1
Programme: BABS Module Level (3,4,5 or 6): 4
Module: Managing Information and
Technology
Module code: SBLC4001
Contribution to Overall
Module Assessment (%):
75% Assignment No(s): 1
Referencing: In the main body of your submission you must give credit to authors on whose research your
work is based. Append to your submission a reference list that indicates the books, articles, etc.
that you have read or quoted in order to complete this assignment (e.g. for books: surname of
author and initials, year of publication, title of book, edition, publisher: place of publication).
Disclosure: Please include the following statement on the title page of the submitted assignment, followed
by your name:
I declare that this assignment is all my own work and that I have acknowledged all materials
used from the published or unpublished works of other people. All references have been duly
cited.
Turnitin: All assignments must be submitted to Turnitin unless otherwise instructed by the Lecturer.
Note: the Turnitin version is the primary submission and acts as a receipt for the student. Late
submission of the electronic version of the assignment will result in a late penalty mark. Penalties for
late submission: Up to one weeks late, maximum mark of 50%. Over one week late, Refer. Only the
Extenuating Circumstances Panel may grant an extension.
YES X
NO
UNDERGRADUATE
ASSIGNMENT
SPECIFICATION
2
Learning Outcomes tested
(from module syllabus)
Assessment Criteria To achieve each outcome a
student must demonstrate the ability to:
1. Evidence understanding of Information technology
and its application to “real life”
2. Demonstrate understanding of the relationships
between theoretical and practical applications of
information technology
• Assess the importance of IT in organisations as a
store for data, information and knowledge
• Discuss the different social contexts and
stakeholder perspectives of IT
• Understand the relationship between IT and process
change within organisations
• Explain how IT contributes to the management of
knowledge within organisations
• Analyse how interactions with customers and
external parties can be managed using IT
3
Smartville
Assignment Type: Individual Report – 75%
Mercedes-Benz car manufacturers have plants in many countries including one in France, Hambach in a
factory named Smartville. They assemble several models of Smart cars from parts imported from the head
office in India and also obtained from their partner manufacturing organisations in France. Complete cars
are then shipped to car dealerships; they do not sell cars to individual customers.
The Smart production site in Hambach (France) with its 2,000 workers is among the most modern automobile
production plants. It has been built for 450 million Euros and has started production in 1998. In order to
achieve optimized production processes the plant is arranged in ...
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
1. Read the story first.2. Bold Face TermsMake a separate lAbbyWhyte974
1. Read the story first.
2. Bold Face Terms:
Make a separate list of all the definitions of the bold face terms in the story first from your reference sources like a medical dictionary or website etc.
Start by listing all the bold face medical terms and their definitions and cite your sources of reference. Example: appendectomy: the surgical excision of the organ known as the appendix which is a vestigial organ (Webster, 2010)
Then list all your full references at the bottom of your work.
Submit this list as part of your work.
3. Translate definitions into simple terms and insert them into the story:
Next, translate all of the bold faced medical terms into simple language as if you are explaining it to a patient or to someone who may not understand medical terminology and incorporate these simple translations into your story.
This means you should remove the actual medical terms in bold face print but leave the meaning in place with your translated explanations of these terms.
Your finished work should be easily understood. It is OK to alter the sentence structure to accomodate your translations.
Remember to use simple basic language to explain these complicated medical terms to another person.
Highlight your new translation either by bold facing or capitalizing the words.
Do not just insert the definitions. You will not get credit for this and points will be taken off.
The goal here is for you to learn how make the complicated sound simple.
Example:
Initial sentence with medical term in place: The patient is having an appendectomy.
Translation into simple terms in your story: The patient is have his appendix cut out and removed.
In other words, rewrite the story completely in layman's terms or plain English so that someone without a medical or science background would be able to understand.
Your translation must be clear and easy to understand.
Take into account the context of how the terms were used.
You must use all the bold faced terms "translated meanings" in your story.
So when you are complete you will have a list of terms plus definitions (with sources cited) plus a rewritten story in plain English.
4. Submitting Your Completed Work:
Submit your work on a Microsoft Word document using the attachment tool.
Submit all work as one WORD document.. Your file name should end in .doc or .docx or you can use a plain text file format ending in .rtf
If unsure how to do this please contact tech support.
Include your list of definitions and your translated story and your references.
Be sure to run a spell check on your work before submitting.
If you have any difficulty using the attachment tool please call tech support for help.
Exams may be worked on any time during the week but must be submitted on or before the due date.
Submit your exam by clicking on the title of this section "Exam I -Due..." then scroll to the bottom of the page to submit your work.
Exam 2 – part 1
Morticia was particularly interested in entering cosmetolog ...
1. PURPOSE To document and evaluate teaching skills necessary toAbbyWhyte974
1. PURPOSE: To document and evaluate teaching skills necessary to provide teaching to an individual client with a demonstrated need.
With the completion of this assignment the student will be able to achieve the following objectives.
a. Demonstrate ability to thoroughly assess the learning styles of an individual or family using given developmental or cultural models.
b. Demonstrate ability to anticipate learning needs based on developmental or cultural assessments.
c. Identify and utilize teaching/learning principles to facilitate achievement of learning goals and outcomes.
d. Select and prioritize learning strategies based on the developmental or cultural assessment to achieve learning goals and outcomes.
e. Support rationales for teaching plan using teaching and learning theories from required readings with references
2. NURSING COMPETENCIES:
a. Assessing and identifying developmental, cultural, and socioeconomic factors affecting a client.
b. Providing evidence-based health information and teaching based on developmental, cultural, and socioeconomic factors affecting a client or family
c. Integrating teaching/learning activities into client interactions based on developmental, cultural, and socioeconomic factors affecting a client or family.
d. Incorporating health promotion and teaching into the plan of care based on developmental, cultural, and socioeconomic factors affecting a family or client.
3. PLAN: submitted to the clinical instructor during the teaching experience. Your clinical instructor must approve the topic.
a. Develop nursing diagnosis (NANDA)
b. Develop two (2) learning objectives
c. State methodology (teaching methods)
d. Provide and utilize teaching aids e)
e. State needed resources
4. This write-up should be 2-3 pages to follow the Teaching Experience Rubric.
5. SUGGESTED TOPICS FOR TEACHING PLAN:
a. Mother’s with infants who have hyperbilirubinemia
b. Maternal and neonatal infection
c. Care of the Mother and Infant with Substance Abuse Problems
d. Immunization schedule for the newborn
e. Newborn care
f. Post op cesarean section care
g. Post vaginal delivery care
h. Breastfeeding
Course Number and Name
Course: NURS 316L
TEACHING EXPERIENCE PROJECT GUIDELINES & RUBRIC
i. Postpartum depression
Revision Date: Month, Year (i.e. February, 2010) Page 1
Page 1 of 3
TEACHING EXPERIENCE RUBRIC
NAME: DATE:
TOPIC:COURSE:
START TIME: END TIME:
Criteria
4
3
2
1-0
Score
Comprehensive
Assessment
· Clear and concise
discussion of patient’s admission diagnosis, demographic data,
and anticipated learning needs
· Clear and comprehensive patient assessment data to support a deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and anticipated learning needs.
· Vague and incomplete patient assessment data to support deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and antici ...
1. Rate yourself according to your confidence level performing theAbbyWhyte974
1. Rate yourself according to your confidence level performing the skills identified in the Clinical Skills Self-Assessment Form.
2. Based on your ratings, summarize your strengths and opportunities for improvement.
3. Based on your self-assessment and theory of nursing practice, develop four (4) measurable goals and objectives for a practicum experience.
4. Include them on the designated area of the form.
Self-Assessment Form
Desired Clinical Skills for Students to Achieve
Confident (Can complete independently)
Mostly confident (Can complete with supervision)
Beginning (Have performed with supervision or needs supervision to feel confident)
New (Have never performed or does not apply)
Comprehensive psychiatric evaluation skills in:
Recognizing clinical signs and symptoms of psychiatric illness across the lifespan
X
Differentiating between pathophysiological and psychopathological conditions
X
Performing and interpreting a comprehensive and/or interval history and physical examination (including laboratory and diagnostic studies)
X
Performing and interpreting a mental status examination
X
Performing and interpreting a psychosocial assessment and family psychiatric history
X
Performing and interpreting a functional assessment (activities of daily living, occupational, social, leisure, educational).
X
Diagnostic reasoning skill in:
Developing and prioritizing a differential diagnoses list
X
Formulating diagnoses according to DSM 5 based on assessment data
X
Differentiating between normal/abnormal age-related physiological and psychological symptoms/changes
X
Pharmacotherapeutic skills in:
Selecting appropriate evidence based clinical practice guidelines for medication plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management)
X
Evaluating patient response and modify plan as necessary
X
Documenting (e.g., adverse reaction, the patient response, changes to the plan of care)
X
Psychotherapeutic Treatment Planning:
Recognizes concepts of therapeutic modalities across the lifespan
X
Selecting appropriate evidence based clinical practice guidelines for psychotherapeutic plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management, modality appropriate for situation)
X
Applies age appropriate psychotherapeutic counseling techniques with individuals and/or any caregivers
X
Develop an age appropriate individualized plan of care
X
Provide psychoeducation to individuals and/or any caregivers
X
Promote health and disease prevention techniques
X
Self-assessment skill:
Develop SMART goals for practicum experiences
X
Evaluating outcomes of practicum goals and modify plan as necessary
X
Documenting and reflecting on learning experiences
X
Professional skills:
Maintains professional boundaries and thera ...
