus y Alcmena, pero Hera, esposa de Zeus, retrasa su nacimiento para que su primo Euristeo nazca primero y herede el trono. Más adelante, Heracles realiza sus famosos Doce Trabajos como castigo por matar a sus hijos en un ataque de locura inducido por Hera. Estos trabajos incluyen matar monstruos, capturar animal
Menu general octubre 2015 - cocinas - sin cerdololosan10
Este documento presenta el menú de octubre de 2015 para personas sin cerdo. Incluye 31 días de menús con dos opciones de plato principal y guarnición para cada comida, así como recomendaciones nutricionales para la cena y procedimientos de seguridad alimentaria para personas con alergias e intolerancias.
Nâng cao Phong độ Quý ông thời nay - Sản phẩm nội địa Nhật chính hãngThuốc bổ Nhật Bản
CAM KẾT CỦA SHOP:
- Chỉ bán hàng Made in Japan 100%. Hình ảnh cung cấp là hình ảnh chụp thực tế với thông tin đúng theo chỉ dẫn của nhà sản xuất.
- Giá luôn ưu đãi nhất
- Dịch vụ chuyên nghiệp, tận tâm, nhiệt tình
This document summarizes a presentation about managing medications effectively. The objectives covered include understanding why medications are prescribed, improving adherence, developing management strategies, and maintaining an up-to-date medication list. Key points discussed include the importance of medication adherence for health outcomes, the high costs associated with non-adherence, and strategies to improve adherence such as pill boxes, reminders, and understanding dosing instructions. The presentation emphasizes consulting pharmacists for any medication questions or concerns.
Research paper on accessibility of HIV and AIDS information by students with special communication needs in Malawi. Case study of Montfort Demonstration and Mary view school of the deaf
Alfredo Najera has over 39 years of experience in broadcasting, entertainment, news, advertising and public relations. He has worked in both radio and television, holding positions such as talent, program director, music director and station manager. Some of his accomplishments include having the number one radio show in 14 U.S. markets and one of the most popular segments on Telemundo television. He is skilled in communications, operations management, client relations and translation between English and Spanish.
Contraception Successes: IUDs and ImplantsSummit Health
Although unintended pregnancy rates in the United States have been static (approximately 51%) for many years, long-acting reversible contraception such as intrauterine devices (IUDs) and contraceptive implants may be reliable alternatives to prevent unwanted pregnancies and further lower unintended pregnancy rates. Join us to learn more about how long-acting reversible contraception may help you!
Novel Formulation of Prostaglandins for Induction of Labour Dinoprostone V...Lifecare Centre
The document discusses a novel formulation of prostaglandins called dinoprostone vaginal pessary for induction of labour. It provides several key advantages over existing prostaglandin formulations like misoprostol and dinoprostone gel. The sustained release pessary allows for precise control of cervical ripening over 24 hours with one application and is easy to administer and remove. Clinical studies show the pessary increases rates of vaginal delivery within 24 hours and reduces need for oxytocin or C-section compared to other induction methods.
Best Clinical Practice Guidelines Ever Produced on Management of EndometriosisLifecare Centre
This document provides guidelines for the management of endometriosis. It addresses key questions regarding symptoms, diagnosis, treatment of pain, and prevention. Some main points covered include:
- Common symptoms associated with endometriosis include dysmenorrhea, pelvic pain, and infertility.
- Laparoscopy with histological examination is the gold standard for diagnosis but can have a delay of 4-10 years.
- Hormonal therapies, analgesics, and surgery are effective treatments for painful symptoms. For surgery, laparoscopy is preferred over laparotomy when possible.
- Secondary prevention with hormonal contraceptives after surgery may help reduce recurrence of disease and pain.
INTRAUTERINE DEATH CME ON INDUCTION OF LABOUR ON 8TH NOVEMBER 2016, Dr sharda...Lifecare Centre
HOW TO DEFINE
IUD or STILL BORN
fetal death after period of viability ( 28 weeks )
24 weeks in USA
24WEEKS OR >500 Gms by WHO
ACOG refers to IUFD as the demise occurring at or later than 20weeks.
D.G.F. CME CASE STUDY DISCUSSIONAbnormal Uterine BleedingLifecare Centre
D.G.F. CME CASE STUDY DISCUSSIONAbnormal Uterine Bleeding
MODERATOR : Dr. Ila Gupta
Dr. Sharda Jain
PANELIST : Dr. Jyoti Agarwal
Dr. Raj Bokaria
Dr. Dipti Nabh
Dr. Vandana Gupta
The document compares the cost of designing a building using different structural systems, including a dual system without beams, building frame system with beams, and other options. It finds that the dual system without beams has the lowest total cost at $80 million, while the most expensive is the moment resisting system with beams at $120 million. Charts and tables show the cost breakdown by structural element and comparisons of total costs for each system.
The document discusses how microbial interactions with the blood-brain barrier (BBB) endothelium can modulate astroglial and neuronal function. It describes the BBB endothelium as part of the neurovascular unit, where homeostasis is maintained through interactions between endothelial, neuronal and glial cells. Dysfunction in any component can affect the others and contribute to neurological disease. The role of BBB endothelial activation in disease is unclear. In vitro BBB models are useful for studying these interactions but may not fully reflect the in vivo environment. Some pathogens like Plasmodium falciparum, which causes cerebral malaria, can induce neurological symptoms without crossing the BBB by activating the endothelium. Release of factors from the activated endothelium towards the brain may then affect
Caspase activation contributes to astrogliosis without inducing apoptosis in astrocytes. The study found that treating cultured neonatal rat astrocytes with dibutryl cAMP or beta-amyloid peptide, stimuli known to induce astrogliosis, led to increased caspase activity and expression of active caspase-3 without cell death. Inhibition of caspases attenuated the increased expression of glutamine synthetase and fibroblast growth factor-2, markers of astrogliosis. The results suggest caspases play a non-apoptotic role in regulating astrogliosis in astrocytes following brain injury.
Aminah Sheikh's research focuses on understanding the neural mechanisms underlying abnormal brain development that result from early brain injuries. Using a neonatal rat model of hypoxia-ischemia, she investigates how these injuries damage subplate neurons in the developing brain and alter the maturation of brain circuits. Her work aims to identify targets for therapies to prevent long-term cognitive impairment resulting from neonatal brain damage.
Research ArticleAging and rejuvenation of human muscle stem .docxdebishakespeare
Research Article
Aging and rejuvenation of human muscle stem cells
Molecular aging and rejuvenation of human
muscle stem cells
Morgan E. Carlson
1
, Charlotte Suetta
2
, Michael J. Conboy
1
, Per Aagaard
3
, Abigail Mackey
2
,
Michael Kjaer
2
, Irina Conboy
1*
Keywords: satellite cell; muscle; aging;
Notch; MAPK/ERK
DOI 10.1002/emmm.200900045
Received February 10, 2009
Revised July 2, 2009
Accepted August 28, 2009
(1) Department of Bioengineering, University of C
Berkeley CA, USA.
(2) Institute of Sports Medicine and Centre of Healt
Health Science, University of Copenhagen, Denmark
(3) Institute of Sports Sciences and Clinical Biomech
Southern Denmark.
*Corresponding author: Tel: þ1 510 666 2792; Fax: þ
E-mail: [email protected]
www.embomolmed.org EMBO
Very little remains known about the regulation of human organ stem cells (in
general, and during the aging process), and most previous data were collected in
short-lived rodents. We examined whether stem cell aging in rodents could be
extrapolated to genetically and environmentally variable humans. Our findings
establish key evolutionarily conserved mechanisms of human stem cell aging. We
find that satellite cells are maintained in aged human skeletal muscle, but fail to
activate in response to muscle attrition, due to diminished activation of Notch
compounded by elevated transforming growth factor beta (TGF-b)/phospho
Smad3 (pSmad3). Furthermore, this work reveals that mitogen-activated protein
kinase (MAPK)/phosphate extracellular signal-regulated kinase (pERK) signalling
declines in human muscle with age, and is important for activating Notch in
human muscle stem cells. This molecular understanding, combined with data
that human satellite cells remain intrinsically young, introduced novel thera-
peutic targets. Indeed, activation of MAPK/Notch restored ‘youthful’ myogenic
responses to satellite cells from 70-year-old humans, rendering them similar to
cells from 20-year-old humans. These findings strongly suggest that aging of
human muscle maintenance and repair can be reversed by ‘youthful’ calibration
of specific molecular pathways.
INTRODUCTION
The rate of metabolism and cumulative oxidative damage to
DNA and proteins, as well as genomic instability and mutations
to mitochondrial DNA, have all been implicated in determining
the intrinsic rate of cell aging and ultimately, species’ life-span
(Cevenini et al, 2008; Vijg & Campisi, 2008). Interestingly,
recent studies have delineated that the aging process in organ
stem cells is largely caused by age-specific changes in the
differentiated niches, and that regenerative outcomes often
depend on the age of the niche, rather than on stem cell age
alifornia, Berkeley,
hy Aging, Faculty of
.
anics, University of
1 510 642 5835;
Mol Med 1, 381–391
(Grounds, 1998). It was further established that, despite the
deteriorated repair of old tissues (such as muscle), old tissue
organ stem cells are capable ...
A Critical Role of Erythropoietin Receptor in Neurogenesis and Post-Stroke Re...johnohab
Erythropoietin (EPO) is the principal growth factor regulating the production of red blood cells. Recent studies demonstrated that
exogenous EPO acts as a neuroprotectant and regulates neurogenesis. Using a genetic approach, we evaluate the roles of endogenous EPO
and its classical receptor (EPOR) in mammalian neurogenesis. We demonstrate severe and identical embryonic neurogenesis defects in
animals null for either the Epo or EpoR gene, suggesting that the classical EPOR is essential for EPO action during embryonic neurogenesis.
Furthermore, by generating conditional EpoR knock-down animals, we demonstrate that brain-specific deletion of EpoR leads to
significantly reduced cell proliferation in the subventricular zone and impaired post-stroke neurogenesis. EpoR conditional knockdown
leads to a specific deficit in post-stroke neurogenesis through impaired migration of neuroblasts to the peri-infarct cortex. Our results
suggest that both EPO and EPOR are essential for early embryonic neural development and that the classical EPOR is important for adult
neurogenesis and for migration of regenerating neurons during post-injury recovery.
Pten Deletion in Adult Neural Stem/Progenitor Cells Enhances Constitutive Neu...johnohab
Here we show that conditional deletion of Pten in a subpopulation of adult neural stem cells in the subependymal zone (SEZ) leads to persistently enhanced neural stem cell self-renewal without sign of exhaustion. These Pten null SEZ-born neural stem cells and progenies can follow the endogenous migration, differentiation, and integration pathways and contribute to constitutive neurogenesis in the olfactory bulb. As a result, Pten deleted animals have increased olfactory bulb mass and enhanced olfactory function. Pten null cells in the olfactory bulb can establish normal connections with peripheral olfactory epithelium and help olfactory bulb recovery from acute damage. Following a focal stroke, Pten null progenitors give rise to greater numbers of neuroblasts that migrate to peri-infarct cortex. However, in contrast to the olfactory bulb, no significant long-term survival and integration can be observed, indicating that additional factors are necessary for long-term survival of newly born neurons after stroke. These data suggest that manipulating PTEN-controlled signaling pathways may be a useful step in facilitating endogenous neural stem/progenitor expansion for the treatment of disorders or lesions in regions associated with constitutive neurogenesis.
Akhtar and Breunig-2015-Frontiers in Cellular Neuroscience - Barriers to post...Aslam Akhtar, MS
This document summarizes barriers to postnatal neurogenesis in the cerebral cortex. It describes how the cortex develops prenatally through tightly regulated neurogenesis along radial glial scaffolds. After birth, radial glia are depleted and the "gliogenic switch" stops neurogenesis in favor of gliogenesis. As a result, the adult cortex has very little ability to replace neurons lost to injury or disease. Strategies to promote postnatal neurogenesis, such as interneuron transplantation and glial reprogramming, aim to circumvent the developmental barriers normally preventing regeneration in the adult brain.
The Neurometabolic Cascade of a ConcussionAmanda McClure
This document discusses concussions in athletes and the physiological effects of concussions. It begins by defining a concussion and outlining common concussion symptoms. It then discusses the neurometabolic cascade that occurs immediately after a concussion, including excess neurotransmitter release and energy crisis in the brain. This can lead to cell death and impairment of neuronal connectivity. The document also discusses the risk of further injury if an athlete returns to play before fully healing from an initial concussion, as well as physiological damage found through MRI studies, such as increased brain activation in concussed athletes during tasks.
