Alignment of raw reads in Avadis NGS
•Download as PPTX, PDF•
0 likes•1,001 views
Avadis NGS provides support for aligning raw reads for small RNA, ChIP-Seq and DNA-Seq analysis. The alignment algorithm"COBWeb" integrated with Avadis NGS is a new proprietary algorithm based on the Burrows Wheeler Transform.
Recommended
Recommended
More Related Content
More from Strand Life Sciences Pvt Ltd
More from Strand Life Sciences Pvt Ltd (12)
Recently uploaded
Recently uploaded (20)
Alignment of raw reads in Avadis NGS
- 1. Pioneering Scientific Intelligence DNA/Small RNA Alignment in Avadis NGS 1.3 Strictly Confidential © Strand Life Sciences
- 2. How does CoBWeb compare with other What is an Alignment algorithm? algorithms? What issues must an Alignment How is CoBWeb exposed in Avadis algorithm consider? NGS? What is the future evolution of How do Alignment algorithms work? CoBWeb? How does CoBWeb work? Questions we will seek to answer in this presentation © Strand
- 3. What is an Alignment algorithm? © Strand
- 4. Subject’s Genome AGGCTACGCATTTCCCATAAAGACCCACGCTTAAGTTC AGGCTACGCATGTCCCATAATGACCCACACTTAAGTTC Reference Genome, close but not quite the same as the Subject’s Genome © Strand
- 5. What issues must an Alignment algorithm consider? © Strand
- 6. Mismatches and Gaps Reference Genome Deletion Reads SNP © Strand
- 7. Handling paired reads Subject’s Genome × Reference Genome Repeat Repeat Region Region © Strand
- 8. A variety of Read Lengths Short reads ~50, few mismatches and gaps Long reads, few hundreds to thousands, ma ny more mismatches and gaps © Strand
- 9. Speed and Memory Run in 4GB RAM Allow use of multiple Billions of cores/process reads. ors Scale speed with more memory © Strand
- 10. How do Alignment algorithms work? © Strand
- 11. Indexing the Genome to find Seed Matches Scanning the Reference for each Read takes too long The Reference Index The Index very quickly yields locations in the Reference where some part (seed) of the Read matches. This Seed occurs at This Seed occurs at Reference locations Reference locations x1, x2… x3, x4… © Strand
- 12. Detailed Alignment at Seed Match Locations Seed Reference Match Read How many Mismatches and Gaps are needed for the Read to match around the Seed? Smith-Waterman or Dynamic Programming © Strand
- 13. The Burrows- Wheeler based Index The original Reference C G A C $ All its circular shifts, sorted A C $ C G This column is 2 the BWT lexicographically 0 C G A C $ 3 C $ C G A 1 G A C $ C Circular Shift Indices 4 $ C G A C The Index These can be sampled comprises these to fit into reduced along with some memory at the expense housekeeping data of speed without structures sacrificing correctness © Strand
- 14. The Burrows- Wheeler based Index EXACT Reference Match Read All Exact Matches of a Read (NO Mismatches or Gaps) in the Reference can be found in time proportional to the length of the Read and largely independent of the size of the Reference. © Strand
- 15. How does CoBWeb work? © Strand
- 16. Seeding Strategy This 15-mer occurs This 15-mer occurs at locations at locations x1, x2… x3, x4… This whole 30-mer occurs at location x5 Use the BW based index, augmented with additional data structures for speed, to find one or more Long Seed Matches in the Reference Justification: Most long Reads do not have Mismatches and Gaps strewn across their length; And Long Seeds there are usually long will have few stretches that match matching locations. exactly. © Strand
- 17. Advantages Separating the Smith- Seed length is not Waterman phase from specified in advance, so the BW Index search Long and Short reads can allows an unlimited be handled seamlessly. number of gaps and mismatches. © Strand
- 18. How does CoBWeb compare with other algorithms? © Strand
- 19. Comparison with BWA CoBWeb: 94% BWA: 4% Alignment error + 1 gap Read Score with up of possibly Length 50 to 2 Gaps multiple length Read Length 150 A little faster than BWA with comparable results © Strand
- 20. How is CoBWeb exposed in Avadis NGS? © Strand
- 21. Entry Two new experiment types, DNA Alignment and Small-RNA Alignment © Strand
- 22. The Alignment Workflow Run Alignment, and then create a DNA Variant or ChIP-Seq Experiment from the results. © Strand
- 23. Specify number of Alignment Mismatches and Parameters Gaps, and handling of Multiple Matching. Specify Adaptor Trimming (only for Small RNA) and 3’,5’ trimming based on quality Screen against Contaminant Databases. © Strand
- 24. What is the future evolution of CoBWeb? © Strand
- 25. ToDos Chimeric Reads RNA-Seq Alignment Base Quality recalibration Affine Gap Costs © Strand
- 26. http://www.avadis-ngs.com © Strand