1. President William McKinley, letter to Congress, April 25, 1898.AbbyWhyte974
1. President William McKinley, letter to Congress, April 25, 1898.
[I took action] under the joint resolution approved April 20, 1898, "for the recognition of the independence of the people of Cuba, demanding that the Government of Spain relinquish its authority and Government in the island of Cuba, and to withdraw its land and naval forces from Cuba and Cuban waters…"
…The Government of Spain…responds by treating the reasonable demands of this Government as measures of hostility, following with that instant and complete severance of relations by its action which by the usage of nations accompanies an existent state of war between sovereign powers.
I now recommend the adoption of a joint resolution declaring that a state of war exists between the United States of America and the Kingdom of Spain…
2. Teller Amendment, Adopted by the Senate, April 19, 1898
[The United States] hereby disclaims any disposition of intention to exercise sovereignty, jurisdiction, or control over said island except for pacification thereof, and asserts its determination, when that is accomplished, to leave the government and control of the island to its people.
3. Senator Alfred Beveridge (R-Indiana), in Congress, January 9, 1900.
. . . [J]ust beyond the Philippines are China's illimitable markets. . . We will not renounce our part in the mission of our race, trustee of God, of the civilization of the world. . . Where shall we turn for consumers of our surplus?. . . China is our natural customer. . . [England, Germany and Russia] have moved nearer to China by securing permanent bases on her borders. The Philippines gives us a base at the door of all the East. . .
They [the Filipinos] are a barbarous race, modified by three centuries of contact with a decadent race [the Spanish]. . . It is barely possible that 1,000 men in all the archipelago are capable of self-government in the Anglo-Saxon sense. . .
The Declaration [of Independence] applies only to people capable of self-government. How dare any man prostitute this expression of the very elect of self-government peoples to a race of Malay children of barbarism, schooled in Spanish methods and ideas? And you, who say the Declaration applies to all men, how dare you deny its application to the American Indian? And if you deny it to the Indian at home, how dare you grant it to the Malay abroad.
4. President Woodrow Wilson, War Message to Congress, 1917
The Imperial German Government [announced that] it was its purpose to put aside all restraints of law or of humanity and use its submarines to sink every vessel that sought to approach either the ports of Great Britain and Ireland or the western coasts of Europe or any of the ports controlled by the enemies of Germany within the Mediterranean.…
It is a war against all nations. American ships have been sunk, American lives taken, in ways which it has stirred us very deeply to learn of, but the ships and people of other neutral and friendly nations have been sunk and ...
1. Prof. Lennart Van der Zeil’s theorem says that any programming AbbyWhyte974
1. Prof. Lennart Van der Zeil’s theorem says that any programming language is complete if it can be used to write a program to compute any computable number.
a. What is a computable number?
b. What is a non-computable number?
c. If all existing programming languages are complete why do we need more than one?
2. Two methodologies are used to transform programs written in a source language (also known as a programmer-oriented language, or a horizontal language, or a high-level language) into a target language (also known as a machine language, or a vertical language, or a low-level language). There is a static method called translation and a dynamic method called interpretation. Yet FORTRAN while 98% static ., uses interpretation for the Formatted I/O statement, similarly COBOL uses interpretation for the MOVE and MOVE CORRESPONDING statements; on the other hand, Java is fully interpretative except that in some programs and certain data sets it may invoke a JIT (Just In Time) compiler to execute a bit of static code. Why do language designers mix these modalities if either is complete? Hint: This is a long question with a short answer.
3. C and C++ store numerical arrays (matrices) in row major order and each index range must begin with 0; whereas FORTRAN stores arrays in column major order and the (default) index range starts (almost always) with 1. Engineers and scientists are often faced with the problem of converting a working program, or much more often a subroutine, from one language to another. Unfortunately, due to the index range difference (0 to n-1) in C/C++ and (1 to N) in FORTRAN, viewing one array as simply the transpose of the other will not suffice. What steps would you take to convert such a subroutine to compute the product of two matrices A(N,M) and B(M,N) to produce C(N,N) from FORTRAN to C++?
4. What was the major reason Jim Gosling invented Java? Did he succeed?
5. What are the four major features of C++ that were eliminated in Java? Why were they taken out? Why do we not miss them?
6. What was Kim Polese’ role at SUN Microsystems and why did she think Java should be positioned as a general purpose computer programming language? How did she accomplish this truly incredible feat, not done since Captain (later Admiral) Grace Murray Hopper, USN standardized COBOL in the early 1960s.
7. Describe briefly the role of women in the development of computer programming and computer programming languages. (Ada Lovelace, Betty Holberton, Grace Hopper, Mandaly Grems, Kim Polese, Laura Lemay)
8. What are the pros and cons of overloaded operators in C++? Java has only one, what is it?
9. State your own arguments for allowing mixed mode arithmetic statements. (See Ch 7)
10. What is BNF and why are meta-languages like BNF and EBNF used?
...
1. Preparing for assessment. DateWeek 3Session titlePrAbbyWhyte974
1. Preparing for assessment.
Date
Week 3
Session title
Preparing for assessments
Content covered
Have enough knowledge on the university assessments before you start doing it.
Comments on readings/practice.
Making study plan and Managing time are the best method to have the peace of mind.
Most interesting points
Feeling organised when finish multiple assessments in the right time.
Most difficult points
Reading the academic articles and find the relative information that supports my topic, How to discuss more in depth.
· Introduction
The above session provided the best academic and coordination skills by explained the multiple essential tips of preparing properly for the assessments and considering the times determinant, which encouraged me to think and write professionally.
· Reflection Discussion on the study plan for assessments
As the English language is my second tongue, I have faced many difficulties with reading and writing academic articles. I found the above topic has a significant impact positively to prepare my assessments in advance, especially when it displays at the beginning of my first semester in the university. However, an ongoing experience on what I gained from this session has a huge impact on me. For instance, after this session, I organised a table that shows each type of the assessments separately, and each one has its basics and elements in its allotted box. As a result, while I’m doing my estimates, I refer to my table and find my structures ready, which helps me seize the time and be more skilled.
· Reflection Discussion on prepare well for my assessments.
As I'm in my first year at the university, I thought there was no need to have an entire assessments plan. Later on, I noticed that working on assessments without organising a plan affects the whole semester assessments, which might cause time conflict in the Assignments due date. I wasn't aware of how important it is the preparing and reading enough sources before start writing. However, Glancing and reading enough information can convert the assessment from stress work to exciting work, which will help set the scene and allow me to think critically and write academically. Based on the benefits that I acquired from the session, the critical thinking and in depth discussion in a particular topic will need to be supported by academic information from reading more articles and spend more time on this part of the work. After this session, I became able to organise my assessments, which allow me to have enough time to working on them and preventing some of the study stresses and cramming. Also, I have been able to take a period to refresh my mind and get my memory retention. However, there is no doubt that it encouraged me to provide the work in a prime manner. This experience will be beneficial in my subsequent semesters to develop my ability to be further organised in my study and aware of how to prepare before the assessments.
Conclusion
...
1. Project Description Definition of ProjectThe supervision of wAbbyWhyte974
1. Project Description Definition of Project
The supervision of workers' operations or corporate functions is difficult work for the administrative environment. Modern frameworks have certain limitations in the implementation of integrated workforce control functions. This project aims to improve the structure of EMS (employee management system). The new framework helps administrators to trace staff profiles, particularly their tasks, and it will capture the present position. The accompanying boss forecasts the workforce requirements by detailed information of workers and plans a valid timeline for each employee to reduce the difficulties of collaborative working. This project focuses on developing a user-friendly interface that helps supervisors reliably collect or store information for workers (Abdulhamid, Dada, & Ajibuwa, 2019).
2. Plan scale, deliverables, and outcomes
This project has a high scope since many companies compete for previous techniques to monitor employee records, but face challenges with data quality and human-made errors. EMS enables organizations to capture, store and exchange the details needed about current and recently entered staff. The present state of the delegated activities of workers would inevitably be monitored by employee supervision and their responsibilities would also be mainly helpful. Through the use of the EMS framework, quality control levels will ultimately be possible to delegate workers the correct stress and improve employee loyalty. The corporation would raise employee engagement rates, which would also increase group morale and person efficiency (Abdulhamid, Dada, & Ajibuwa, 2019).
3. The Project Limitations
Two main limitations, such as effort and money, have been faced throughout the project implementation period. For this sort of IT project, capital resources are important since it incorporates certain hardware and software requirements in the procurement and the project faces difficulties throughout the development process owing to proper evaluation on a budget schedule. Time is another requirement for this project. Any project mission has to be accomplished within a very limited time but job-related problems have been induced by a combination of vacations and the shortage of project participants due to sickness. However, this project was performed using productive management techniques, which collaborated in collaboration for the successful coordination and communication of the project (Denney, 2020).
4. Recommendation of Project
This initiative is about handling and tracking staff, so privacy and protection are the two main employee issues. EMS shops or collect all workers' employee records. This means that owing to certain software fixes or gaps, security attacks such as ransomware, insider attacks, and unauthorized entry, security safety is a high priority of this initiative. So, in this project, I would like to see certain improvements, first of all, I would suggest gaining some financia ...
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
1. Read the story first.2. Bold Face TermsMake a separate lAbbyWhyte974
1. Read the story first.
2. Bold Face Terms:
Make a separate list of all the definitions of the bold face terms in the story first from your reference sources like a medical dictionary or website etc.
Start by listing all the bold face medical terms and their definitions and cite your sources of reference. Example: appendectomy: the surgical excision of the organ known as the appendix which is a vestigial organ (Webster, 2010)
Then list all your full references at the bottom of your work.
Submit this list as part of your work.
3. Translate definitions into simple terms and insert them into the story:
Next, translate all of the bold faced medical terms into simple language as if you are explaining it to a patient or to someone who may not understand medical terminology and incorporate these simple translations into your story.
This means you should remove the actual medical terms in bold face print but leave the meaning in place with your translated explanations of these terms.