This study tested the hypothesis that combining increased intrinsic growth ability through PTEN deletion with reduced extrinsic growth inhibition through Nogo deletion may further improve axonal regeneration after spinal cord injury compared to manipulating either factor alone. The results showed that PTEN/Nogo codeletion enhanced corticospinal tract regeneration more than PTEN deletion alone but did not further increase sprouting compared to PTEN deletion. While regeneration and sprouting increased in PTEN-deleted and PTEN/Nogo-deleted mice, functional recovery was only temporarily improved or not improved, indicating additional strategies are needed to translate enhanced axonal growth into functional benefits.
The document discusses three studies that examined the effects of multimodal early onset stimulation (MEOS) therapy in patients and rats with severe brain injuries. The studies found that MEOS therapy combined with an enriched environment:
1) Led to improvements in vegetative parameters and motor functions in some comatose patients.
2) Resulted in reduced brain lesion volumes and enhanced recovery of motor functions in rats.
3) Provided additional benefits over enriched environment alone, including better reversal of motor and cognitive dysfunction in rats.
The Role Of Cytokines On Immune PrivilegeKaty Allen
- Immune privilege sites like the brain actively suppress inflammation to protect delicate tissues from damage. Cytokines play a role in maintaining this immune privilege.
- Experiments on mice found that chronic early-life stress impaired microglial function and rewired the brain's stress response pathways, causing depression-like behaviors in adulthood. Treating the stress hormone CRH reversed these effects.
- Exposure to toxins in tobacco smoke during development can alter brain cell proliferation, synaptic activity, and microglial function, potentially leading to neurological and cognitive impairments.
This study aims to examine the effects of agomelatine, a melatonergic antidepressant, on behavioral, neuroendocrine, and neurochemical disturbances in socially isolated reared rats. The study leader and collaborators will administer agomelatine or comparator drugs like melatonin or S32006 to socially isolated and control rats and assess outcomes related to monoamine levels, HPA axis regulation, oxidative stress, immune function, and cognition. The study aims to demonstrate the face validity, construct validity, and predictive validity of agomelatine treatment in reversing social isolation induced disturbances based on its proposed mechanism of resynchronizing circadian rhythms and modulating monoamine levels.
This chapter discusses perspectives on employing mesenchymal stem cells from Wharton's jelly of the umbilical cord for peripheral nerve repair. It provides background on regenerative medicine and peripheral nerve injuries. Various biomaterials that have been tested as scaffolds for delivering mesenchymal stem cells in models of rat sciatic nerve injury are described, including chitosan-silicate hybrid, collagen, PLGA90:10, poly(DL-lactide-e-caprolactone), and poly(vinyl alcohol) with conductive materials. The importance of a multidisciplinary approach to tissue engineering the peripheral nerve through development of biomaterials, cell therapies, and preclinical studies is emphasized.
Diffuse axonal injury is a widespread axonal damage that occurs after traumatic brain injury. It involves stretching and shearing of axons that disrupts neuronal transport and homeostasis. This leads to primary axotomy at the time of injury and secondary axotomy over time through injury cascades. Neuroinflammation mediated by microglia also contributes to secondary injury. Biomarkers and advanced neuroimaging techniques can help detect and monitor diffuse axonal injury. While there are no definitive treatments, potential therapies involving calcineurin modulation, stem cells, and other agents are being explored.
This study investigated the effects of lithium on the MEK-ERK signaling pathway in astrocytes and neurons. The key findings were:
1) In astrocytes, lithium decreased MEK and ERK phosphorylation in a time- and dose-dependent manner, inhibiting DNA synthesis and inducing cell cycle arrest.
2) In neurons, lithium enhanced MEK and ERK phosphorylation in a concentration-dependent way.
3) The opposing effects of lithium on the MEK-ERK pathway in astrocytes versus neurons suggest lithium may promote neural repair by inhibiting reactive gliosis while stimulating neurons.
This document discusses how the brain controls body movements and transfers information. It argues that an intact body with sensory feedback is essential for maximal brain control and information transfer. It provides evidence that: 1) Volitional control of neurons drops when proprioceptive feedback is disrupted. 2) Proprioception and other senses are needed for normal movements. 3) Intact sensory feedback is required for learning through experience. 4) Current brain-machine interfaces transfer far less information than an intact brain due to reduced feedback. The body provides crucial feedback that allows the brain to effectively generate movements and learn from the environment.
This document discusses various types of brain damage. It begins by defining brain damage as loss of brain tissue and function. It then lists six main causes of brain damage: brain tumors, strokes, closed head injuries, infections, toxins, and genetic factors. The document focuses on closed head injuries like concussions. While concussions are usually temporary, repeated concussions can lead to long-term damage. The document also discusses different types of closed head injuries like contusions and hematomas. It describes the neurological responses to brain damage, including regeneration, reorganization, degeneration, and recovery of function.
This study investigated early post-hatching sex differences in cell proliferation, survival, and apoptosis in the quail telencephalon. The study found that in males, there were significantly higher numbers of newborn cells in the ventricular zone of the mesopallium at day 1 post-hatching compared to females. Long-term survival until day 20 showed higher numbers of labeled cells in the intermediate medial part of the mesopallium in males compared to females. Additionally, higher numbers of apoptotic cells were found in the intermediate medial part of the mesopallium in males at day 10, suggesting cell death plays a role in controlling regional cell density. The findings indicate sex-specific mechanisms stimulate increased cell genesis, survival
This study examined cell proliferation in the chick forebrain after one-trial passive avoidance learning (PAL) using methylanthranilate (MeA). The following key findings were reported:
1. At 24 hours post-injection of the cell marker BrdU, there was a significant reduction in labeled cells in the dorsal hippocampus and area parahippocampalis of chicks that underwent MeA-based PAL compared to controls.
2. Double-labeling showed a reduction of newborn neuronal cells in the dorsal hippocampus of the PAL group at 24 hours.
3. By 9 days post-injection, there was no difference in hippocampal BrdU labeling between PAL and
Passive avoidance training decreases synapse density in the hippocampus of domestic chicks. The study found that 6 hours after training chicks to avoid pecking at a bead coated in a bitter substance, the density of synapses in the dorsal and ventral hippocampus was lower compared to untrained control chicks. By 24 hours post-training, this difference was no longer present. A hemispheric asymmetry was also observed, with some regions showing enhanced synapse density in the left hemisphere for water-trained chicks but in the right hemisphere for methyl anthranilate-trained chicks. The results suggest that passive avoidance learning and stress can prune synapses in the chick hippocampus.
Netrin signaling through DCC modulates retinotectal synaptic connectivity in Xenopus laevis by influencing axon branching and synapse formation in the developing brain. Live imaging of retinal ganglion cell axons expressing GFP-synaptobrevin and DsRed showed that injecting netrin-1 into the tectum increased presynaptic site addition, branch addition and total branch number over 24 hours. In contrast, injecting DCC blocking antibodies prevented the normal increase in presynaptic sites and branch number. Dynamic analysis revealed the antibodies specifically decreased new synapse and branch additions without affecting stability of existing structures, indicating netrin is required for branching and synaptic differentiation through DCC signaling.
This document summarizes a study that investigated the role of presynaptic and postsynaptic TrkB signaling in the establishment of visual connectivity in Xenopus tadpoles. The researchers disrupted TrkB signaling in individual retinal ganglion cells (RGCs) or tectal neurons by overexpressing a dominant-negative TrkB receptor. They found that disrupting presynaptic TrkB signaling in RGCs decreased axon branching and stability, reduced synaptic maturation, and decreased the number of mature synaptic profiles. In contrast, disrupting postsynaptic TrkB signaling in tectal neurons did not alter synaptic number or dendritic morphology. This demonstrates that presynaptic TrkB signaling in RGCs is necessary for normal development of visual connectivity.
1) Activated microglia secrete factors that promote neurogenesis from white matter cells, whereas resting microglia do not. When neonatal optic nerve cells were cocultured with activated microglia, there was a significant increase in neurons identified by TUJ-1 labeling compared to cocultures with resting microglia.
2) Oligodendrocyte progenitor cells (OPCs) generated some neurons but were not the major source. Around 70% of neurons came from A2B5-negative cells, which included astrocytes. Activated microglia increased neurogenesis from both OPCs and A2B5-negative cells.
3) Mass spectrometry identified protease ser
BDNF stabilizes synapses and maintains the structural complexity of optic axons in vivo. The study used time-lapse imaging to examine how neutralizing endogenous BDNF or blocking NMDA receptors in the optic tectum affects synapse and axon branch stability in Xenopus retinal ganglion cell axons. Neutralizing BDNF enhanced synapse and branch elimination, indicating BDNF stabilizes both. Blocking NMDA receptors transiently eliminated synapses, but BDNF treatment rescued synapses by maintaining addition and rapid stabilization. Thus, BDNF promotes synaptic connectivity by stabilizing synapses and maintaining axon complexity.
This study examines the maturation of synaptic connections in the retinotectal system of Xenopus laevis tadpoles using electron microscopy. The results show that early in development, retinal ganglion cell axons form synapses onto filopodial processes, but later synapses form directly onto dendritic shafts and spines. Treatment with brain-derived neurotrophic factor increases the number of spine synapses and docked vesicles within 24 hours. These structural changes correlate with BDNF's role in functional synaptic maturation.
1. Original Article
Astrocytic Ephrin-B1 Regulates
Synapse Remodeling Following
Traumatic Brain Injury
Angeliki M. Nikolakopoulou1
, Jordan Koeppen1,2
, Michael Garcia1
,
Joshua Leish1
, Andre Obenaus3
, and Iryna M. Ethell1,2
Abstract
Traumatic brain injury (TBI) can result in tissue alterations distant from the site of the initial injury, which can trigger
pathological changes within hippocampal circuits and are thought to contribute to long-term cognitive and neuropsycho-
logical impairments. However, our understanding of secondary injury mechanisms is limited. Astrocytes play an important
role in brain repair after injury and astrocyte-mediated mechanisms that are implicated in synapse development are likely
important in injury-induced synapse remodeling. Our studies suggest a new role of ephrin-B1, which is known to regulate
synapse development in neurons, in astrocyte-mediated synapse remodeling following TBI. Indeed, we observed a transient
upregulation of ephrin-B1 immunoreactivity in hippocampal astrocytes following moderate controlled cortical impact model
of TBI. The upregulation of ephrin-B1 levels in hippocampal astrocytes coincided with a decline in the number of vGlut1-
positive glutamatergic input to CA1 neurons at 3 days post injury even in the absence of hippocampal neuron loss. In
contrast, tamoxifen-induced ablation of ephrin-B1 from adult astrocytes in ephrin-B1loxP/y
ERT2-CreGFAP
mice accelerated the
recovery of vGlut1-positive glutamatergic input to CA1 neurons after TBI. Finally, our studies suggest that astrocytic ephrin-
B1 may play an active role in injury-induced synapse remodeling through the activation of STAT3-mediated signaling in
astrocytes. TBI-induced upregulation of STAT3 phosphorylation within the hippocampus was suppressed by astrocyte-
specific ablation of ephrin-B1 in vivo, whereas the activation of ephrin-B1 in astrocytes triggered an increase in STAT3
phosphorylation in vitro. Thus, regulation of ephrin-B1 signaling in astrocytes may provide new therapeutic opportunities
to aid functional recovery after TBI.
Keywords
astrocytes, hippocampus, ephrinB1, STAT3, synapse, traumatic brain injury
Received August 6, 2015; Received revised December 30, 2015; Accepted for publication December 31, 2015
Introduction
Traumatic brain injury (TBI) occurs as a result of a
closed or penetrating head injury by an external mechan-
ical force, including a blast wave, impact, or penetration
by a bullet (Maas et al., 2008). While advanced diagnostic
and monitoring approaches have lead to a steady increase
in the survival rate following brain injury, TBI triggers
long-term neuropsychological changes and physical dis-
abilities affecting nearly 1.5 million individuals in the
United States each year. Considerable efforts have been
devoted to developing treatments that enhance neuronal
survival following brain injury. However, our under-
standing of the mechanisms that regulate injury-induced
brain rewiring is limited. Brain injury can cause dramatic
changes in brain synaptic connectivity that may promote
functional recovery, but may also lead to cognitive and
neuropsychological impairment (Langlois et al., 2004;
Nortje and Menon, 2004). In addition to neuronal
damage to the neocortex at the time of injury, other
1
Biomedical Sciences Division, School of Medicine, University of California
Riverside, CA, USA
2
Cell, Molecular, and Developmental Biology graduate program, University
of California Riverside, CA, USA
3
Department of Pediatrics, School of Medicine, Loma Linda University, CA,
USA
Corresponding Author:
Iryna M. Ethell, Biomedical Sciences Division, School of Medicine, University
of California, 900 University Avenue, Riverside, CA 92521, USA.