Your finished work should be easily understood. It is OK to alter the sentence structure to accomodate your translations.
Remember to use simple basic language to explain these complicated medical terms to another person.
Highlight your new translation either by bold facing or capitalizing the words.
Do not just insert the definitions. You will not get credit for this and points will be taken off.
The goal here is for you to learn how make the complicated sound simple.
Example:
Initial sentence with medical term in place: The patient is having an appendectomy.
Translation into simple terms in your story: The patient is have his appendix cut out and removed.
In other words, rewrite the story completely in layman's terms or plain English so that someone without a medical or science background would be able to understand.
Your translation must be clear and easy to understand.
Take into account the context of how the terms were used.
You must use all the bold faced terms "translated meanings" in your story.
So when you are complete you will have a list of terms plus definitions (with sources cited) plus a rewritten story in plain English.
4. Submitting Your Completed Work:
Submit your work on a Microsoft Word document using the attachment tool.
Submit all work as one WORD document.. Your file name should end in .doc or .docx or you can use a plain text file format ending in .rtf
If unsure how to do this please contact tech support.
Include your list of definitions and your translated story and your references.
Be sure to run a spell check on your work before submitting.
If you have any difficulty using the attachment tool please call tech support for help.
Exams may be worked on any time during the week but must be submitted on or before the due date.
Submit your exam by clicking on the title of this section "Exam I -Due..." then scroll to the bottom of the page to submit your work.
Exam 2 – part 1
Morticia was particularly interested in entering cosmetolog ...
1. PURPOSE To document and evaluate teaching skills necessary toAbbyWhyte974
1. PURPOSE: To document and evaluate teaching skills necessary to provide teaching to an individual client with a demonstrated need.
With the completion of this assignment the student will be able to achieve the following objectives.
a. Demonstrate ability to thoroughly assess the learning styles of an individual or family using given developmental or cultural models.
b. Demonstrate ability to anticipate learning needs based on developmental or cultural assessments.
c. Identify and utilize teaching/learning principles to facilitate achievement of learning goals and outcomes.
d. Select and prioritize learning strategies based on the developmental or cultural assessment to achieve learning goals and outcomes.
e. Support rationales for teaching plan using teaching and learning theories from required readings with references
2. NURSING COMPETENCIES:
a. Assessing and identifying developmental, cultural, and socioeconomic factors affecting a client.
b. Providing evidence-based health information and teaching based on developmental, cultural, and socioeconomic factors affecting a client or family
c. Integrating teaching/learning activities into client interactions based on developmental, cultural, and socioeconomic factors affecting a client or family.
d. Incorporating health promotion and teaching into the plan of care based on developmental, cultural, and socioeconomic factors affecting a family or client.
3. PLAN: submitted to the clinical instructor during the teaching experience. Your clinical instructor must approve the topic.
a. Develop nursing diagnosis (NANDA)
b. Develop two (2) learning objectives
c. State methodology (teaching methods)
d. Provide and utilize teaching aids e)
e. State needed resources
4. This write-up should be 2-3 pages to follow the Teaching Experience Rubric.
5. SUGGESTED TOPICS FOR TEACHING PLAN:
a. Mother’s with infants who have hyperbilirubinemia
b. Maternal and neonatal infection
c. Care of the Mother and Infant with Substance Abuse Problems
d. Immunization schedule for the newborn
e. Newborn care
f. Post op cesarean section care
g. Post vaginal delivery care
h. Breastfeeding
Course Number and Name
Course: NURS 316L
TEACHING EXPERIENCE PROJECT GUIDELINES & RUBRIC
i. Postpartum depression
Revision Date: Month, Year (i.e. February, 2010) Page 1
Page 1 of 3
TEACHING EXPERIENCE RUBRIC
NAME: DATE:
TOPIC:COURSE:
START TIME: END TIME:
Criteria
4
3
2
1-0
Score
Comprehensive
Assessment
· Clear and concise
discussion of patient’s admission diagnosis, demographic data,
and anticipated learning needs
· Clear and comprehensive patient assessment data to support a deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and anticipated learning needs.
· Vague and incomplete patient assessment data to support deficient knowledge nursing diagnosis.
· Vague and incomplete discussion of patient’s admission diagnosis, demographic data, and antici ...
1. Rate yourself according to your confidence level performing theAbbyWhyte974
1. Rate yourself according to your confidence level performing the skills identified in the Clinical Skills Self-Assessment Form.
2. Based on your ratings, summarize your strengths and opportunities for improvement.
3. Based on your self-assessment and theory of nursing practice, develop four (4) measurable goals and objectives for a practicum experience.
4. Include them on the designated area of the form.
Self-Assessment Form
Desired Clinical Skills for Students to Achieve
Confident (Can complete independently)
Mostly confident (Can complete with supervision)
Beginning (Have performed with supervision or needs supervision to feel confident)
New (Have never performed or does not apply)
Comprehensive psychiatric evaluation skills in:
Recognizing clinical signs and symptoms of psychiatric illness across the lifespan
X
Differentiating between pathophysiological and psychopathological conditions
X
Performing and interpreting a comprehensive and/or interval history and physical examination (including laboratory and diagnostic studies)
X
Performing and interpreting a mental status examination
X
Performing and interpreting a psychosocial assessment and family psychiatric history
X
Performing and interpreting a functional assessment (activities of daily living, occupational, social, leisure, educational).
X
Diagnostic reasoning skill in:
Developing and prioritizing a differential diagnoses list
X
Formulating diagnoses according to DSM 5 based on assessment data
X
Differentiating between normal/abnormal age-related physiological and psychological symptoms/changes
X
Pharmacotherapeutic skills in:
Selecting appropriate evidence based clinical practice guidelines for medication plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management)
X
Evaluating patient response and modify plan as necessary
X
Documenting (e.g., adverse reaction, the patient response, changes to the plan of care)
X
Psychotherapeutic Treatment Planning:
Recognizes concepts of therapeutic modalities across the lifespan
X
Selecting appropriate evidence based clinical practice guidelines for psychotherapeutic plan (e.g., risk/benefit, patient preference, developmental considerations, financial, the process of informed consent, symptom management, modality appropriate for situation)
X
Applies age appropriate psychotherapeutic counseling techniques with individuals and/or any caregivers
X
Develop an age appropriate individualized plan of care
X
Provide psychoeducation to individuals and/or any caregivers
X
Promote health and disease prevention techniques
X
Self-assessment skill:
Develop SMART goals for practicum experiences
X
Evaluating outcomes of practicum goals and modify plan as necessary
X
Documenting and reflecting on learning experiences
X
Professional skills:
Maintains professional boundaries and thera ...
1. President William McKinley, letter to Congress, April 25, 1898.AbbyWhyte974
1. President William McKinley, letter to Congress, April 25, 1898.
[I took action] under the joint resolution approved April 20, 1898, "for the recognition of the independence of the people of Cuba, demanding that the Government of Spain relinquish its authority and Government in the island of Cuba, and to withdraw its land and naval forces from Cuba and Cuban waters…"
…The Government of Spain…responds by treating the reasonable demands of this Government as measures of hostility, following with that instant and complete severance of relations by its action which by the usage of nations accompanies an existent state of war between sovereign powers.
I now recommend the adoption of a joint resolution declaring that a state of war exists between the United States of America and the Kingdom of Spain…
2. Teller Amendment, Adopted by the Senate, April 19, 1898
[The United States] hereby disclaims any disposition of intention to exercise sovereignty, jurisdiction, or control over said island except for pacification thereof, and asserts its determination, when that is accomplished, to leave the government and control of the island to its people.
3. Senator Alfred Beveridge (R-Indiana), in Congress, January 9, 1900.
. . . [J]ust beyond the Philippines are China's illimitable markets. . . We will not renounce our part in the mission of our race, trustee of God, of the civilization of the world. . . Where shall we turn for consumers of our surplus?. . . China is our natural customer. . . [England, Germany and Russia] have moved nearer to China by securing permanent bases on her borders. The Philippines gives us a base at the door of all the East. . .
They [the Filipinos] are a barbarous race, modified by three centuries of contact with a decadent race [the Spanish]. . . It is barely possible that 1,000 men in all the archipelago are capable of self-government in the Anglo-Saxon sense. . .
The Declaration [of Independence] applies only to people capable of self-government. How dare any man prostitute this expression of the very elect of self-government peoples to a race of Malay children of barbarism, schooled in Spanish methods and ideas? And you, who say the Declaration applies to all men, how dare you deny its application to the American Indian? And if you deny it to the Indian at home, how dare you grant it to the Malay abroad.
4. President Woodrow Wilson, War Message to Congress, 1917
The Imperial German Government [announced that] it was its purpose to put aside all restraints of law or of humanity and use its submarines to sink every vessel that sought to approach either the ports of Great Britain and Ireland or the western coasts of Europe or any of the ports controlled by the enemies of Germany within the Mediterranean.…
It is a war against all nations. American ships have been sunk, American lives taken, in ways which it has stirred us very deeply to learn of, but the ships and people of other neutral and friendly nations have been sunk and ...
1. Prof. Lennart Van der Zeil’s theorem says that any programming AbbyWhyte974
1. Prof. Lennart Van der Zeil’s theorem says that any programming language is complete if it can be used to write a program to compute any computable number.
a. What is a computable number?
b. What is a non-computable number?
c. If all existing programming languages are complete why do we need more than one?
2. Two methodologies are used to transform programs written in a source language (also known as a programmer-oriented language, or a horizontal language, or a high-level language) into a target language (also known as a machine language, or a vertical language, or a low-level language). There is a static method called translation and a dynamic method called interpretation. Yet FORTRAN while 98% static ., uses interpretation for the Formatted I/O statement, similarly COBOL uses interpretation for the MOVE and MOVE CORRESPONDING statements; on the other hand, Java is fully interpretative except that in some programs and certain data sets it may invoke a JIT (Just In Time) compiler to execute a bit of static code. Why do language designers mix these modalities if either is complete? Hint: This is a long question with a short answer.