Email: iryna.ethell@ucr.edu
ASN Neuro
January-February 2016: 1–18
! The Author(s) 2016
DOI: 10.1177/1759091416630220
asn.sagepub.com
Creative Commons CC-BY: This article is distributed under the terms of the Creative Commons Attribution 3.0 License
(http://www.creativecommons.org/licenses/by/3.0/) which permits any use, reproduction and distribution of the work without further permission
provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).
by guest on March 3, 2016asn.sagepub.comDownloaded from
2. areas of the brain, such as the hippocampus, are suscep-
tible to long-term anatomical and functional changes.
Alterations in hippocampal circuits may contribute to
memory loss and long-term behavioral changes following
injury (Baldwin et al., 1997; Scheff et al., 2005; Yu and
Morrison, 2010; Atkins, 2011).
Astrocytes can facilitate brain repair after injury by
protecting neurons from glutamate excitotoxicity and
regulating the blood-brain barrier; however, the role of
astrocytes in rewiring neuronal networks is not well
understood (Ito et al., 2006; Myer et al., 2006; Brown
and Murphy, 2008; Benowitz and Carmichael, 2010;
Mostany et al., 2010; Shields et al., 2011). Astrocytes
undergo substantial changes in response to brain and
spinal cord injury (Sofroniew, 2009), including cell hyper-
trophy (Wilhelmsson et al., 2006), enhanced proliferation
and scar formation, increased expression of glial-fibrillary
acidic protein (GFAP), and reexpression of the progeni-
tor markers vimentin and nestin (Eddleston and Mucke,
1993; Pekny and Nilsson, 2005; Sofroniew, 2005).
Although it is elusive whether these changes are beneficial
or detrimental for brain recovery, STAT3 signaling has
been implicated in reactive astrogliosis and astrocyte-
specific STAT3 KO mice exhibited attenuated upregula-
tion of GFAP, failure to exhibit astrocytic hypertrophy,
and disruption of astroglial scar formation after spinal
cord injury (Herrmann et al., 2008; O’Callaghan et al.,
2014). STAT3 is also known to regulate astrocytic differ-
entiation (Bonni et al., 1997), the formation of perineur-
onal astrocytic processes, and the expression of
synaptogenic molecule TSP-1 (Tyzack et al., 2014).
EphB receptor tyrosine kinases and their ligands,
ephrin-Bs, play an important role in neuronal connectivity
and synaptogenesis (Ethell and Pasquale, 2005). More pre-
cisely, ephrin-B/EphB signaling pathways participate in
cell–cell interaction and regulate a plethora of biological
processes during development and in adulthood, such as
axon guidance (Zimmer et al., 2003), synaptogenesis
(Moeller et al., 2006; Segura et al., 2007), dendritic spine
formation (Henkemeyer et al., 2003), and neurogenesis
(Conover et al., 2000; Catchpole and Henkemeyer,
2011). Recent studies have linked several Ephs and ephrins
to neurodevelopmental disorders, neurodegenerative dis-
eases, and central nervous system injuries (Cisse et al.,
2011; Georgakopoulos et al., 2011; Sanders et al., 2012;
Coulthard et al., 2012; Overman et al., 2012; Van Hoecke
et al., 2012; Ren et al., 2013; Barthet et al., 2013), but the
mechanisms of ephrin-B/EphB signaling in neurologic dis-
eases remain largely unexplored. Both ephrins and EphB
receptors are shown to be upregulated in reactive astro-
cytes following injury (Sofroniew, 2009). An increase in
ephrin-B1 expression has been reported in reactive astro-
cytes in the hippocampus after transection of entorhinal
afferents (Wang et al., 2005). Similarly, ephrin-B2 and Eph
receptor levels increase in astrocytes after spinal cord
injury (Goldshmit et al., 2006) and the ablation of astro-
cytic ephrin-B2 leads to increased motor axon regener-
ation (Chen et al., 2013). Ephrin-B2 expression is also
upregulated in microglia and astrocytes at the head of
the optic nerve in glaucomatous DBA/2 J mice coinciding
with the loss of retina ganglia cell axons (Du et al., 2007).
The upregulation of ephrins in astrocytes most likely
affects the Eph receptor activity in neurons. Indeed,
increased EphB3 has been reported in regenerating axons
after optic nerve injury and EphB3 loss impeded axonal
regeneration (Liu et al., 2006). In stroke, ephrin-A5 upre-
gulation in reactive astrocytes is associated with a signifi-
cant increase in the phosphorylation of EphA receptors in
peri-infarct tissue (Overman et al., 2012) and EphB1 levels
are increased during axonal sprouting following stroke (Li
and Carmichael, 2006). Although ephrin-A/EphA recep-
tor interactions are implicated in astrocyte regulation of
synaptic maintenance and remodeling after injury (Murai
et al., 2003; Carmona et al., 2009; Filosa et al., 2009; Murai
and Pasquale, 2011), the functional significance of astro-
cytic ephrin-B1 signaling in the regeneration of brain cir-
cuits after injury has not been investigated.
Here we report a transient upregulation of ephrin-B1
in the adult hippocampal astrocytes, but not microglia,
following moderate TBI using a controlled cortical
impact (CCI) model, concomitant with reactive
astrogliosis. The upregulation of ephrin-B1 levels in
reactive astrocytes in stratum radiatum (SR) area of
CA1 hippocampus coincides with a decline in the
number of vGlut1-positive glutamatergic input to CA1
neurons at 3 days post injury (dpi), followed by a signifi-
cant downregulation of astrocytic ephrin-B1 at 7 dpi.
Furthermore, targeted ablation of ephrin-B1 from adult
astrocytes accelerates the recovery of vGlut1-positive glu-
tamatergic input to CA1 neurons after TBI, suggesting
that astrocytic ephrin-B1 may play an active role in
injury-induced synapse remodeling. Finally, our studies
suggest that astrocytic ephrin-B1 may act through the
activation of STAT3-mediated signaling in astrocytes as
the activation of ephrin-B1 in cultured astrocytes induces
phosphorylation of STAT3, whereas astrocyte-specific
deletion of ephrin-B1 suppresses STAT3 activation in
the hippocampus following TBI in vivo.
Materials and Methods
Mice and Tamoxifen Injections
GFAP-ERT2Cre/þ
(Jax#012849) male mice were crossed
with ephrinB1loxP/þ
female mice (exons 2 through 5 of
efnb1 gene are floxed by loxP sites, Jax#007664) to
obtain GFAP-ERT2Cre/þ
ephrinB1loxP/y
(KO) or GFAP-
ERT2Cre/þ
(WT) male mice. WT and KO littermates male
mice older than 8 weeks received tamoxifen intraperitone-
ally (1 mg; dissolved at 5 mg/ml in 1:9 ethanol/sunflower
2 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
3. oil mixture) once a day for 7 consecutive days. Animals
received surgery (see later) 1 to 2 weeks after the first tam-
oxifen injections as we observed a significant downregula-
tion of ephrin-B1 expression in hippocampal
astrocytes, but not neurons, of tamoxifen-injected GFAP-
ERT2Cre/þ
ephrinB1loxP/y
during this period. We did not
detect any changes in ephrin-B1 levels in astrocytes or neu-
rons in GFAP-ERT2Cre/þ
ephrinB1loxP/y
noninjected or
injected with sunflower oil without tamoxifen. Cre and
ephrin-B1 immunoreactivities were analyzed in GFAP-
ERT2Cre/þ
ephrinB1loxP/y
(KO) and GFAP-ERT2Cre/þ
(WT) mice. GFAP-ERT2Cre/þ
ephrinB1loxP/y
animals
showed a detectable Cre immunoreactivity and at least
twofold reduction of ephrin-B1 immunoreactivity in astro-
cytes following tamoxifen injection. For expression of YFP
in GFAPþ cells, Rosa-STOPloxPYFP animals were also
crossed with GFAP-ERT2Cre/þ
ephrinB1loxP/y
or GFAP-
ERT2Cre/þ
mice. All genotypes were confirmed by poly-
merase chain reaction (PCR) analysis of genomic DNA
isolated from mouse tails. Mice were maintained in an
AAALAC accredited facility under 12-h light/dark cycles
and fed standard mouse chow. All mouse studies were done
according to NIH and Institutional Animal Care and Use
Committee guidelines.
Surgery
Two-month-old C57BL/6 wild-type, GFAP-ERT2Cre/þ
ephrinB1loxP/y
(KO) or GFAP-ERT2Cre/þ
(WT) male
mice received a unilateral CCI after a 4-mm craniotomy
over the right parietal cortex (impactor center at Bregma:
anterior-posterior, À1.50mm, medial lateral 1.50mm)
using a stereotaxically positioned 3 mm diameter stainless
steel tipped piston (Figure 1(d)). CCI (3mm diameter tip,
1 mm depth, 6.0 m/s speed, 250 ms dwell) was then delivered
to the cortical surface using an electromagnetically driven
piston, resulting in cortical compression and some loss
of cortical tissue. Moderate TBI in C57Bl6 mice results in
a lesion volume of 2.51Æ 0.52% and 2.40Æ 0.46%
(mean Æ SEM; % of brain volume) at 3 and 7 days post
injury (dpi), respectively, showing no hippocampal damage.
Involvement of the hippocampus irrespective of the depth
was considered severe TBI. Mice recovered quickly after
TBI and demonstrated full activity within few hours after
surgery, Sham mice received craniotomy without TBI. Mice
with moderate CCI were analyzed in these studies. Animals
were sacrificed at 1, 3, and 7 days post TBI or craniotomy.
Untreated animals were sacrificed at similar timepoints as
TBI animals for comparison.
Immunohistochemistry
Animals were anesthetized with isoflurane and transcar-
dially perfused first with 0.9% NaCl followed by with 4%
paraformaldehyde in 0.1 M phosphate-buffered saline
(PBS), pH ¼ 7.4. Brains were postfixed overnight in
4% paraformaldehyde/0.1 M PBS and 100 -mm coronal
brain sections were cut with a vibratome. We observed
no neuronal loss or apoptotic nuclear morphology in the
hippocampus of these animals at 1, 3, or 7 dpi by assessing
nuclear morphology with 4’6-diamidino-2-phenylindole
(DAPI) staining. To determine ephrin-B1 immunoreactiv-
ity in the hippocampus, double immunostaining was per-
formed using goat antibodies against ephrin-B1 (1:50, BD
Pharmingen). The specificity of the ephrin-B1 immunor-
eactivity in astrocytes was confirmed by the depletion of
anti-ephrin-B1 antibody against ephrin-B1-Fc coupled to
protein-A agarose (not shown). Astrocytes were labeled
with conjugated Cy3-anti-GFAP (1:500, Sigma) and
microglia with rabbit anti-Iba1 (1:1,000, Wako) antibo-
dies to identify changes in glial phenotype. Cre expression
was analyzed with mouse anti-Cre antibody (1:100, EMD
Millipore). Presynaptic boutons were labeled by immu-
nostaining for the excitatory synapse marker vesicular glu-
tamate transporter 1 (vGLUT1) using rabbit anti-
vGLUT1 (1mg/4ml; 482400; Invitrogen). Secondary anti-
bodies used were Alexa Fluor 594-conjugated donkey
anti-mouse IgG (4 mg/ml; Molecular Probes), Alexa
Fluor 647-conjugated donkey anti-rabbit IgG (4 mg/ml;
Molecular Probes), or Alexa Fluor 488-conjugated
donkey anti-goat IgG (4 mg/ml; Molecular Probes).
Sections were mounted on slides with Vectashield mount-
ing medium containing DAPI (Vector Laboratories Inc.).
Imaging
Confocal images from the ipsilateral and contralateral
hemispheres were captured with a Leica SP2 confocal
laser-scanning microscope using a series of high-resolu-
tion optical sections (1,024 Â 1,024-pixel format) that
were captured with a 20Â (immunohistochemistry) or
63Â (synaptogenesis) water-immersion objective (1.2
numerical aperture), 1 Â zoom at 1 -mm step intervals
(z-stack of 11 optical sections). All images were acquired
under identical conditions. Each z-stack was collapsed
into a single image by projection, converted to a tiff file,
encoded for blind analysis, and analyzed using Image J
Software. Three adjacent projections from SR were ana-
lyzed per brain slice from at least three animals/group.
Cell area, integrated fluorescent intensity, and cell per-
imeter were determined for each GFAP-positive and
ephrinB1-positive cells (100–300 astrocytes, 5–11
images, 3–4 mice per group). For the analysis of
vGlut1 immunolabeling, at least six sequential images
were captured for selected area at 1-mm step intervals,
each image in the series was threshold-adjusted to
identical levels and the puncta were measured using
ImageJ. Three adjacent areas from SR were imaged
and analyzed per brain slice from at least three ani-
mals/group.