3. C and C++ store numerical arrays (matrices) in row major order and each index range must begin with 0; whereas FORTRAN stores arrays in column major order and the (default) index range starts (almost always) with 1. Engineers and scientists are often faced with the problem of converting a working program, or much more often a subroutine, from one language to another. Unfortunately, due to the index range difference (0 to n-1) in C/C++ and (1 to N) in FORTRAN, viewing one array as simply the transpose of the other will not suffice. What steps would you take to convert such a subroutine to compute the product of two matrices A(N,M) and B(M,N) to produce C(N,N) from FORTRAN to C++?
4. What was the major reason Jim Gosling invented Java? Did he succeed?
5. What are the four major features of C++ that were eliminated in Java? Why were they taken out? Why do we not miss them?
6. What was Kim Polese’ role at SUN Microsystems and why did she think Java should be positioned as a general purpose computer programming language? How did she accomplish this truly incredible feat, not done since Captain (later Admiral) Grace Murray Hopper, USN standardized COBOL in the early 1960s.
7. Describe briefly the role of women in the development of computer programming and computer programming languages. (Ada Lovelace, Betty Holberton, Grace Hopper, Mandaly Grems, Kim Polese, Laura Lemay)
8. What are the pros and cons of overloaded operators in C++? Java has only one, what is it?
9. State your own arguments for allowing mixed mode arithmetic statements. (See Ch 7)
10. What is BNF and why are meta-languages like BNF and EBNF used?
...
1. Preparing for assessment. DateWeek 3Session titlePrAbbyWhyte974
1. Preparing for assessment.
Date
Week 3
Session title
Preparing for assessments
Content covered
Have enough knowledge on the university assessments before you start doing it.
Comments on readings/practice.
Making study plan and Managing time are the best method to have the peace of mind.
Most interesting points
Feeling organised when finish multiple assessments in the right time.
Most difficult points
Reading the academic articles and find the relative information that supports my topic, How to discuss more in depth.
· Introduction
The above session provided the best academic and coordination skills by explained the multiple essential tips of preparing properly for the assessments and considering the times determinant, which encouraged me to think and write professionally.
· Reflection Discussion on the study plan for assessments
As the English language is my second tongue, I have faced many difficulties with reading and writing academic articles. I found the above topic has a significant impact positively to prepare my assessments in advance, especially when it displays at the beginning of my first semester in the university. However, an ongoing experience on what I gained from this session has a huge impact on me. For instance, after this session, I organised a table that shows each type of the assessments separately, and each one has its basics and elements in its allotted box. As a result, while I’m doing my estimates, I refer to my table and find my structures ready, which helps me seize the time and be more skilled.
· Reflection Discussion on prepare well for my assessments.
As I'm in my first year at the university, I thought there was no need to have an entire assessments plan. Later on, I noticed that working on assessments without organising a plan affects the whole semester assessments, which might cause time conflict in the Assignments due date. I wasn't aware of how important it is the preparing and reading enough sources before start writing. However, Glancing and reading enough information can convert the assessment from stress work to exciting work, which will help set the scene and allow me to think critically and write academically. Based on the benefits that I acquired from the session, the critical thinking and in depth discussion in a particular topic will need to be supported by academic information from reading more articles and spend more time on this part of the work. After this session, I became able to organise my assessments, which allow me to have enough time to working on them and preventing some of the study stresses and cramming. Also, I have been able to take a period to refresh my mind and get my memory retention. However, there is no doubt that it encouraged me to provide the work in a prime manner. This experience will be beneficial in my subsequent semesters to develop my ability to be further organised in my study and aware of how to prepare before the assessments.
Conclusion
...
1. Project Description Definition of ProjectThe supervision of wAbbyWhyte974
1. Project Description Definition of Project
The supervision of workers' operations or corporate functions is difficult work for the administrative environment. Modern frameworks have certain limitations in the implementation of integrated workforce control functions. This project aims to improve the structure of EMS (employee management system). The new framework helps administrators to trace staff profiles, particularly their tasks, and it will capture the present position. The accompanying boss forecasts the workforce requirements by detailed information of workers and plans a valid timeline for each employee to reduce the difficulties of collaborative working. This project focuses on developing a user-friendly interface that helps supervisors reliably collect or store information for workers (Abdulhamid, Dada, & Ajibuwa, 2019).
2. Plan scale, deliverables, and outcomes
This project has a high scope since many companies compete for previous techniques to monitor employee records, but face challenges with data quality and human-made errors. EMS enables organizations to capture, store and exchange the details needed about current and recently entered staff. The present state of the delegated activities of workers would inevitably be monitored by employee supervision and their responsibilities would also be mainly helpful. Through the use of the EMS framework, quality control levels will ultimately be possible to delegate workers the correct stress and improve employee loyalty. The corporation would raise employee engagement rates, which would also increase group morale and person efficiency (Abdulhamid, Dada, & Ajibuwa, 2019).
3. The Project Limitations
Two main limitations, such as effort and money, have been faced throughout the project implementation period. For this sort of IT project, capital resources are important since it incorporates certain hardware and software requirements in the procurement and the project faces difficulties throughout the development process owing to proper evaluation on a budget schedule. Time is another requirement for this project. Any project mission has to be accomplished within a very limited time but job-related problems have been induced by a combination of vacations and the shortage of project participants due to sickness. However, this project was performed using productive management techniques, which collaborated in collaboration for the successful coordination and communication of the project (Denney, 2020).
4. Recommendation of Project
This initiative is about handling and tracking staff, so privacy and protection are the two main employee issues. EMS shops or collect all workers' employee records. This means that owing to certain software fixes or gaps, security attacks such as ransomware, insider attacks, and unauthorized entry, security safety is a high priority of this initiative. So, in this project, I would like to see certain improvements, first of all, I would suggest gaining some financia ...
1. Project Description Definition of ProjectThe supervision of w
1 Programme BABS Module Level (3,4,5 or 6) 4 Mo
1. 1
Programme: BABS Module Level (3,4,5 or 6): 4
Module: Managing Information and
Technology
Module code: SBLC4001
Contribution to Overall
Module Assessment (%):
75% Assignment No(s): 1
Referencing: In the main body of your submission you must
give credit to authors on whose research your
work is based. Append to your submission a reference list that
indicates the books, articles, etc.
that you have read or quoted in order to complete this
assignment (e.g. for books: surname of
author and initials, year of publication, title of book, edition,
publisher: place of publication).
Disclosure: Please include the following statement on the title
page of the submitted assignment, followed
by your name:
2. I declare that this assignment is all my own work and that I
have acknowledged all materials
used from the published or unpublished works of other people.
All references have been duly
cited.
Turnitin: All assignments must be submitted to Turnitin unless
otherwise instructed by the Lecturer.
Note: the Turnitin version is the primary submission and acts as
a receipt for the student. Late
submission of the electronic version of the assignment will
result in a late penalty mark. Penalties for
late submission: Up to one weeks late, maximum mark of 50%.
Over one week late, Refer. Only the
Extenuating Circumstances Panel may grant an extension.
YES X
NO
UNDERGRADUATE
ASSIGNMENT
SPECIFICATION
2
Learning Outcomes tested
(from module syllabus)
Assessment Criteria To achieve each outcome a
3. student must demonstrate the ability to:
1. Evidence understanding of Information technology
and its application to “real life”
2. Demonstrate understanding of the relationships
between theoretical and practical applications of
information technology
• Assess the importance of IT in organisations as a
store for data, information and knowledge
• Discuss the different social contexts and
stakeholder perspectives of IT
• Understand the relationship between IT and process
change within organisations
• Explain how IT contributes to the management of
knowledge within organisations
• Analyse how interactions with customers and
external parties can be managed using IT
3
Smartville
Assignment Type: Individual Report – 75%
4. Mercedes-Benz car manufacturers have plants in many countries
including one in France, Hambach in a
factory named Smartville. They assemble several models of
Smart cars from parts imported from the head
office in India and also obtained from their partner
manufacturing organisations in France. Complete cars
are then shipped to car dealerships; they do not sell cars to
individual customers.
The Smart production site in Hambach (France) with its 2,000
workers is among the most modern automobile
production plants. It has been built for 450 million Euros and
has started production in 1998. In order to
achieve optimized production processes the plant is arranged in
the shape of a cross; in each of its four
extensions different assembly works are provided. The centre,
the so-called market place, serves as a test
room for completed vehicles and for refinishing operations. The
centre is multi-storied; thereby all the
administrative, IT and changing rooms could be implemented in
one central place.
Smartville, like other plants in the rest of the world, are
technology based and they make full use of the
relevant information/enterprise systems. The senior management
at Smartville are mostly from India and
the middle management consists of a mix of Indian and French
managers; other staff are hired from the local
community in France.
The above is a very brief description of Smartville. In this
5. scenario, you are not required to know how
Smartville operates or what their policies or decision-making
processes are. However, you are required to
write a report including the points provided below, based on the
above broad scenario, providing your
opinions based on the knowledge and research that you acquired
through the study of this module using
Harvard Reference Style.
As a consultant, you are required to write a report about
Smartville including the below points:
• THREE (3) relevant information systems (IS) that, in your
opinion, form the core of Smartville
business. Provide a brief summary of the general purpose of
each of these IS.
• Michael Porter suggests that two generally accepted strategies
organisations often adopt are: cost
leadership and differentiation. Discuss what these strategies are
and make a judgement as to which
of these would be more appropriate for Smartville - explain
reasons for your choice.
• It is important that data kept within an organisation remains
accurate, private and confidential. If any
data within Smartville gets stolen or compromised, discuss
whether the situation would fall under
the Data Protection Act. Mention THREE (3) core aspects of the
relevant Act.
6. TASK DESCRIPTION – ASSIGNMENT 1 – 75%
4
Please note the following when completing your written
assignment:
1. Writing: Written in English in an appropriate
business/academic style
2. Focus: Focus only on the tasks set in the assignment.
3. Length: 3000 Words +/- 10%
4. Formatting: Typed on A4 paper in Times New Roman or
Arial font 12 with at least 2.5 centimetre space at
each edge, double spaced and pages numbered.
5. Document format: Ensure a clear title, course, and name or
ID number is on a cover sheet and a bibliography
using Harvard referencing throughout is also provided.
6. Research: Research should use reliable and relevant sources
of information e.g. academic books and journals
that have been peer reviewed. The research should be extensive.
The use of a range of information sources is expected –
academic books, peer reviewed journal articles, professional
articles, press releases and newspaper articles, reliable
statistics, company annual reports and other company
information. All referencing should be in Harvard style.
FORMATTING AND LAYOUT
7. 5
This section details the assessment criteria. The extent to which
these are demonstrated by you determines your mark. The marks
available for each criterion are shown. Lecturers use a similar
format to comment on the achievement of the task(s), including
those areas in which you have performed well and areas that
would benefit from development/improvement.
Common Assessment Criteria Applied
M
a
rk
s
a
v
a
il
a
b
le
8. M
a
rk
s
A
w
a
rd
e
d
1. Research-informed Literature
Extent of research and/or own reading, selection of credible
sources, application of appropriate referencing conventions.
10
Information Technology is ever changing field. Research here
must be up-to-date. Selection of variety of
sources like latest journals, books etc. are recommended.
2. Knowledge and Understanding of Subject
Extent of knowledge and understanding of concepts and
underlying principles associated with the discipline.
15
9. With respect to the assignment topic, students must have a
sound knowledge and understanding of
different information technology concepts, which can be applied
in their employment.
3. Analysis
Analysis, evaluation and synthesis; logic, argument and
judgement; analytical reflection; organisation of ideas and
evidence
40
Different collaboration technologies must be identified, their
suitability for the current chosen
organisation must be assessed and analysed with logical
arguments and justification
4. Practical Application and Deployment
Deployment of methods, materials, tools and techniques;
application of concepts; formulation of innovative and creative
solutions to solve problems.
25
As Information Technology is more practical based subject,
examples must be provided.
5. Skills for Professional Practice
Attributes in professional practice: individual and collaborative
working; deployment of appropriate media; presentation and
organisation.
10. 10
Report format normally includes the following sections:
Executive
Summary, Introduction, Main Findings, Conclusions,
Recommendations, References and Appendices. Your report
should be written in a suitable academic writing style i.e. using
the
third person.
TOTAL 100
Assignment Mark (Assessment marks are subject to ratification
at the
Exam Board. These comments and marks are to give feedback
on module work
and are for guidance only until they are confirmed. )
Late Submission Penalties (tick if
appropriate)
%
MARKING CRITERIA AND STUDENT FEEDBACK –
ASSIGNMENT 1
6
11. NOTE: The guidance offered below is linked to the five
common assessment criteria above.
1. Research-informed Literature
Your work must be informed and supported by scholarly
material that is relevant to and focused on the task(s) set.
You should provide evidence that you have accessed a wide
range of sources, which may be academic, governmental
and industrial; these sources may include academic journal
articles, textbooks, current news articles, organisational
documents, and websites. You should consider the credibility of
your sources; academic journals are normally highly
credible sources while websites require careful
consideration/selection and should be used sparingly. Any
sources
you use should be current and up-to-date, mostly published
within the last five years or so, though seminal/important
works in the field may be older. You must provide evidence of
your research/own reading throughout your work, using
in-text citations in the main body of your work and a reference
list that is alphabetical at the end of your work. Please
use the Harvard referencing system.
2. Knowledge and Understanding of Subject
Your work must demonstrate the growing extent of your
knowledge and understanding of concepts and underlying
principles associated with the subject area. Knowledge relates
to the facts, information and skills you have acquired
through your learning. You demonstrate your understanding by
interpreting the meaning of the facts and information
(knowledge). This means that you need to select and include in
your work the concepts, techniques, models, theories,
12. etc. appropriate to the task(s) set. You should be able to explain
the theories, concepts, etc. meaningfully to show
your understanding. Your mark/grade will also depend upon the
extent to which you demonstrate your knowledge
and understanding; ideally each should be complete and
detailed, with comprehensive coverage.
3. Analysis
Your work must contain evidence of logical, analytical
thinking, evaluation and synthesis. For example, to examine and
break information down into parts, make inferences, compile,
compare and contrast information. This means not just
describing What! but also justifying: Why? How? When? Who?
Where? At all times, you must provide justification for
your arguments and judgements. Evidence that you have
reflected upon the ideas of others within the subject area is
crucial to you providing a reasoned and informed debate within
your work. Furthermore, you should provide evidence
that you are able to make sound judgements and convincing
arguments using data and concepts. Sound, valid
conclusions are necessary and must be derived from the content
of your work. There should be no new information
presented within your conclusion. Where relevant, alternative
solutions and recommendations may be proposed.
4. Practical Application and Deployment
You should be able to demonstrate how the subject-related
concepts and ideas relate to real world situations or a
particular context. How do they work in practice? You will
deploy models, methods, techniques, and/or theories, in
that context, to assess current situations, perhaps to formulate
plans or solutions to solve problems, some of which
may be innovative and creative. This is likely to involve, for
instance, the use of real world examples and cases, the
13. application of a model within an organisation and/or
benchmarking one organisation against others based on stated
criteria. You should show awareness of the limitations of
concepts and theories when applied in particular contexts.
5. Skills for Professional Practice
Your work must provide evidence of the attributes expected in
professional practice. This includes demonstrating
your individual initiative and/or collaborative working. You
must communicate effectively in a suitable format, which
may be written and/or oral, for example, essay, management
report, presentation. Work should be coherent and well -
structured in presentation and organisation.
GUIDANCE FOR STUDENTS IN THE COMPLETION OF
TASKS
7
UNDERGRADUATE - COMMON ASSESSMENT AND
MARKING CRITERIA
Assessment Criteria
OUTRIGHT FAIL UNSATISFACTORY SATISFACTORY
GOOD VERY GOOD EXCELLENT EXCEPTIONAL
0-29%
15. of sources.
Referencing
conventions used
inconsistently.
References to a
limited range of
mostly relevant
sources. Some
omissions and
minor errors.
Referencing
conventions evident
though not always
applied consistently.
Inclusion of a range
of research-
informed literature,
including sources
retrieved
independently.
Referencing
conventions mostly
consistently applied.
Inclusion of a wide
range of research-
informed literature,
including sources
retrieved
independently.
Selection of relevant
and credible
sources. Very good
use of referencing
16. conventions,
consistently applied.
A comprehensive
range of research
informed literature
embedded in the
work. Excellent
selection of relevant
and credible
sources. High-level
referencing skills,
consistently applied.
Outstanding
knowledge of
research-
informed
and/or own reading,
selection of credible
sources, application of
literature
embedded in
the work.
Outstanding
appropriate referencing
conventions
selection of
relevant and
credible
sources. High-
17. level referencing
skills
consistently and
professionally
applied.
2. Knowledge and
Understanding of
Subject
Major gaps in
knowledge and
understanding of
material at this
level. Substantial
inaccuracies.
Gaps in knowledge,
with only superficial
understanding.
Some significant
Evidence of basic
knowledge and
understanding of
the relevant
Knowledge is
accurate with a
good understanding
of the field of study.
Knowledge is
extensive. Exhibits
understanding of
the breadth and
18. Excellent knowledge
and understanding
of the main
concepts and key
Highly detailed
knowledge and
understanding
of the main
Extent of knowledge and
understanding of
concepts and underlying
inaccuracies. concepts and
underlying
principles.
depth of established
views.
theories. Clear
awareness of
challenges to
established views
theories/concep
ts, and a critical
awareness of
the ambiguities
principles associated
with the discipline.
and the limitations
19. of the knowledge
base.
and limitations
of knowledge.
3. Analysis
Analysis, evaluation and
synthesis; logic,
Unsubstantiated
generalisations,
made without use
of any credible
Some evidence of
analytical
intellectual skills,
but for the most
Evidence of some
logical, analytical
thinking and some
attempts to
Evidence of some
logical, analytical
thinking and
synthesis. Can
Sound, logical,
analytical thinking;
synthesis and
evaluation. Ability
Thoroughly logical
20. work, supported by
evaluated evidence.
High quality
Exceptional
work; judiciously
selected and
evaluated
argument and
judgement; analytical
reflection; organisation
evidence. Lack of
logic, leading to
unsupportable/
missing conclusions.
part descriptive.
Ideas/findings
sometimes illogical
and contradictory.
synthesise, albeit
with some
weaknesses.
Some evidence to
analyse new and/or
abstract data and
situations without
guidance.
to devise and
sustain persuasive
arguments, and to
21. review the
analysis, developed
independently or
through effective
collaboration.
evidence. Very
high quality
analysis,
developed
of ideas and evidence Lack of any attempt
to analyse,
Generalised
statements made
support findings/
views, but evidence
An emerging
awareness of
reliability, validity &
significance of
Ability to investigate
contradictory
independently
or through
synthesise or with scant evidence. not consistently different
stances evidence. Ability to information and effective
evaluate. Conclusions lack interpreted. and ability to use
22. communicate ideas identify reasons for collaboration.
relevance. Some relevant evidence to support and evidence
contradictions. Ability to
conclusions and the argument. accurately and Strong,
persuasive, investigate
recommendations, Valid conclusions convincingly.
conclusions, contradictory
where relevant and Sound, convincing justifiable information
and
recommendations, conclusions / recommendations. identify
reasons
where relevant recommendations. for
contradictions.