Nikolakopoulou et al. 3
by guest on March 3, 2016asn.sagepub.comDownloaded from
4. Cell Culture
Astrocytes were isolated from WT or ephrinB1loxP
mouse
hippocampi at P0-P1 as previously described (Barker
et al., 2008). Briefly, hippocampi were treated with
0.1%trypsin/ethylenediaminetetraacetic acid (EDTA)
solution for 25 min at 37
C and mechanically dissociated.
Cells were plated on cell culture flasks and cultured in
DMEM containing 10% fetal bovine serum (FBS) and
1% pen-strep, under 10% CO2 atmosphere at 37
C. To
achieve purified astrocyte cultures (95% astrocytes)
cells were shaken after 4 days in vitro (DIV) for 1 h.
After shaking, the media were removed and cells were
washed twice with 0.1 M PBS (pH 7.4). Cells were then
treated with 0.1% trypsin/EDTA solution for 20 min at
37
C and plated on 10-cm Petri dishes with DMEM
containing 10% FBS. Once confluent astrocytes were
trypsinized and plated on six-well plates at a density of
1.2 Â 106
per plate and cultured for 2 days before being
transfected with pEGFP, pEGFP and pcDNA-ephrinB1,
or pEGFP and pcDNA-Cre plasmids using
Lipofectamine according to the manufacturer’s instruc-
tions (Invitrogen, 11668-019). Astrocytes were treated
with preclustered EphB2-Fc to activate ephrin-B1 or con-
trol Fc and processed for Western blot as described later.
Ephrin-B1 Induction In Vitro
Preclustered EphB2-Fc or Fc were generated by incubating
EphB2-Fc (RD Systems) or Fc (RD Systems) with goat
anti-human IgG (Jackson ImmunoResearch) for 1 h at 4
C.
Transfected astrocytes were stimulated with 2.5mg/ml
EphB2-Fc or 2.5ug/ml Fc for 15min. Cells were then
lysed with lysis buffer: (in mM) 25 Tris-HCl, 150 mM
NaCl, 5 EDTA, 1% Triton-X, 1 sodium pervanadate,
and protease inhibitor mixture (1:100, Sigma, P8340).
Western Blotting
The hippocampi were removed from each mouse (n ¼ 4
mice per group), frozen, and stored at À80
C. Brain
tissues were homogenized in cold lysis buffer: 50 mM
Tris-HCl (pH ¼ 7.4), 150 mM NaCl, 1 mM EDTA
(pH ¼ 8.0), 1% Triton X-100, 0.1% sodium dodecyl sul-
fate (SDS) containing protease inhibitor cocktail (1:100,
Sigma, P8340), and 0.5 mM sodium pervanadate. The
Figure 1. Reactive astrogliosis is observed in the hippocampus at 3 and 7 days following moderate CCI. Fluorescent images show GFAP
immunoreactivity (a) and DAPI labeling (b) in coronal brain sections of control mice at 1, 3, or 7 dpi. The location of the impact area is
indicated by a white bar. Note that reactive astrogliosis was observed in the ipsilateral cortex and hippocampus after moderate CCI, which
leads to neuronal loss near cortical impact but not in the hippocampus. (c) 3D brain reconstruction shows the size and location of the
impact. SR, stratum radiatum area of CA1 hippocampus; hp, hippocampus; CA1, CA1 layer; CA3, CA3 layer. (d) TBI location and size.
4 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
5. samples were rotated at 4
C for at least 1 hr to allow for
complete cell lysis and then cleared by centrifugation at
10,000 Â g for 15 min at 4
C. Hippocampal and cell lys-
ates were boiled in reducing sample buffer (Laemmli 2Â
concentrate, Sigma, S3401), and proteins separated on
8% to 16% Tris-glycine SDS-PAGE precast gels (Life
Technologies, EC6045BOX). Proteins were transferred
onto Protran BA 85 Nitrocellulose membrane (GE
Healthcare) and blocked for 1 hr at room temperature
in 5% skim milk (BioRad, #170-6404). Primary antibody
incubations were done overnight at 4
C with antibodies
diluted in tris-buffered saline (TBS)/0.1% Tween-20/5%
bovine serum albumin (BSA). Primary antibodies used
were anti-STAT3 (1:2,000; Cell Signaling; 4904S) and
anti-p-STAT3 (1:2,000; Cell Signaling; 9145P). Blots
were washed 3 Â 10 min with TBS/0.1% tween-20 and
incubated with the appropriate horseradish peroxidase
(HRP)-conjugated secondary antibodies for an hour at
room temperature in a TBS/0.1% tween-20/5% BSA
solution. The secondary antibodies used were a-rabbit-
HRP at 1:5,000 and a-mouse-HRP at 1:5,000 (GE
Healthcare). After secondary antibody incubations,
blots were washed 3 Â 10 min in TBS/0.1% tween-20
and developed with ECL Detection reagent (Thermo
Scientific, #80196). For reprobing, membrane blots were
washed in stripping buffer (2% SDS, 100 mM b-mercap-
toethanol, 50 mM Tris-HCl, pH ¼ 6.8) for 30 min at
56
C, then rinsed repeatedly with TBS/0.1% tween-20,
finally blocked with 5% skim milk, and then reprobed.
Developed films were then scanned and protein levels
quantified by comparing band density values obtained
using ImageJ. Two samples per group were run per blot
and pSTAT3/STAT3 ratio was calculated for EphB2-Fc-
treated samples and normalized to pSTAT3/STAT3 ratio
of Fc-treated samples. Statistical analysis was performed
using two-way analysis of variance (ANOVA) followed
by post hoc pair-by-pair comparisons with Fisher’s Least
Significant Difference (LSD) method.
Quantitative Real-Time PCR
RNA was isolated from mouse hippocampi using Trizol
reagent (Invitrogen), precipitated in isopropanol, and
RNA concentration (ng/ml) was identified from the
absorbance at 260 and 280 nm, detected by NanoDrop
ND-1000 spectrophotometer (NanoDrop Technologies).
cDNA was transcribed using the Reverse Transcription
System (Promega) according to manufacturer’s instruc-
tions. To examine mRNA expression of ephrinB1 (F:
ACCCTAAGTTCCTAAGTGGGA, R: CTTGTAGTA
CTCGTAGGGC), EphB2 (F: TACATCCCCCA
TCAGGGTGG, R: GCCGGATGAATTTGGTCCGC,
GFAP (F: GCCACCAGTAACATGCAAGA, R:
GCTCTAGGGACTCGTTCGTG), and vimentin (F:
ATGCTTCTCTGGCACGTCTT, R: AGCCACGC
TTTCATACTGCT), specific forward and reverse pri-
mers were used. Real-time PCR was carried out on an
iCycler (Bio-Rad laboratories). Each reaction mixture
contained 1 Â Power SYBR Green PCR Master Mix
(Life Technologies), and all the reactions were run in
triplicate. The PCR amplification protocol was as fol-
lows: initial DNA Polymerase activation at 95
C for
10 min, followed by 40 cycles with denaturation at 95
C
for 15 s, and annealing þ extension at 60
C for 1 min.
Amplification was performed in a StepOne Real Time
PCR System (96-well format) (Life Technologies) and
analyzed by normalizing the expression of each gene to
GAPDH within each tissue sample.
Statistical Analysis
Both for in vivo and in vitro studies, the groups were
compared using one-way or two-way ANOVA with
Tukey’s or Bonferroni post hoc analysis, respectively,
or paired Student’s t-test, and p values .05 were taken
as statistically significant.
Results
The aim of this study was to determine whether ephrin-
B1 levels are regulated in hippocampal astrocytes follow-
ing moderate CCI and to investigate the role of astrocytic
ephrin-B1 in synapse recovery after CCI in vivo using
conditional ephrin-B1 KO mice.
Moderate CCI Triggers a Transient Upregulation of
Ephrin-B1 Immunoreactivity in Reactive Astrocytes
in the Hippocampus
To induce TBI, mice received moderate unilateral
CCI after craniotomy over the right parietal cortex
(Figures 1(a) to (d)). As anticipated, we observed an
increase in GFAP-immunoreactivity suggesting reactive
astrogliosis at the site of injury (Figure 1(a)). Although
we observed no neuronal loss or apoptotic nuclear
morphology in the hippocampus of these animals at 1,
3, or 7 dpi by assessing nuclear morphology with DAPI
staining (not shown), an increase in GFAP immunoreac-
tivity was noted in the ipsilateral hippocampus at 3 dpi,
with a significant upregulation of GFAP immunoreactiv-
ity at 7 dpi (Figures 1(a) and 2(c) and (e)). To examine
whether ephrin-B1 levels were also upregulated in the
reactive astrocytes after TBI, we performed immunos-
taining against ephrin-B1 and analysis of GFAP and
ephrin-B1 immunoreactivity per area of astrocyte
(Figure 2(a) to (f)). Our results show a significant increase
of ephrin-B1 immunoreactivity in astrocytes at 3 dpi in
the SR area of CA1 hippocampus as compared with con-
trols (p .05; Figure 2(f)) but not in cortical astrocytes
around the impact area (not shown). Surprisingly, at
Nikolakopoulou et al. 5
by guest on March 3, 2016asn.sagepub.comDownloaded from
6. 7 dpi, ephrin-B1 immunoreactivity in hippocampal astro-
cytes had subsided to control levels and was significantly
lower than at 3 dpi (p .01; Figure 2(f)). Interestingly,
although ephrin-B1 immunoreactivity was reduced in
astrocytes at 7 dpi, astrocytes remained reactive and
showed higher GFAP immunoreactivity as compared
with control astrocytes (p .01; Figure 2(e)). Ephrin-B1
immunoreactivity was also slightly upregulated in CA1
neurons, but we could not detect ephrin-B1 immunoreac-
tivity in microglial cells (blue, Figure 2(a)). To further
Figure 2. Ephrin-B1 immunoreactivity was significantly upregulated in reactive astrocytes in the hippocampus following moderate CCI.
(a–d) Fluorescent images show GFAP-positive astrocytes (GFAP, red in a and d, gray in c), Iba1-positive microglia (Iba1, blue in a), and
ephrin-B1 immunoreactivity (ephrin-B1, green in a, gray in b) in the SR area of the CA1 hippocampus in control, 1, 3, and 7 dpi. (d) High
magnification images show examples of ephrin-B1-positive astrocytes. Note that ephrin-B1-positive immunoreactivity is found in the
dendrites of CA1 neurons and astrocytes in SR area of CA1 hippocampus. (e–g) Graphs show GFAP immunoreactivity per GFAP-positive
astrocyte (e) or ephrin-B1 immunoreactivity per ephrin-B1-positive astrocyte (f) in control (n ¼ 682 cells, 9 images, 3 mice), 1 dpi (n ¼ 385
cells, 5 images, 3 mice), 3 dpi (n ¼ 732 cells, 11 images, 4 mice), and 7 dpi (n ¼ 1217 cells, 9 images, 3 mice) or post-sham (n ¼ 300–500 cells,
4–6 images, 3 mice). Note that ephrin-B1 immunoreactivity was not detected in all GFAP-positive cells. Error bars indicate SEM. Statistical
analysis was performed using one-way ANOVA followed by Tukey’s post hoc analysis (e,f, n ¼ 3–4 mice, *p .05, **p .01) or two-way
ANOVA, followed by Bonferroni post hoc analysis (g, n ¼ 3–4 mice, *p .05).
6 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
7. verify that the changes described earlier are induced as a
consequence of the brain injury, we compared TBI ani-
mals to animals that had received craniotomy without the
impact (sham). Our data clearly show that craniotomy
alone does not promote upregulation of ephrin-B1 immu-
noreactivity at any timepoint (Figure 2(g)). In contrast,
ephrin-B1 immunoreactivity was significantly higher in
hippocampal astrocytes at 3 dpi as compared with 3
days sham animals (p .01; Figure 1(g)). In addition to
immunohistological studies, we examined gene expression
levels of ephrin-B1 and its receptor EphB2 in control and
TBI animals. Our results show an upregulation of both
ephrin-B1 and EphB2 expression in the hippocampus
after TBI compared with control animals (Figure 3).
The changes in the levels of ephrin-B1 and EphB2 recep-
tor may affect transynaptic ephrin-B/EphB signaling and
synaptic rewiring following TBI.