Highly
persuasive
conclusions
4. Practical Application Limited or no use of
methods, materials,
tools and/or
techniques.
Little or no
appreciation of the
context of the
application.
Rudimentary
application of
methods, materials,
tools and/or
techniques but
without
consideration and
competence.
Flawed appreciation
of the context of the
23. application.
An adequate
awareness and
mostly appropriate
application of well
established
methods, materials,
tools and/or
techniques.
Basic appreciation
of the context of the
application.
A good and
appropriate
application of
standard methods,
materials, tools
and/or techniques.
Good appreciation
of the context of the
application, with
some use of
examples, where
relevant.
A very good
application of a
range of methods,
materials, tools
and/or techniques.
Very good
consideration of the
context of the
application, with
24. perceptive use of
examples, where
relevant.
Evidence of some
innovation and
creativity.
An advanced
application of a
range of methods,
materials, tools
and/or techniques.
The context of the
application is well
considered, with
extensive use of
relevant examples.
Application and
deployment extend
beyond established
conventions.
Innovation and
creativity evident
throughout.
Outstanding
levels of
application and
deployment
skills.
Assimilation and
development of
cutting edge
processes and
techniques.
25. and Deployment
Effective deployment of
appropriate methods,
materials, tools and
techniques; extent of
skill demonstrated in the
application of concepts
to a variety of processes
and/or contexts;
formulation of innovative
and creative solutions to
solve problems.
5. Skills for Professional Communication
media is
inappropriate or
misapplied.
Little or no evidence
of autonomy in the
completion of tasks.
Work is poorly
structured and/or
largely incoherent.
Media is poorly
designed and/or not
suitable for the
audience.
Poor independent
or collaborative
initiative.
Work lacks
structure,
organisation, and/or
coherence
26. Can communicate in
a suitable format
but with some room
for improvement.
Can work as part of
a team, but with
limited involvement
in group activities.
Work lacks
coherence in places
and could be better
structured.
Can communicate
effectively in a
suitable format, but
may have minor
errors.
Can work effectively
as part of a team,
with clear
contribution to
group activities.
Mostly coherent
work and is in a
suitable structure.
Can communicate
well, confidently
and consistently in a
suitable format.
Can work very well
as part of a team,
with very good
contribution to
27. group activities.
Work is coherent
and fluent and is
well structured and
organised.
Can communicate
professionally and,
confidently in a
suitable format.
Can work
professionally
within a team,
showing leadership
skills as appropriate,
managing conflict
and meeting
obligations.
Work is coherent,
very fluent and is
presented
professionally.
Can
communicate
with an
exceptionally
high level of
professionalism.
Can work
exceptionally
well and
professionally
within a team,
showing
advanced
28. leadership skills.
Work is
exceptionally
coherent, very
fluent and is
presented
professionally.
Practice
Demonstrates attributes
expected in professional
practice including:
individual initiative and
collaborative working;
deployment of
appropriate media to
communicate (including
written and oral); clarity
and effectiveness in
presentation and
organisation.
8
Student Self Evaluation Form
Student name:
Student number:
Programme:
29. Year of
programme
Assignment Title:
This section repeats in brief the common assessment criteria
detailed on previous pages. The extent to which these
are demonstrated by you determines your mark. Using these
criteria, tick the box that best indicates the level of
achievement you feel you have achieved with regard to each of
them. Please note that this self-assessment is used as
a developmental tool only and has no impact on the way in
which your work will be marked.
Common Assessment
Criteria Applied
Level of Achievement
REFER
3rd
2:2
2:1
1st
30. 1st
OUTRIGHT FAIL UNSATISFACTORY SATISFACTORY
GOOD VERY GOOD EXCELLENT EXCEPTIONAL
1. Research-informed
Literature
0-29% 30-39% 40-49% 50-59% 60-69% 70-79% 80-100%
2. Knowledge and
Understanding of
Subject
0-29% 30-39% 40-49% 50-59% 60-69% 70-79% 80-100%
3. Analysis 0-29% 30-39% 40-49% 50-59% 60-69% 70-79% 80-
100%
4. Practical
Application and
Deployment
0-29% 30-39% 40-49% 50-59% 60-69% 70-79% 80-100%
31. 5. Skills for
Professional Practice
0-29% 30-39% 40-49% 50-59% 60-69% 70-79% 80-100%
PLEASE COMMENT ON AREAS IN WHICH YOU FEEL
THAT YOU HAVE PERFORMED WELL
PLEASE COMMENT ON AREAS YOU FEEL THAT YOU
NEED TO DEVELOP
Student’s Name
32. Date
Student’s Signature
Writing the Executive Summary
An executive summary is a brief document typically directed at
top-level managers who sometimes make decisions based upon a
reading of this summary alone. As a result, the executive
summary must be concise but comprehensive, meaning that it
must present in summary form all major sections of the main
report, such as:
· purpose
· problem
· methods of analyzing the problem
· results of analysis
· recommendations
To repeat, because of the critical role it plays, the executive
summary is often the first and only part read by key decision
makers. Therefore, it must be designed so that it can be read
independently of the main document. Typically, figures and
tables are not referenced in the executive summary. Uncommon
terminology, symbols and acronyms are avoided. If the
executive summary is sufficiently persuasive, the entire
proposal will then be read in full.
Therefore, your summary is key to the success of your proposal
and should reflect these characteristics:
Perfect Miniaturization. The executive summary should contain
the same sections in the same order as the full report.
33. Major Findings Only. Because it is a distilled version of the full
report, the summary should include only the proposal's principal
points and major evidence. Most charts, tables, and deep-level
analysis are reserved for full proposal.
Proportional. The executive summary should typically be only
10% the length of the full proposal it distills. Therefore, the
executive summary for a 10-page proposal would be 1 page or
less.
Stand Alone. The summary should be written in a way that it
can be read as a stand-alone document. Before submitting it,
allow a test subject to read the summary. The subject should be
able to give to you the basics of the full proposal from one
reading of the summary.
Flawless. Like a job resume, even the most minor error of
proofreading or grammar can spell rejection.
Step 5: Complete Your Final Business Plan
INBOX: 1 New Message
Subject: Final Business Plan
From: Jillian Best, CEO, MCS
To: You
It’s been a pleasure working with you on this project. I’m
looking forward to seeing the final deliverables.
The international business plan should be 10–12 pages,
excluding cover page, executive summary, reference list, and
appendices. Any tables, graphs, and figures should be included
as appendices. Your plan should have one-inch margins and be
double spaced in 12-point Times New Roman font. In-text
citations and references should abide by APA format. The plan
should be organized using headings and subheadings to improve
34. its readability.
Your final international business plan should include the
components outlined in the international business plan template.
Congrats!
Jillian
Your final international business plan should include key
findings from your marketing strategy (Steps 1–2) and financial
projections and strategy implementation (Steps 3–4). It should
also include an executive summary
Submit your final business plan to the dropbox located in the
final step of this project. Then proceed to the next step.
Step 4: Prepare Strategy Implementation Plan
The next step is to specify the major factors to be tracked for
strategy implementation using the four perspectives of
the balanced scorecard: the learning and growth perspective,
business process perspective, customer perspective, and
financial perspective.
Next, you will combine your marketing strategy and your
financial, governance, and implementation analysis into a final
report.
Step 3: Make Financial Projections in the Selected Country
As you continue to work on your international business
plan prepare market share estimates for MediCorp’s medical
device in the selected country and revenue forecasts for the next
three years.
This analysis will form a portion of your final international
business plan. In the next step, you’ll examine another element
of the business plan, strategy implementation.
Step 2: Develop a Marketing Strategy
35. Email
Subject: Marketing Strategy
From: Jillian Best, CEO, MCS
To: You
Now that we know more about MediCorp’s potential customers,
we need to examine some key attributes of the company to
adequately prepare it for international expansion.
Include the following components in your marketing strategy:
· selection of new medical device for MediCorp to introduce in
the selected country
· MediCorp's main competitors in your selected medical
diagnostics devices industry in the selected country
· market and segment growth of your selected medical
device over the next three years in your selected country.
· Where does MediCorp add value as a way of gaining a
competitive edge?
· Recommendation of relocation of one or more activities from
MediCorp’s value chain in the United States to your selected
country, using Porter’s Value Chain analysis.
· the legal business entity to market the products in the country
(review Modes of Entry for help)
· impact of the country’s legal, ethical, and cultural standards
on MediCorp’s operations in the country (review Governance
and Accountability for more information)
Jillian
By the end of Week 9, submit your six- to seven-page marketing
strategy to the dropbox located in the final step of this project.
(This milestone submission is optional, but useful if you would
like feedback.) Your marketing strategy should include all
components outlined in Step 1 and Step 2.
Then, continue to the next step, where you will consider the
client’s financial projections and the accounting standards in
the selected country.
36. Step 1: Assess the Characteristics of MediCorp's Potential
Customers in the Selected Country
Email
Subject: Marketing Plan
From: Jillian Best, CEO, MCS
To: You
Hi,
Let us continue crafting an international business plan for
another country.
First, select a country from the list in the discussion area as a
new market for MediCorp to expand into, and decide on a
medical device from the list that MediCorp can use to drive
expansion. To help with your analysis of the industry, you will
need to identify the NAICS code for the industry subsector to
which your selected device belongs. Then, begin to develop a
six- to seven-page marketing strategy for MediCorp.
As you begin your marketing strategy for MediCorp, first
analyze the characteristics of the company’s potential customers
in the new market and address the international cultural
differences.