Ephrin-B1 Upregulation in Hippocampal Astrocytes
Coincides With a Decline in vGlut1-Positive
Glutamatergic Innervation of CA1
Hippocampal Neurons
Although we observed reactive astogliosis, there was no
significant neuronal loss noted in the hippocampus fol-
lowing CCI. Previously published results demonstrate
that while most neurons are spared following moderate
or mild CCI, the hippocampus undergoes substantial
changes in synaptic organization (Scheff et al., 2005;
Norris and Scheff, 2009; Gao et al., 2011). Therefore,
we examined the changes in presynaptic Schaffer
collateral input from CA3 to CA1 hippocampal neurons
within the SR area of CA1 hippocampus following TBI
by immunostaining against the excitatory presynaptic
marker vGlut1 (Figure 4(a) to (d)). Our results show
Figure 3. Moderate CCI causes an upregulation in gene expression of ephrinB1 and its receptor, EphB2 in the hippocampus. qPCR data from
the hippocampi of control and TBI animals show that TBI causes an increase in ephrinB1 at all timepoints postinjury in the ipsilateral hemisphere;
however, in the contralateral hemisphere, this increase is noticeable at 3 dpi. Similarly, we observe a concomitant increase in EphB2 levels at 1, 3,
and 7 dpi both in the ipsi- and contralateral hemispheres. Graphs show meanÆ SEM (n ¼ 3, two-way ANOVA, *p .05, **p .01).
Nikolakopoulou et al. 7
by guest on March 3, 2016asn.sagepub.comDownloaded from
8. that at 3 dpi, when ephrin-B1 is significantly upregu-
lated, the number of vGlut1-positive presynaptic bou-
tons was significantly decreased in SR area of CA1
hippocampus (p .05; Figure 4(e)). Furthermore, there
was no further decline in the density of presynaptic
boutons in the SR at 7 dpi, when ephrin-B1 levels
were similar to controls (Figure 4(e)). Our results also
show that there is a negative correlation between the
levels of ephrin-B1 in astrocytes and the number of
excitatory glutamatergic presynaptic input to CA1 neu-
rons in SR at 3 dpi (Figure 4(f)), suggesting that astro-
cytic ephrin-B1 may play a role in synapse removal
following TBI.
Targeted Ablation of Ephrin-B1 From Astrocytes
Promotes Fast Recovery of vGlut1-Positive
Glutamatergic Innervation of CA1
Hippocampal Neurons Following CCI
To further establish a causal link between the upregu-
lation in the levels of astrocytic ephrin-B1 and synapse
reorganization after TBI, we developed a mouse model
where ephrin-B1 was specifically ablated from adult
astrocytes. A significant reduction in ephrin-B1 immu-
noreactivity was detected by immunostaining in GFAP-
positive astrocytes of ephrinB1loxP/y
GFAP-ERT2Cre/þ
(KO) but not GFAP-ERT2Cre/þ
(WT) mice treated
with tamoxifen (Figure 5). The reduction in ephrin-B1
levels was also confirmed in adult astrocytes in Rosa-
STOPloxP
YFP/ephrin-B1Flox/y
ERT2-CreGFAP
mice but
not Rosa-STOPloxP
YFP/ERT2-CreGFAP
mice following
tamoxifen treatment (p .001; Figure 6). Ephrin-B1
was still detected in the cell bodies and dendrites of
CA1 neurons but not in YFP-positive astrocytes in
SR area of CA1 hippocampus (Figure 6(a)). We
found that astrocyte-specific deletion of ephrin-B1 trig-
gered about three- to fivefold decrease in ephrin-B1
immunoreactivity in GFAP-positive astrocytes (Figures
5(b) and 6(c)).
Next, we examined whether the deletion of ephrin-B1
from astrocytes can prevent the loss of excitatory pre-
synaptic innervation of CA1 neurons following TBI.
TBI was performed 7 to 14 days after the first tamoxifen
injection, at which point we see a selective ablation of
ephrin-B1 from astrocytes (Figure 5(a)). Astrocytic
ephrin-B1 levels were significantly reduced in SR area
of CA1 hippocampus of ephrin-B1 KO as compared
with WT mice at 1 dpi (p .01), 3 dpi (p .05), and
7 dpi (p .01; Figure 5(a) and (b)). Although both WT
and ephrin-B1 KO mice showed a significant loss of
vGlut1-positive presynaptic innervation of CA1 neurons
at 3 dpi as compared with control animals (p .01), a
significant recovery of vGlut1-positive presynaptic sites
was observed in ephrin-B1 KO but not WT mice
(Figure 5(c)). At 7 dpi, the number of vGlut1-positive
presynaptic sites reached control levels in ephrin-B1 KO
mice (p .05), whereas the number of vGlut1-positive
presynaptic sites remained low in WT mice (p .001;
Figure 5(c)). A higher number of vGlut1-positive pre-
synaptic boutons was also seen at 3 dpi in ephrin-B1
KO mice as compared with WT mice (p .05;
Figure 5(c)). This difference was most likely a result of
an overall increase in the number of vGlut1-positive pre-
synaptic sites in ephrin-B1 KO mice as compared with
WT mice prior to TBI (p .01). Our results show that
while a selective ablation of ephrin-B1 from astrocytes
did not prevent the initial loss of vGlut1-positive pre-
synaptic innervation of CA1 neurons in SR following
CCI, it accelerated recovery of vGlut1-positive excitatory
input to CA1 neurons at 7 dpi, suggesting negative effects
of astrocytic ephrin-B1 on new synapse formation in CA1
hippocampus following TBI.
Ephrin-B1 Regulates STAT3 Phosphorylation
in Astrocytes Following TBI
STAT3 signaling plays an important role in reactive
astrocytosis and may regulate protein expression in astro-
cytes following injury (Herrmann et al., 2008). Similar to
previous work, our studies demonstrate an increase in the
levels of phosphorylated STAT3 (pSTAT3) following
brain injury (Figure 7(a)). Interestingly, the changes in
pSTAT3 levels also coincided with increased ephrin-B1
immunoreactivity levels in astrocytes, showing increased
pSTAT3 at 1 and 3 dpi as compared with control (p .01
and p .001), followed by its downregulation at 7 dpi
(p .01; Figure 7(d)). To establish a causal link between
an upregulation in the levels of astrocytic ephrin-B1 and
an increase in STAT3 phosphorylation, we examined the
effects of ephrin-B1 activation in astrocytes on STAT3
phosphorylation in vitro. Our results show higher
STAT3 phosphorylation (pSTAT3) in cultured astrocytes
following ephrin-B activation with preclustered EphB2-
Fc (p .05; Figure 7(b) and (e)). We see a greater increase
in pSTAT3 in astrocytes overexpressing ephrin-B1, sug-
gesting that injury-induced increases in STAT3 phos-
phorylation may be mediated through the activation of
ephrin-B1. Indeed, astrocyte-specific deletion of ephrin-
B1 affected STAT3 phosphorylation following TBI. Our
data show significantly lower levels of pSTAT3 in the
ipsilateral hippocampus of ephrinB1-KO mice at 3 dpi
when compared with WT animals (p .05; Figure 7(c)
and (f)). These studies suggest that ephrin-B1-dependent
activation of STAT3 in astrocytes may contribute to
astrocyte-mediated synapse remodeling following TBI.
8 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
9. Figure 4. Moderate CCI triggers a significant downregulation of vGlut1-positive glutamatergic innervation of CA1 hippocampal neurons.
We have analyzed vGlut1-positive puncta in SR area of the CA1 hippocampus, which immunolabels terminals of CA3 neurons innervating
dendrites of CA1 neurons. (a–d) Fluorescent images show a reduced vGlut1-positive puncta in SR at 3 (c) and 7 dpi (d) as compared with
control (a), suggesting a reduction in excitatory innervation of CA1 neurons following TBI. (e) Graph shows vGlut1-positive puncta per
100 mm2
area (mean Æ SEM; n ¼ 3–4 mice, one-way ANOVA followed by Tukey’s post hoc analysis, *p .05). (f) Graph shows a negative
correlation between the mean levels of ephrin-B1 per ephrin-B1-positive astrocyte (x axis, n ¼ 100–300 astrocytes per animal) and the
average number of vGlut1-positive puncta per 100 mm2
area (y axis, n ¼ 50–100 images per animal) in SR area of CA1 hippocampus of four
mice at 3 dpi. SR ¼ stratum radiatum.
Nikolakopoulou et al. 9
by guest on March 3, 2016asn.sagepub.comDownloaded from
10. Discussion
The main findings of this study are as follows: (a)
there is an increase in ephrin-B1 immunoreactivity in
hippocampal astrocytes during synapse remodeling fol-
lowing moderate CCI in the absence of hippocampal
neuron loss (middle panel, Figure 8), (b) specific deletion
of ephrin-B1 from adult astrocytes accelerates the
Figure 5. Astrocyte-specific deletion of ephrin-B1 triggers accelerated recovery of vGlut1-positive excitatory presynaptic sites in SR area
of CA1 hippocampus at 7 dpi. (a) Confocal images show increased ephrin-B1 immunoreactivity (green) in WT (left panel), but not ephrin-
B1 KO astrocytes (right panel) in the SR at 3 dpi. Note that the remaining ephrin-B1-positive immunoreactivity (green) in ephrin-B1 KO
(right panel) represent ephrin-B1 expression in dendrites of CA1 neurons. (b, c) Graphs show integrated intensity of ephrin-B1 immu-
noreactivity per GFAP-positive astrocyte (b) and vGlut1-positive puncta per 100 mm2
area (mean Æ SEM; n ¼ 3–4 mice, two-way ANOVA,
followed by Bonferroni post hoc analysis *p .05, **p .01, ***p .001).
10 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
11. recovery of vGlut1-positive excitatory innervation of
CA1 hippocampal neurons following injury (right
panel, Figure 8), and (c) ephrin-B1 regulates STAT3
phosphorylation in hippocampal astrocytes and astro-
cyte-specific deletion of ephrin-B1 suppresses STAT3
activation in the hippocampus following CCI. Our results
suggest the involvement of ephrin-B1 signaling in astro-
cyte-mediated remodeling of excitatory synapses
following injury, which can be accomplished through
ephrin-B1-mediated regulation of STAT3 signaling in
astrocytes.
The CCI model of TBI is a well-established model that
has been extensively used by many research groups
to study both neuronal degeneration and plasticity fol-
lowing brain injury (Albensi et al., 2000; Immonen et al.,
2009; Villapol et al., 2014). Numerous studies have
Figure 6. Specific ablation of ephrin-B1 from adult hippocampal astrocytes but not CA1 neurons in vivo. (a, b) Confocal images show YFP
(green), GFAP (red), and ephrin-B1 (blue) in the SR area of CA1 hippocampus of ephrin-B1Flox/y
GFAP-ERT2Cre/þ
STOPFlox
YFP (KO, A) and
control GFAP-ERT2Cre/þ
STOPFlox
YFP (WT, B) mice. GFAP and ephrin-B1 levels were detected by immunostaining. YFP-positive WT
astrocytes (black arrow, b) but not YFP-positive KO astrocytes (a) express ephrin-B1. Note that the ephrin-B1 deletion is specific to
astrocytes and CA1 neurons express ephrin-B1 in both WT and KO mice. (c) Graph shows mean integrated intensity of ephrin-B1
immunoreactivity per GFAP-positive astrocyte in WT (n ¼ 552 cells, 9 images, 3 mice) and KO (n ¼ 520 cells, 9 images, 3 mice) groups
(mean Æ SEM; n ¼ 3 mice). Statistical analysis was performed using paired Student’s t test (*p .05, **p .01).
Nikolakopoulou et al. 11
by guest on March 3, 2016asn.sagepub.comDownloaded from
12. documented the cellular and metabolic consequences
of TBI (for a review, see Giza and Hovda, 2014).
Quantitative magnetic resonance imaging has been used
to assess the temporal evaluation of injury, where in the
acute phase there is edema formation (Badaut et al.,
2011) that peaks at 3 to 5 dpi. This edematous phase
then resolves and results in increased astrogliosis as a
consequence of ongoing neuronal cell death at the
Figure 7. STAT3 phosphorylation in astrocytes is regulated by ephrin-B1. (a) Western blot analysis of pSTAT3 and STAT3 in the
hippocampus of control, 1, 3, or 7 dpi. (b) Western blot analysis of pSTAT3 and STAT3 in the primary cultures of untransfected astrocytes
(WT) and astrocytes overexpressing GFP (GFP) or ephrin-B1 (ephrin-B1) following the treatment with control Fc or EphB2-Fc for 15 min.
(c) Western blot analysis of pSTAT3 and STAT3 in the ipsilateral (Ipsi) or contralateral (Cont) hippocampus of ephrin-B1 KO or WT at
3 dpi. The blots were first probed against pSTAT3 and then reprobed for total STAT3. (d–f) Graphs show pSTAT3/STAT3 (mean Æ SEM;
n ¼ 3–4 cultures for E, Student’s t test, *p .05; n ¼ 3–4 mice for d and f, one-way ANOVA followed by Tukey’s post hoc analysis, *p .05,
**p .01, ***p .001). The levels of pSTAT3 and total STAT3 in EphB2-Fc-treated cultures were normalized to Fc-treated cultures (e).
Figure 8. Visual depiction of hypothesis. Increased ephrin-B1 immunoreactivity in astrocytes coincide with a reduction in vGlut1-positive
glutamatergic innervation of CA1 hippocampal neurons in SR at 3 dpi (middle panel), suggesting that astrocytic ephrin-B1 may regulate
synapse reorganization in the hippocampus following CCI. Astrocyte-specific deletion of ephrin-B1 accelerates recovery of vGlut1-positive
glutamatergic innervation of CA1 hippocampal neurons in SR after CCI (right panel).
12 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
13. injury site. The predominant secondary injury mechan-
isms are believed to include increased [Ca2þ
]i, loss of
metabolic regulation, and altered blood flow most
prominently at the site of the injury (cortex in our
model). However, here we studied the changes within
the hippocampus away from the injury site in animals
with moderate CCI when the hippocampus was not dir-
ectly injured by the CCI. Although the roles of neurode-
generation and neuroplasticity are likely interwoven and
are not mutually exclusive as the brain attempts to rees-
tablish homeostasis, our moderate CCI model of TBI
clearly results in cortical tissue loss independent of
direct hippocampal tissue loss. Transient upregulation
of ephrin-B1 immunoreactivity in hippocampal astro-
cytes, which is not observed in cortical astrocytes, is unli-
kely to be solely a direct response to the lesion, but rather
a response within the hippocampus to deafferenation
that occurs after cortical neuronal loss to establish
homeostatic controls. Although astrocytic roles in water
movement and glutamate recycling certainly can and
likely do play a role in both neurodegeneration and plas-
ticity, we propose that synaptic plasticity and reorganiza-
tion are most likely mechanisms of astrocyte-derived
ephrin-B1 reported here, considering its role in the
normal synapse development.
Our studies suggest that astrocytic ephrin-B1 is a nega-
tive regulator of vGlut1-positive innervation in the CA1
hippocampus and ephrin-B1 expressing astrocytes may
inhibit new synapse formation by competing with neur-
onal ephrin-B1. Our previous work demonstrated the
importance of trans-synaptic neuronal ephrin-B/EphB
interactions in the formation and maintenance of syn-
apses in vitro and within the developing mouse brain
(Henderson et al., 2001; Ethell et al., 2001; Takasu
et al., 2002; Henkemeyer et al., 2003). In the adult
brain, several EphB receptors, including EphB1, EphB2,
and EphB3, are expressed at synapses (Torres et al., 1998;
Buchert et al., 1999; Grunwald et al., 2001; Henderson
et al., 2001). Inhibition of EphB receptor signaling by the
expression of a kinase-inactive, dominant-negative form
of EphB2 interferes with the maturation of postsynaptic
dendritic spines in cultured hippocampal neurons (Ethell
et al., 2001). Further supporting a physiological role of
EphB receptors in synapse development, hippocampal
neurons lacking multiple EphB receptors develop abnor-
mal synapses in vivo (Henkemeyer et al., 2003). On the
other hand, activation of EphB receptors in cultured hip-
pocampal or cortical neurons with ephrin-B2 triggers the
maturation of dendritic spines (Henkemeyer et al., 2003;
Penzes et al., 2003) and induces clustering of EphB2
receptors together with NMDA receptors and other post-
synaptic components (Dalva et al., 2000; Penzes et al.,
2003). Although EphB2 contains a PDZ domain-binding
site at its intracellular carboxy-terminal end, its associ-
ation with the NR1 subunit of the NMDA receptor is
direct and is mediated by the extracellular domain of
EphB2 (Takasu et al., 2002; Nolt et al., 2011). The
PDZ domain-binding motif of the EphB receptors may
instead contribute to the localization of several PDZ
domain-containing components to the postsynaptic
density.
Postsynaptic proteins that interact with EphB recep-
tors and possibly regulate their postsynaptic localization
include the glutamate receptor-binding protein 1
(GRIP1), the protein interacting with C kinase 1
(Pick1), and the Ras-binding protein AF6 (Hock et al.,
1998; Torres et al., 1998; Hoogenraad et al., 2005). Dalva
et al. demonstrated that EphB2 also controls AMPA-type
glutamate receptor localization through PDZ-binding
domain interactions and also triggers presynaptic differ-
entiation via its ephrin binding domain (Kayser et al.,
2006). Thus, EphB receptors may promote the assembly
of both pre- and postsynaptic proteins following their
trans-synaptic interactions with ephrin-B ligand. Since
both EphB receptors and ephrin-B ligands are mem-
brane-bound, EphB/ephrin-B trans-interactions require
cell–cell adhesion between cells expressing Eph receptors
and those expressing ephrins. Interestingly, the EphB
receptor may be either pre- or postsynaptic depending
on the brain region (Contractor et al., 2002; Grunwald
et al., 2004). EphB2 was found to be expressed in both
CA1 and CA3 neurons and the disruption of interactions
between presynaptic EphB2 on Schaffer collaterals and
ephrin-B ligand on dendrites of CA1 hippocampal neu-
rons was implicated in impaired hippocampal long-term
potentiation observed in EphB2 KO mice (Grunwald
et al., 2004). Therefore, it is possible that astrocytic
ephrin-B1 detects presynaptic terminals that express the
EphB2 receptor and prevent excessive innervation of
CA1 hippocampal neurons by inhibiting growth of
EphB2-containing sprouting fibers following injury.
EphB receptor activation in axon fibers with ephrin-B
ligand is well known to trigger the repulsion of ipsilateral
retinal projections at the optic chiasm (Petros et al.,
2009), to regulate growth of spinal motor axons (Wang
and Anderson, 1997), and to induce collapse of axonal
growth cones of embryonic hippocampal and cortical
neurons in vitro (Lin et al., 2008; Srivastava et al.,
2013). Ephrin-B/EphB receptor signaling has been also
suggested to guide medial lateral motor column axons
into the ventral limb (Luria et al., 2008) and to regulate
the formation of intercortical connections through the
guidance of axon fibers within the corpus callosum
in vivo (Innocenti et al., 1995; Mendes et al., 2006).
Indeed, we see an increase in the number of vGlut1-posi-
tive presynaptic fibers in SR area of CA1 hippocampus of
astrocyte-specific ephrin-B1 KO mice as compared with
WT mice following TBI, suggesting that astrocytic
ephrin-B1 may prevent sprouting of CA3 axon fibers by
repulsion.
Nikolakopoulou et al. 13
by guest on March 3, 2016asn.sagepub.comDownloaded from
14. It is also possible that ephrin-B1 expressing astrocytes
directly target EphB-expressing presynaptic boutons.
Ephrin-B-expressing astrocytes were shown to engulf
neuronal EphB2 in mixed neuron/astrocyte cocultures
at the sites of neuron-glial contacts (Lauterbach and
Klein, 2006). However, functional significance of
ephrin-B/EphB trans-endocytosis is not clear. Our studies
are the first to show that specific deletion of ephrin-B1
from astrocytes accelerates v-Glut-positive glutamatergic
innervation of CA1 hippocampal neurons, possibly due
to reduced removal of vGlut1-positive terminals of
sprouting fibers by astrocytes following TBI. Although
the factors or molecular signals triggering astrocyte-
mediated engulfment of synapses are not known, con-
focal microscopy revealed that both excitatory and
inhibitory synapses are engulfed by astrocytes in the
developing and adult mouse brain through phagocytic
pathways (Chung et al., 2013). Other studies also
reported a decrease in the number of synapses in CA1
hippocampus accompanied by decreased dendritic com-
plexity at 3 dpi (Gao et al., 2011) and reduced excitability
of CA1 hippocampal neurons at 7 dpi (Cohen et al.,
2007). Thus, a vacant presynaptic EphB receptor from
disassembled synaptic connections and a reduced synap-
tic activity may serve as an eat me signal to recruit ephrin-
B1 expressing astrocytes and to initiate synapse engulfing
process.
It is also possible that astrocytic ephrin-B1 may not be
acting through neuronal EphB but activate EphB recep-
tors in microglia to trigger microglia-mediated synaptic
pruning. Microglia has been suggested to prune synaptic
connections in the brain, and clathrin-coated spinules
were observed at sites of contact between microglia and
dendritic spines, axon terminals, or astrocytic processes
(Tremblay et al., 2010; Schafer et al., 2012). The role of
microglia in the developmental pruning of synapses is
supported by studies showing reduced number of micro-
glia and decreased synaptic pruning in the hippocampus
of mice lacking the fractalkine receptor (Cx3cr1)
(Paolicelli et al., 2011). However, mechanisms of glial-
mediated synapse pruning are still not clear. Microglial
activation was shown to be reduced following nerve
injury in EphB1 KO mice (Cibert-Goton et al., 2013)
and macrophages expressing EphB3 accumulated at the
injury site after optic nerve crush injury (Liu et al., 2006).
Future studies will establish the effects of astrocyte-
specific overexpression of ephrin-B1 on microglial-
dependent synapse pruning.
In addition to regulating EphB receptor forward sig-
naling in neurons, ephrin-B1 is know to activate reverse
signaling in ephrin-B-expressing cells through the activa-
tion of STAT3 (Bong et al., 2007). Therefore, it is pos-
sible that the effects of astrocytic ephrin-B1 on synapses
are mediated through the activation of STAT3 signaling
in astrocytes. Indeed, STAT3 is known to regulate
astrocyte differentiation (Bonni et al., 1997), the forma-
tion of perineuronal astrocytic processes, and the expres-
sion of synaptogenic molecule TSP-1 (Tyzack et al.,
2014). STAT3 signaling also plays an important role in
reactive astrocytosis and may regulate protein expression
in astrocytes following TBI (Herrmann et al., 2008). In
fact, STAT3 phosphorylation is upregulated in astrocytes
following TBI (Oliva et al., 2012) and astrocyte-specific
deletion of STAT3 attenuated reactive astrogliosis and
glial scar formation after injury (Wanner et al., 2013;
O’Callaghan et al., 2014). Our results also show higher
STAT3 phosphorylation (pSTAT3) in the hippocampus
following TBI. Furthermore, we observed that astrocyte-
specific ablation of ephrin-B1 suppressed injury-induced
upregulation of STAT3 phosphorylation in the hippo-
campus in vivo and the activation of ephrin-B1 triggered
an increase in STAT3 phosphorylation in cultured
astrocytes.
Ephrin-B1-mediated activation of STAT3 may lead to
synapse pruning through phagocytosis, as astrocyte-
mediated pruning of synapses involves the activation of
MEGF10 and MERTK phagocytic pathways (Chung
et al., 2013), and STAT3 has been implicated in the com-
plement-dependent phagocytosis (Pietrocola et al., 2013).
Interestingly, the role of Rac-mediated pinocytosis in
ephrin-B-dependent axon pruning was previously sug-
gested via the activation of Grb4/DOCK180/Rac path-
way (Marston et al., 2003; Parker et al., 2004; Xu and
Henkemeyer, 2009; reviewed in Xu and Henkemeyer,
2012). The cytoplasmic tail of ephrin-B can become phos-
phorylated by the Src family of nonreceptor tyrosine
kinases and recruits SH2/SH3 domain adaptor protein
Grb4 following its interaction with EphB receptor.
Grb4 adaptor protein links ephrin-B to Rac GTPase
guanine exchange factor Dock 180. This pathway plays
a critical role in ephrin-B3-mediated pruning of mossy
fibers, axons of dentate granular cells (Xu and
Henkemeyer, 2009), and EphB receptor-induced cluster-
ing and internalization of ephrin-B1 through a clathrin-
mediated endocytotic pathway (Parker et al., 2004).
As glial cells expressing ephrin-B are able to trans-endo-
cytose full-length EphB2 receptor from the neighboring
neurons in neuron/glial cocultures, it is possible that
reactive astrocytes expressing ephrin-B1 are also involved
in trans-endocytosis of EphB2 receptor containing pre-
synaptic boutons following brain injury. Future studies
will determine whether ephrin-B1 activation in astrocytes
following its interaction with neuronal EphB receptor can
induce engulfing of EphB/ephrin-B complex by astrocytes
in vivo through Rac-mediated endocytosis.
However, the long-term effects of ephrin-B1 upregula-
tion in astrocytes following TBI are still unclear. The
reduction in vGlut1-positive innervation of CA1 neurons
may contribute negatively to TBI recovery by eliminating
existing connections that are necessary for appropriate
14 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
15. hippocampal function. Conversely, elimination of syn-
apses may improve recovery by reducing the amount of
excitatory synapses and preventing glutamate excitotoxi-
city. In addition, accelerated restoration of excitatory
synaptic innervation that we see in astrocyte-specific
ephrin-B1 KO mice can lead to an early activation of
cognitive and other processes during the window of vul-
nerability, which may actually be detrimental to long-
term recovery (Griesbach et al., 2012; Shen et al., 2013).
Long-term functional analysis will be preformed in future
studies to determine if the short-term changes observed
here lead to long-term benefits or deficits.