I’ll send additional instructions shortly about how to analyze
MediCorp’s own characteristics and how those characteristics
will influence this marketing strategy.
Thanks for your hard work!
Jillian
When you have assessed the characteristics of MediCorp's
potential customers for your selected medical device in a
country, continue to the next step, where you will work on
expanding MediCorp’s product base in the selected country by
accounting for MediCorp’s mode of entry.
You will incorporate your recommendations from Step 1 and
Step 2 into a six- to seven-page marketing strategy that will be
submitted for feedback at the end of Week 9.
37. 2/1/21, 4:27 PMProject 5—Final Report Template
Page 1 of
2https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/course-resource-list/project-5-final-report-template-
.html?ou=541222
Project 5—Final Report Template
1. Title page
states the client organiza!on, selected country, the client's
product, type of legal
structure, and the alliance partner
date submi"ed
your name
course !tle, course and sec!on number
professor’s name
2. Table of contents
page numbers for each major sec!on
3. Execu!ve summary
(h"p://ewc.umgc.edu/ewc/web/exec_summary.html)
summarizes the results of your analysis and how you arrived at
the recommenda!on
38. belongs on a separate page from the introduc!on to the report
Start your execu!ve summary as follows: “Business Plan for
[selected client
organiza!on] to enter [selected country] $(size of market in US
Dollars) market for
[product/service] through a [type of legal structure] with
[selected alliance partner].”
4. Introduc!on (first page of report body)
states the purpose of the report
explains what the report will do
introduces the industry, country, and client's name
Course Resource
Memo: Please use this template
http://ewc.umgc.edu/ewc/web/exec_summary.html
2/1/21, 4:27 PMProject 5—Final Report Template
Page 2 of
2https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/course-resource-list/project-5-final-report-template-
.html?ou=541222
5. Marke!ng strategy
market analysis
40. 1. Angioplasty balloon catheters
2. Catheter ablation machines
3. Continuous glucose monitoring system
4. Drug delivery pumps
5. Insertable cardiac monitors (ICM)
6. Programmable shunts
7. Traction equipment
You can decide on any one of the following six countries for
your selected medical device:
· Argentina
· Brazil
· Indonesia
· Poland
· Spain
· Vietnam
2/1/21, 4:19 PMPorter's Value Chain
Page 1 of
3https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/value-chain.html?ou=541222
Porter's Value Chain
Another method of diagnosing an organiza!on is to analyze its
value chain. The term value chain was
introduced by Michael Porter to refer to the ac!vi!es that are
performed within and surrounding the
41. organiza!on that add value to its products or services.
Organiza!ons should perform these ac!vi!es
effec!vely for compe!!ve advantage.
Value chain analysis iden!fies five primary areas within the
value chain, as shown in the figure Porter's Value
Chain:
inbound logis!cs
opera!ons
outbound logis!cs
marke!ng and sales
service
Addi!onally, four secondary areas are iden!fied as follows:
infrastructure
human resources management
technology development
procurement
Porter argued that an organiza!on should seek to provide unique
value for its customers by finding what it
does best (which will result in compe!!ve success), rather than
entering into too many markets, striving to
42. please everyone, or trying to provide the lowest cost.
Organiza!ons will be successful when they focus on
crea!ng a unique value for the customer, determine who their
customer base is, nego!ate the best
distribu!on channels, and manage their produc!on and pricing
strategies. Organiza!ons will always face
challenges from changes in the environment. To remain
effec!ve, organiza!ons will need to focus on
con!nual innova!on and on increasing their value to the
customer.
The learning resource(s) listed below will help you learn about
organiza!onal assessments and
organiza!onal diagnosis. You must click on each resource
separately to access it. This informa!on will be
used to complete your deliverable for this project.
The value-added chain is the process by which technology is
combined with material and labor inputs, and
then processed inputs are assembled, marketed, and distributed.
The value chain shows the links, or chain,
of the dis!nct ac!vi!es and processes that a company performs to
create, manufacture, market, sell, and
distribute its product or service. The focus is on the ac!vi!es
that create value for customers.
43. Learning Topic
2/1/21, 4:19 PMPorter's Value Chain
Page 2 of
3https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/value-chain.html?ou=541222
Value-chain ac!vi!es can be segregated to provide a detailed
iden!fica!on of a company’s ac!vi!es and the
capabili!es that correspond to each ac!vity. The value-added
chain is best defined in terms of each link's
contribu!on to total cost. By comparing the costs incurred by
each link and against compe!tors, the
company can locate the cri!cal success factors that must be
addressed.
The importance of value-chain analysis is that it helps portray
the costs in a company’s opera!ons that
might be impacted by a change in one of the chain's processes.
By comparing a company’s value chain to its
compe!tors’, you can iden!fy areas for improvement.
It is important to note that the value chain is influenced by the
type of strategy the company and its
compe!tors follow. If the company is a high-value, high-quality
market leader, its chain will be different from
44. the low-cost, high-volume compe!tor. These differences
influence value-chain analysis. Companies must
make sure that their business strategy is in tune with their
strategic objec!ves.
The airline industry represents a good example of differen!a!on.
Many airlines operate under similar
circumstances and share similar cost structures and routes.
Methods of differen!a!on can include lowest-
price or on-!me record, and areas such as boarding procedures,
carry-on policies, airline miles, and social
media can drive customer loyalty. The example of Southwest
Airlines illustrates how pu#ng people first
creates a solid marke!ng posi!on. It is important to iden!fy the
opportuni!es that increase a product or
service's perceived value to the customer (Smartsheet, n.d.).
Another example is the American steel industry, which consists
of large, ver!cally integrated carbon steel
makers. Some of the steel companies are integrated from ore
mining to finished products. Their profitability
has been threatened by mini steel mills and imports. Steel
producers must choose either to reduce crude
steel produc!on and focus on flat and specialty steel products,
or cut costs. The value-added chain is useful
in iden!fying links that are not cost compe!!ve.
45. For strategies driven by product differen!a!on, the value-added
chain is best defined in terms of the
contribu!on of each link to market value. This method helps
iden!fy the product a$ributes preferred by
consumers and links them to the value-added ac!vi!es in the
chain that generate this a$ribute.
However, assets that underlie the produc!on of these a$ributes
cannot be easily redeployed along the
value-added chain. There is also the risk of product or process
imita!on by compe!tors. Companies,
therefore, o%en pursue different strategies. Analysis of value
chains shows that strategy is not just about
the selec!on of profitable product markets. It is also about
inves!ng in the links that generate the product
a$ribute desired by consumers and which correspond to the
firm's dis!nc!ve competence rela!ve to its
compe!tors.
Depending upon the customer preferences and compe!tors’
strengths, the company can decide to redeploy
its assets, pursue its tradi!onal business, withdraw from the
business, or make an acquisi!on of the cri!cal
assets.
The value-chain concept is thus useful in isola!ng the cri!cal
46. success factors of a strategy. For strategies in
compe!!ve industries, the chain isolates those links that are not
currently viable rela!ve to compe!!on. For
strategies of product differen!a!on, the chain indicates those
links that generate downstream economic
rents.
In the global context, the chain of compara!ve advantage for
countries must be explored.
References
2/1/21, 4:19 PMPorter's Value Chain
Page 3 of
3https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/value-chain.html?ou=541222
Smartsheet. (n.d.). The art of value chain analysis: From
defining ac!vi!es to iden!fying areas for
improvement. Retrieved from h$ps://www.smartsheet.com/art-
value-chain-analysis-defining-
ac!vi!es-iden!fying-areas-improvement
Porter, M. E. (1985). The compe!!ve advantage: Crea!ng and
sustaining superior performance. NY: Free
Press.
48. tradi!onal and well-established method of reaching foreign
markets. Since it does not require that the goods
be produced in the target country, no investment in foreign
produc!on facili!es is required. Most of the
costs associated with expor!ng take the form of marke!ng
expenses.
While rela!vely low risk, expor!ng entails substan!al costs and
limited control. Exporters typically have
li#le control over the marke!ng and distribu!on of their
products, face high transporta!on charges and
possible tariffs, and must pay distributors for a variety of
services. Further, expor!ng does not give a
company firsthand experience in staking out a compe!!ve
posi!on abroad, and it makes it difficult to
customize products and services to local tastes and preferences.
Licensing essen!ally permits a company in the target country to
use the property of the licensor. Such
property, such as trademarks, patents, and produc!on
techniques, is usually intangible. The licensee pays a
fee in exchange for the rights to use the intangible property and
possibly for technical assistance.
Because li#le investment on the part of the licensor is required,
licensing can provide a very large return on
49. investment. However, because the licensee produces and
markets the product, poten!al returns from
manufacturing and marke!ng ac!vi!es may be lost. Thus,
licensing reduces cost and involves limited risk.
However, it does not mi!gate the substan!al disadvantages
associated with opera!ng from a distance. As a
rule, licensing strategies inhibit control and produce only
moderate returns.
Strategic alliances and joint ventures have become increasingly
popular in recent years. They allow
companies to share the risks and resources required to enter
interna!onal markets. And although returns
also may have to be shared, these arrangements give companies
a degree of flexibility not afforded by going
it alone through direct investment.
There are several mo!va!ons for companies to consider a
partnership as they expand globally, including
facilita!ng market entry, risk and reward sharing, technology
sharing, joint product development, and
conforming to government regula!ons. Other benefits include
poli!cal connec!ons and distribu!on channel
access that may depend on rela!onships.
Such alliances o%en are favorable when (1) the partners'
strategic goals converge while their compe!!ve
50. goals diverge; (2) the partners' size, market power, and
resources are small compared to the industry leaders;
and (3) partners are able to learn from one another while
limi!ng access to their own proprietary skills.