In summary, our studies show the role of astrocytic
ephrin-B1 in the regulation of synapse remodeling in
the hippocampus following brain injury. As the changes
in synaptic circuits contribute to long-term neuropsycho-
logical changes and cognitive deficits observed in humans
following brain injury, the regulation of ephrin-B1/EphB
receptor signaling may provide new therapeutic opportu-
nities to moderate synaptic connectivity and aid func-
tional recovery after TBI.
Acknowledgments
The authors thank members of the Ethell and Obenaus laboratories
for helpful discussions and comments. The authors also thank Sima
Mortazavi and Mary Hammer for technical support.
Declaration of Conflicting Interests
The authors declared no potential conflicts of interest with respect
to the research, authorship, and/or publication of this article.
Funding
The authors disclosed receipt of the following financial support for
the research, authorship, and/or publication of this article: The
work was supported by MH67121 grant from NIMH (to I. M. E.)
and PP1903 grant from NMSS (to A. M. N.).
References
Albensi, B. C., Knoblach, S. M., Chew, B. G. M., O’Reilly, M. P.,
Faden, A. I., Pekar, J. J. (2000). Diffusion and high resolution
MRI of traumatic brain injury in rats: Time course and correl-
ation with histology. Experimental Neurology, 162, 61–72.
Atkins, C. M. (2011). Decoding hippocampal signaling deficits
after traumatic brain injury. Translational Stroke Research, 2,
546–555.
Badaut, J., Ashwal, S., Obenaus, A. (2011). Aquaporins in cere-
brovascular disease: A target for treatment of brain Edema?
Cerebrovascular Diseases, 31, 521–531.
Baldwin, S. A., Gibson, T., Callihan, C. T., Sullivan, P. G., Palmer,
E., Scheff, S. W. (1997). Neuronal cell loss in the CA3
subfield of the hippocampus following cortical contusion utiliz-
ing the optical disector method for cell counting. Journal of
Neurotrauma, 14, 385–398.
Barker, A. J., Koch, S. M., Reed, J., Barres, B. A., Ullian, E. M.
(2008). Developmental control of synaptic receptivity. The
Journal of Neuroscience, 28, 8150–8160.
Barthet, G., Dunys, J., Shao, Z., Xuan, Z., Ren, Y., Xu,
J., . . . Robakis, N. K. (2013). Presenilin mediates neuroprotec-
tive functions of ephrinB and brain-derived neurotrophic factor
and regulates ligand-induced internalization and metabolism of
EphB2 and TrkB receptors. Neurobiology of Aging, 34(2):
499–510.
Benowitz, L. I., Carmichael, S. T. (2010). Promoting axonal
rewiring to improve outcome after stroke. Neurobiology of
Disease, 37, 259–266.
Bong, Y. S., Lee, H. S., Carim-Todd, L., Mood, K., Nishanian, T.
G., Tessarollo, L., Daar, I. O. (2007). EphrinB1 signals from
the cell surface to the nucleus by recruitment of STAT3.
Proceedings of the National Academy of Sciences, 104(44):
17305–17310.
Bonni, A., Sun, Y., Nadal-Vicens, M., Bhatt, A., Frank, D. A.,
Rozovsky, I., . . . Greenberg, M. E. (1997). Regulation of
gliogenesis in the central nervous system by the JAK-STAT
signaling pathway. Science, 278(5337): 477–483.
Brown, C. E., Murphy, T. H. (2008). Livin’ on the edge: Imaging
dendritic spine turnover in the peri-infarct zone during ischemic
stroke and recovery. The Neuroscientist, 14(2): 139–146.
Buchert, M., Schneider, S., Meskenaite, V., Adams, M. T.,
Canaani, E., Baechi, T., . . . Hovens, C. M. (1999). The junc-
tion-associated protein AF-6 interacts and clusters with specific
Eph receptor tyrosine kinases at specialized sites of cell–cell
contact in the brain. The Journal of Cell Biology, 144, 361–371.
Carmona, M. A., Murai, K. K., Wang, L., Roberts, A. J.,
Pasquale, E. B. (2009). Glial ephrin-A3 regulates hippocampal
dendritic spine morphology and glutamate transport.
Proceedings of the National Academy of Sciences of the
United States of America, 106, 12524–12529.
Catchpole, T., Henkemeyer, M. (2011). EphB2 tyrosine kinase-
dependent forward signaling in migration of neuronal progeni-
tors that populate and form a distinct region of the dentate niche.
The Journal of Neuroscience, 31, 11472–11483.
Chen, X., Yang, J., Kress, B., T., Tong, J., Liu, H., Takano,
T., . . . Ren, Z. (2013). Improved axonal regeneration after
spinal cord injury in mice with astrocytic specific deletion of
ephrin B2. Neuroscience, 241, 89–99.
Chung, W. S., Clarke, L. E., Wang, G. X., Stafford, B. K., Sher, A.,
Chakraborty, C., . . . Barres, B. A. (2013). Astrocytes mediate
synapse elimination through MEGF10 and MERTK pathways.
Nature, 504(7480): 394–400.
Cibert-Goton, V., Yuan, G., Battaglia, A., Fredriksson, S.,
Henkemeyer, M., Sears, T., Gavazzi, I. (2013).
Involvement of EphB1 receptors signalling in models of inflam-
matory and neuropathic pain. PLoS One, 8(1): e53673.
Cisse, M., Halabisky, B., Harris, J., Devidze, N., Dubal, D. B., Sun,
B., . . . Mucke, L. (2011). Reversing EphB2 depletion rescues
cognitive functions in Alzheimer model. Nature, 469, 47–52.
Cohen, A. S., Pfister, B. J., Schwarzbach, E., Grady, M. S.,
Goforth, P. B., Satin, L. S. (2007). Injury-induced alterations
in CNS electrophysiology. Progress in Brain Research, 161,
143–169.
Conover, J. C., Doetsch, F., Garcia-Verdugo, J. M., Gale, N. W.,
Yancopoulos, G. D., Alvarez-Buylla, A. (2000). Disruption of
Eph/ephrin signaling affects migration and proliferation in the
adult subventricular zone. Nature Neuroscience, 3, 1091–1097.
Contractor, A., Rogers, C., Maron, C., Henkemeyer, M., Swanson,
G. T., Heinemann, S. F. (2002). Trans-synaptic Eph receptor-
Nikolakopoulou et al. 15
by guest on March 3, 2016asn.sagepub.comDownloaded from
16. ephrin signaling in hippocampal mossy fiber LTP. Science,
296(5574): 1864–1869.
Coulthard, M. G., Morgan, M., Woodruff, T. M., Arumugam, T. V.,
Taylor, S. M., Carpenter, T. C., . . . Boyd, A. W. (2012). Eph/
Ephrin signaling in injury and inflammation. American Journal
of Pathology, 181(5): 1493–1503.
Dalva, M. B., Takasu, M. A., Lin, M. Z., Shamah, S. M., Hu, L.,
Gale, N. W., Greenberg, M. E. (2000). EphBs interact with
NMDA receptors and regulate excitatory synapse formation.
Cell, 103, 945–956.
Du, J., Fu, C., Sretavan, D. W. (2007). Eph/ephrin signaling as a
potential therapeutic target after central nervous system injury.
Current Pharmaceutical Design, 13, 2507–2518.
Eddleston, M., Mucke, L. (1993). Molecular profile of reactive
astrocytes – Implications for their role in neurologic disease.
Neuroscience, 54, 15–36.
Ethell, I. M., Pasquale, E. B. (2005). Molecular mechanisms of
dendritic spine development and remodeling. Progress in
Neurobiology, 75, 161–205.
Ethell, I. M., Irie, F., Kalo, M. S., Couchman, J. R., Pasquale, E. B.,
Yamaguchi, Y. (2001). EphB2/syndecan-2 signaling in den-
dritic spine morphogenesis. Neuron, 31, 1001–1013.
Filosa, A., Paixao, S., Honsek, S. D., Carmona, M. A., Becker, L.,
Feddersen, B., . . . Klein, R. (2009). Neuron-glia communication
via EphA4/ephrin-A3 modulates LTP through glial glutamate
transport. Nature Neuroscience, 12, 1285–1292.
Gao, X., Deng, P., Xu, Z. C., Chen, J. (2011). Moderate trau-
matic brain injury causes acute dendritic and synaptic degener-
ation in the hippocampal dentate gyrus. PLoS One, 6(9):
e24566.
Georgakopoulos, A., Xu, J., Xu, C., Mauger, G., Barthet, G.,
Robakis, N. K. (2011). Presenilin1/gamma-secretase promotes
the EphB2-induced phosphorylation of ephrinB2 by regulating
phosphoprotein associated with glycosphingolipid-enriched
microdomains/Csk binding protein. FASEB Journal, 25(10):
3594–3604.
Giza, C. C., Hovda, D. A. (2014). The new neurometabolic
cascade of concussion. Neurosurgery, 75, S24–S33.
Goldshmit, Y., McLenachan, S., Turnley, A. (2006). Roles of
Eph receptors and ephrins in the normal and damaged adult
CNS. Brain Research Reviews, 52, 327–345.
Griesbach, G. S., Tio, D. L., Vincelli, J., McArthur, D. L.,
Taylor, A. N. (2012). Differential effects of voluntary and
forced exercise on stress responses after traumatic brain
injury. Journal of Neurotrauma, 29, 1426–1433.
Grunwald, I. C., Korte, M., Wolfer, D., Wilkinson, G. A., Unsicker,
K., Lipp, H. P., . . . Klein, R. (2001). Kinase-independent
requirement of EphB2 receptors in hippocampal synaptic plas-
ticity. Neuron, 32, 1027–1040.
Grunwald, I. C., Korte, M., Adelmann, G., Plueck, A., Kullander,
K., Adams, R. H., . . . Klein, R. (2004). Hippocampal plasticity
requires postsynaptic ephrinBs. Nature Neuroscience, 7(1):
33–40.
Henderson, J. T., Georgiou, J., Jia, Z., Robertson, J., Elowe, S.,
Roder, J. C., Pawson, T. (2001). The receptor tyrosine kinase
EphB2 regulates NMDA-dependent synaptic function. Neuron,
32(6): 1041–1056.
Henkemeyer, M., Itkis, O. S., Ngo, M., Hickmott, P. W., Ethell,
I. M. (2003). Multiple EphB receptor tyrosine kinases shape
dendritic spines in the hippocampus. The Journal of Cell
Biology, 163(6): 1313–1326.
Herrmann, J. E., Imura, T., Song, B., Qi, J., Ao, Y., Nguyen, T.
K., . . . Sofroniew, M. V. (2008). STAT3 is a critical regulator of
astrogliosis and scar formation after spinal cord injury. The
Journal of Neuroscience, 28, 7231–7243.
Hock, B., Bo¨hme, B., Karn, T., Yamamoto, T., Kaibuchi, K.,
Holtrich, U., . . . Strebhardt, K. (1998). PDZ-domain-mediated
interaction of the Eph-related receptor tyrosine kinase EphB3
and the ras-binding protein AF6 depends on the kinase activity
of the receptor. Proceedings of the National Academy of
Sciences, 95(17): 9779–9784.
Hoogenraad, C. C., Milstein, A. D., Ethell, I. M., Henkemeyer, M.,
Sheng, M. (2005). GRIP1 controls dendrite morphogenesis by
regulating EphB receptor trafficking. Nature Neuroscience, 8,
906–915.
Immonen, R. J., Kharatishvili, I., Niskanen, J. P., Gro¨hn, H.,
Pitka¨nen, A., Gro¨hn, O. H. J. (2009). Distinct MRI pattern
in lesional and perilesional area after traumatic brain injury in
rat—11 months follow-up. Experimental Neurology, 215,
29–40.
Innocenti, G. M., Aggoun-Zouaoui, D., Lehmann, P. (1995).
Cellular aspects of callosal connections and their development.
Neuropsychologia, 33, 961–987.
Ito, U., Kuroiwa, T., Nagasao, J., Kawakami, E., Oyanagi, K.
(2006). Temporal profiles of axon terminals, synapses and
spines in the ischemic penumbra of the cerebral cortex:
Ultrastructure of neuronal remodeling. Stroke: A Journal of
Cerebral Circulation, 37, 2134–2139.
Kayser, M. S., McClelland, A. C., Hughes, E. G., Dalva, M. B.
(2006). Intracellular and trans-synaptic regulation of glutama-
tergic synaptogenesis by EphB receptors. The Journal of
Neuroscience, 26(47): 12152–12164.
Langlois, J. A., Rutland-Brown, W., Thomas, K. E. (2004).
Traumatic brain injury in the United States. Emergency depart-
ment visits, hospitalizations, and deaths. Atlanta, Georgia:
Centers for Disease Control and Prevention, National Center
for Injury Prevention and Control.
Luria, V., Krawchuk, D., Jessell, T. M., Laufer, E., Kania, A.
(2008). Specification of motor axon trajectory by ephrin-B:
EphB signaling reveals symmetrical control of axonal patterning
in the developing limb. Neuron, 60, 1039–1053.
Lauterbach, J., Klein, R. (2006). Release of full-length EphB2
receptors from hippocampal neurons to cocultured glial cells.
The Journal of Neuroscience, 26(45): 11575–11581.
Li, S., Carmichael, S. T. (2006). Growth-associated gene and
protein expression in the region of axonal sprouting in the aged
brain after stroke. Neurobiology of Disease, 23, 362–373.
Lin, K. T., Sloniowski, S., Ethell, D. W., Ethell, I. M. (2008).
Ephrin-B2-induced cleavage of EphB2 receptor is mediated by
matrix metalloproteinases to trigger cell repulsion. The Journal
of Biological Chemistry, 283(43): 28969–28979.
Liu, X., Hawkes, E., Ishimaru, T., Tran, T., Sretavan, D. W.
(2006). EphB3: An endogenous mediator of adult axonal plas-
ticity and regrowth after CNS injury. The Journal of
Neuroscience, 26, 3087–3101.
Maas, A. I., Stocchetti, N., Bullock, R. (2008). Moderate and
severe traumatic brain injury in adults. The Lancet Neurology, 7,
728–741.
16 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from
17. Marston, D. J., Dickinson, S., Nobes, C. D. (2003). Rac-depen-
dent trans-endocytosis of ephrinBs regulates Eph-ephrin contact
repulsion. Nature Cell Biology, 5(10): 879–888.
Mendes, S. W., Henkemeyer, M., Liebl, D. J. (2006). Multiple
Eph receptors and B-class ephrins regulate midline crossing of
corpus callosum fibers in the developing mouse forebrain. The
Journal of Neuroscience, 26, 882–892.
Moeller, M. L., Shi, Y., Reichardt, L. F., Ethell, I. M. (2006).
EphB receptors regulate dendritic spine morphogenesis through
the recruitment/phosphorylation of FAK and RhoA activation.
Journal of Biological Chemistry, 281(3): 1587–1598.
Mostany, R., Chowdhury, T. G., Johnston, D. G., Portonovo, S. A.,
Carmichael, S. T., Portera-Cailliau, C. (2010). Local hemo-
dynamics dictate long-term dendritic plasticity in peri-infarct
cortex. The Journal of Neuroscience, 30, 14116–14126.
Murai, K. K., Nguyen, L. N., Irie, F., Yamaguchi, Y., Pasquale,
E. B. (2003). Control of hippocampal dendritic spine morph-
ology through ephrin-A3/EphA4 signaling. Nature
Neuroscience, 6, 153–160.
Murai, K. K., Pasquale, E. B. (2011). Eph receptors and ephrins
in neuron-astrocyte communication at synapses. Glia, 59,
1567–1578.
Myer, D. J., Gurkoff, G. G., Lee, S. M., Hovda, D. A.,
Sofroniew, M. V. (2006). Essential protective roles of reactive
astrocytes in traumatic brain injury. Brain: A Journal of
Neurology, 129, 2761–2772.
Nolt, M. J., Lin, Y., Hruska, M., Murphy, J., Sheffler-Colins, S. I.,
Kayser, M. S., . . . Dalva, M. B. (2011). EphB controls NMDA
receptor function and synaptic targeting in a subunit-specific
manner. The Journal of Neuroscience, 31(14): 5353–5364.
Norris, C. M., Scheff, S. (2009). Recovery of afferent function
and synaptic strength in hippocampal CA1 following traumatic
brain injury. Journal of Neurotrauma, 26(12): 2269–2278.
Nortje, J., Menon, D. K. (2004). Traumatic brain injury:
Physiology, mechanisms, and outcome. Current Opinion in
Neurology, 17, 711–718.
O’Callaghan, J. P., Kelly, K. A., VanGilder, R. L., Sofroniew, M.
V., Miller, D. B. (2014). Early activation of STAT3 regulates
reactive astrogliosis induced by diverse forms of neurotoxicity.
PLoS One, 9(7): e102003.
Oliva, Jr. A. A., Kang, Y., Sanchez-Molano, J., Furones, C.,
Atkins, C. M. (2012). STAT3 signaling after traumatic brain
injury. Journal of Neurochemistry, 120(5): 710–720.
Overman, J. J., Clarkson, A. N., Wanner, I. B., Overman, W. T.,
Eckstein, I., Maguire, J. L., . . . Carmichael, S. T. (2012). A role
for ephrin-A5 in axonal sprouting, recovery, and activity-depen-
dent plasticity after stroke. Proceedings of the National
Academy of Sciences of the United States of America, 109,
E2230–E2239.
Paolicelli, R. C., Bolasco, G., Pagani, F., Maggi, L., Scianni, M.,
Panzanelli, P., . . . Gross, C. T. (2011). Synaptic pruning by
microglia is necessary for normal brain development. Science,
333(6048): 1456–1458.
Parker, M., Roberts, R., Enriquez, M., Zhao, X., Takahashi, T., Pat
Cerretti, D., . . . Chen, J. (2004). Reverse endocytosis of trans-
membrane ephrin-B ligands via a clathrin-mediated pathway.
Biochemical and Biophysical Research Communications,
323(1): 17–23.
Pekny, M., Nilsson, M. (2005). Astrocyte activation and reactive
gliosis. Glia, 50, 427–434.
Penzes, P., Beeser, A., Chernoff, J., Schiller, M. R., Eipper, B. A.,
Mains, R. E., Huganir, R. L. (2003). Rapid induction of den-
dritic spine morphogenesis by trans-synaptic ephrinB-EphB
receptor activation of the Rho-GEF kalirin. Neuron, 37,
263–274.
Petros, T. J., Shrestha, B. R., Mason, C. (2009). Specificity and
sufficiency of EphB1 in driving the ipsilateral retinal projection.
The Journal of Neuroscience, 29(11): 3463–3474.
Pietrocola, F, Izzo, V., Niso-Santano, M., Vacchelli, E., Galluzzi,
L., Maiuri, M. C., Kroemer, G. (2013). Regulation of autop-
hagy by stress-responsive transcription factors. Seminars in
Cancer Biology, 23(5): 310–322.
Ren, Z., Chen, X., Yang, J., Kress, B. T., Tong, J., Liu,
H., . . . Nedergaard, M. (2013). Improved axonal regeneration
after spinal cord injury in mice with conditional deletion of
ephrin B2 under the GFAP promoter. Neuroscience, 241, 89–99.
Sanders, S. J., Murtha, M. T., Gupta, A. R., Murdoch, J. D.,
Raubeson, M. J., Willsey, A. J., . . . State, M. W. (2012).
De novo mutations revealed by whole-exome sequencing are
strongly associated with autism. Nature, 485, 237–241.
Schafer, D. P., Lehrman, E. K., Kautzman, A. G., Koyama, R.,
Mardinly, A. R., Yamasaki, R., . . . Stevens, B. (2012).
Microglia sculpt postnatal neural circuits in an activity and
complement-dependent manner. Neuron, 74(4): 691–705.
Scheff, S. W., Price, D. A., Hicks, R. R., Baldwin, S. A., Robinson,
S., Brackney, C. (2005). Synaptogenesis in the hippocampal
CA1 field following traumatic brain injury. Journal of
Neurotrauma, 22, 719–732.
Segura, I., Essmann, C. L., Weinges, S., Acker-Palmer, A.
(2007). Grb4 and GIT1 transduce ephrinB reverse signals mod-
ulating spine morphogenesis and synapse formation. Nature
Neuroscience, 10, 301–310.
Shen, X., Li, A., Zhang, Y., Dong, X. M., Shan, T., Wu, Y., . . . Hu,
Y. (2013). The effect of different intensities of treadmill exer-
cise on cognitive function deficit following a severe controlled
cortical impact in rats. International Journal of Molecular
Sciences, 14, 21598–21612.
Shields, J., Kimbler, D. E., Radwan, W., Yanasak, N., Sukumari-
Ramesh, S., Dhandapani, K. M. (2011). Therapeutic targeting
of astrocytes after traumatic brain injury. Translational Stroke
Research, 2, 633–642.
Sofroniew, M. V. (2005). Reactive astrocytes in neural repair and
protection. The Neuroscientist: A Review Journal Bringing
Neurobiology, Neurology and Psychiatry, 11, 400–407.
Sofroniew, M. V. (2009). Molecular dissection of reactive astro-
gliosis and glial scar formation. Trends in Neurosciences, 32,
638–647.
Srivastava, N., Robichaux, M. A., Chenaux, G., Henkemeyer, M.,
Cowan, C. W. (2013). EphB2 receptor forward signaling
controls cortical growth cone collapse via Nck and Pak.
Molecular and Cellular Neuroscience, 52, 106–116.
Takasu, M. A., Dalva, M. B., Zigmond, R. E., Greenberg, M. E.
(2002). Modulation of NMDA receptor-dependent calcium
influx and gene expression through EphB receptors. Science,
295(5554): 491–495.
Torres, R., Firestein, B. L., Dong, H., Staudinger, J., Olson, E. N.,
Huganir, R. L., . . . Yancopoulos (1998). PDZ proteins bind,
cluster, and synaptically colocalize with Eph receptors and
their ephrin ligands. Neuron, 21(6): 1453–1463.
Nikolakopoulou et al. 17
by guest on March 3, 2016asn.sagepub.comDownloaded from
18. Tremblay, M. -Eˇ., Lowery, R. L., Majewska, A. K. (2010).
Microglial interactions with synapses are modulated by visual
experience. PLoS Biology, 8(11): e1000527.
Tyzack, G. E., Sitnikov, S., Barson, D., Adams-Carr, K. L., Lau, N.
K., Kwok, J. C., . . . Lakatos, A. (2014). Astrocyte response to
motor neuron injury promotes structural synaptic plasticity via
STAT3-regulated TSP-1 expression. Nature Communications,
5, 4294.
Villapol, S., Byrnes, K. R., Symes, A. J. (2014). Temporal
dynamics of cerebral blood flow, cortical damage, apoptosis,
astrocyte–vasculature interaction and astrogliosis in the pericon-
tusional region after traumatic brain injury. Frontiers in
Neurology, 5, 82.
Wang, H. U., Anderson, D. J. (1997). Eph Family
Transmembrane Ligands Can Mediate Repulsive Guidance of
Trnk Neural Crest Migration and Motor Axon Outgrowth.
Neuron, 18, 383–396.
Wang, Y., Ying, G. X., Liu, X., Wang, W. Y., Dong, J. H., Ni, Z.
M., Zhou, C. F. (2005). Induction of ephrin-B1 and EphB
receptors during denervation-induced plasticity in the adult
mouse hippocampus. The European Journal of Neuroscience,
21, 2336–2346.
Wanner, I. B., Anderson, M. A., Song, B., Levine, J., Fernandez,
A., Gray-Thompson, Z., . . . Sofroniew, M. V. (2013). Glial scar
borders are formed by newly proliferated, elongated astrocytes
that interact to corral inflammatory and fibrotic cells via
STAT3-dependent mechanisms after spinal cord injury. The
Journal of Neuroscience, 33(31): 12870–12886.
Wilhelmsson, U., Bushong, E. A., Price, D. L., Smarr, B. L., Phung,
V., Terada, M., . . . Pekny, M. (2006). Redefining the concept of
reactive astrocytes as cells that remain within their unique
domains upon reaction to injury. Proceedings of the National
Academy of Sciences of the United States of America, 103,
17513–17518.
Xu, N. J., Henkemeyer, M. (2009). Ephrin-B3 reverse signaling
through Grb4 and cytoskeletal regulators mediates axon prun-
ing. Nature Neuroscience, 12(3): 268–276.
Xu, N. J., Henkemeyer, M. (2012). Ephrin reverse signaling in
axon guidance and synaptogenesis. Seminars in Cell
Developmental Biology, 23(1): 58–64.
Van Hoecke, A., Schoonaert, L., Lemmens, R., Timmers, M.,
Staats, K. A., Laird, A. S., . . . Robberecht, W. (2012). EPHA4
is a disease modifier of amyotrophic lateral sclerosis in animal
models and in humans. Nature Medicine, 18(9): 1418–1422.
Yu, Z., Morrison, 3rd. B. (2010). Experimental mild traumatic
brain injury induces functional alteration of the developing
hippocampus. Journal of Neurophysiology, 103, 499–510.
Zimmer, M., Palmer, A., Kohler, J., Klein, R. (2003). EphB-
ephrinB bi-directional endocytosis terminates adhesion allowing
contact mediated repulsion. Nature Cell Biology, 5, 869–878.
18 ASN Neuro
by guest on March 3, 2016asn.sagepub.comDownloaded from