Learning Topic
2/1/21, 4:20 PMModes of Entry
Page 2 of
8https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/modes-of-entry.html?ou=541222
The key issues to consider in a joint venture are ownership,
control, length of agreement, pricing, technology
transfer, local firm capabili!es and resources, and government
inten!ons. Poten!al problems include (1)
conflict over asymmetric new investments, (2) mistrust over
proprietary knowledge, (3) performance
ambiguity, that is, how to "split the pie," (4) lack of parent firm
support, (5) cultural clashes, and (6) if, how,
and when to terminate the rela!onship.
Ul!mately, most companies will aim at building their own
presence through company-owned facili!es in
important interna!onal markets. Acquisi!ons and greenfield
start-ups represent this ul!mate commitment.
51. Acquisi!on is faster, but star!ng a new, wholly owned subsidiary
might be the preferred op!on if no
suitable acquisi!on candidates can be found.
Also known as foreign direct investment (FDI), acquisi!ons and
greenfield start-ups involve the direct
ownership of facili!es in the target country and, therefore, the
transfer of resources including capital,
technology, and personnel. Direct ownership provides a high
degree of control in the opera!ons and the
ability to be#er know the consumers and compe!!ve
environment. However, it requires a high level of
resources and a high degree of commitment.
Coca-Cola and Illycaffé
In March 2008, the Coca-Cola company and Illycaffé Spa
finalized a joint venture and launched a
premium ready-to-drink espresso-based coffee beverage. The
joint venture, Ilko Coffee Interna!onal,
was created to bring three ready-to-drink coffee products—
caffè, an Italian chilled espresso-based
coffee; cappuccino, an intense espresso, blended with milk and
dark cacao; and la#e macchiato, a
smooth espresso, swirled with milk—to consumers in 10
European countries. The products will be
52. available in stylish, premium cans (150 milliliters for caffè and
200 milliliters for the milk variants). All
three offerings will be available in 10 European Coca-Cola
Hellenic markets, including Austria, Croa!a,
Greece, and Ukraine. Addi!onal countries in Europe, Asia,
North America, Eurasia, and the Pacific were
slated for expansion at a later date.
The Coca-Cola Company is the world's largest beverage
company. Along with Coca-Cola, recognized as
the world's most valuable brand, the company markets four of
the world's top five nonalcoholic
sparkling brands, including Diet Coke, Fanta, Sprite, and a wide
range of other beverages, including diet
and light beverages, waters, juices and juice drinks, teas,
coffees, and energy and sports drinks.
Through the world's largest beverage distribu!on system,
consumers in more than 200 countries enjoy
the company's beverages at a rate of 1.5 billion servings each
day.
Based in Trieste, Italy, Illycaffé produces and markets a unique
blend of espresso coffee under a single
brand leader in quality. Over 6 million cups of Illy espresso
coffee are enjoyed every day. Illy is sold in
53. over 140 countries around the world and is available in more
than 50,000 of the best restaurants and
coffee bars. Illy buys green coffee directly from the growers of
the highest quality Arabica through
partnerships based on the mutual crea!on of value. The Trieste-
based company fosters long-term
collabora!ons with the world's best coffee growers—in Brazil,
Central America, India, and Africa—
providing know-how and technology and offering above-market
prices.
Entry Strategies: Timing
2/1/21, 4:20 PMModes of Entry
Page 3 of
8https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/modes-of-entry.html?ou=541222
In addi!on to selec!ng the right mode of entry, the !ming of
entry is cri!cal. Just as many companies have
overes!mated market poten!al abroad and underes!mated the !me
and effort needed to create a real
market presence, so have they jus!fied their overseas' expansion
on the grounds of an urgent need to
par!cipate in the market early. Arguing that there existed a
limited window of opportunity in which to act,
54. which would reward only those players bold enough to move
early, many companies made sizable
commitments to foreign markets even though their own
financial projec!ons showed they would not be
profitable for years to come. This dogma!c belief in the concept
of a first-mover advantage (some!mes
referred to as pioneer advantage) became one of the most widely
established theories of business. It holds
that the first entrant in a new market enjoys a unique advantage
that later compe!tors cannot overcome
(i.e., that the compe!!ve advantage so obtained is structural and
therefore sustainable).
Some companies have exemplified this concept. Procter &
Gamble (P&G), for example, has always trailed
rivals such as Unilever in certain large markets, including India
and some La!n American countries, and the
most obvious explana!on is that its European rivals were
par!cipa!ng in these countries long before P&G
entered. Given that history, it is understandable that P&G erred
on the side of urgency in reac!ng to the
opening of large markets such as Russia and China. For many
other companies, however, the concept of
pioneer advantage was li#le more than an ar!cle of faith and was
applied indiscriminately and with
55. disastrous results to country-market entry, to product-market
entry, and, in par!cular, to the new economy
opportuni!es created by the Internet.
The get-in-early philosophy of pioneer advantage remains
popular. And while there are clear examples of its
successful applica!on—the advantages gained by European
companies from being early in colonial markets
provide some evidence of pioneer advantage —first-mover
advantage is overrated as a strategic principle. In
fact, in many instances, there are disadvantages to being first.
First, if there is no real first-mover advantage,
being first o%en results in poor business performance, as the
large number of companies that rushed into
Russia and China can a#est to. Second, pioneers may not always
be able to recoup their investment in
marke!ng required to kick-start the new market. When that
happens, a fast follower can benefit from the
market development funded by the pioneer and leapfrog into
earlier profitability. For a more detailed
discussion, see Tellis & Golder (2002).
This ability of later entrants to free-ride on the pioneer's market
development investment is the most
common source of first-mover disadvantage and suggests two
56. cri!cal condi!ons necessary for real first-
mover advantage to exist. First, there must be a scarce resource
in the market that the first entrant can
acquire. Second, the first mover must be able to lock up that
scarce resource in such a way that it creates a
barrier to entry for poten!al compe!tors. A good example is
provided by markets in which it is necessary for
foreign firms to obtain a government permit or license to sell
their products. In such cases, the license, and
perhaps government approval, more generally, may be a scarce
resource that will not be granted to all
comers. The second condi!on is also necessary for first-mover
advantage to develop. Many companies
believed that brand preference created by being first cons!tuted
a valid source of first-mover advantage,
only to find that, in most cases, consumers consider the
alterna!ves available at the !me of their first
purchase, not which came first.
Starbucks’ Global Expansion
Starbucks' decision to expand abroad came a%er an extended
period of exclusive focus on the North
American market. From its founding in 1971, it grew to almost
700 stores by 1995, all within the
57. United States and Vancouver, Canada. It was not un!l the next
decade that Starbucks made its first
entry into other interna!onal markets. By 2006, Starbucks
operated approximately 11,000 stores—with
70 percent in the United States and 30 percent in interna!onal
markets—and interna!onal revenue had
2/1/21, 4:20 PMModes of Entry
Page 4 of
8https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/modes-of-entry.html?ou=541222
grown to almost 20 percent of Starbucks' total revenue.
Starbucks offered the same basic coffee menu
interna!onally as it did in the United States. However, the range
of food products and other items, such
as coffee mugs stocked, varied somewhat according to local
customs and tastes.
Along with many other companies that pursue global expansion,
Starbucks con!nually faces ques!ons
about where and how to further increase its global presence.
Should the emphasis be on growth in
exis!ng countries or on increasing the number of countries in
which it has a presence? How important
is the fact that interna!onal markets so far have proven less
58. profitable than US and Canadian markets?
Starbucks in Japan
Interes!ngly, Starbucks' first move outside the United States and
Canada was a joint venture in Japan.
At the !me, Japan had the second-largest economy in the world
and was consistently among the top
five coffee importers.
The decision to use a joint venture to enter Japan followed
intense internal debate. Concerns among
senior execu!ves centered on Starbucks' lack of local
knowledge, and ques!ons were raised about the
company's ability to a#ract the local talent necessary to grow
the Japanese business quickly enough.
Starbucks was acutely aware that there were significant
differences between doing business in Japan
and in the United States and that it might not have enough
experience to be successful on its own.
Among other factors, opera!ng costs were predicted to be
double those of North America, and
Starbucks would have to pay to ship coffee to Japan from its
roas!ng facility in Kent, Washington (near
Sea#le). In addi!on, retail space in Tokyo was two to three !mes
as expensive as in Sea#le. Just finding
59. rental space in such a populous city might prove to be a
tremendous challenge. Starbucks concluded it
needed to form an alliance with a local group that had
experience with complex opera!ons and real
estate.
Starbucks execu!ves worried that a licensing deal would not be
the right solu!on. Specifically, they
were concerned about a possible loss of control and insufficient
knowledge transfer to learn from the
experience. A joint venture was thought to be a be#er answer,
and, a%er a long search, Starbucks
approached Sazaby, Inc., operators of upscale retail and
restaurant chains, whose president had
approached Starbucks years earlier about the poten!al of
opening Starbucks stores in Japan. Similarity
in values, culture, and community development goals between
Starbucks and Sazaby were important
considera!ons in concluding the 50-50 deal. The two companies
were equally represented on the
board of directors of the newly created Starbucks Coffee Japan.
Starbucks was the sole decision-
making power in ma#ers rela!ng to brand, product line
adver!sing, and corporate communica!ons,
while decisions regarding real-estate opera!onal issues and
60. human resources were handled by Sazaby.
Despite strong local compe!!on, the venture was successful
from the start. By fiscal year 2000,
Starbucks Coffee Japan became profitable more than two years
ahead of schedule.
Starbucks in the United Kingdom
Unlike its expansion into Asia and later, the Middle East,
Starbucks chose to enter the United Kingdom
through acquisi!on rather than partnerships. Speed was a major
factor in Starbucks' decision to enter
the fast-growing UK market by acquisi!on. In addi!on, the
culture, language, legal environment,
management prac!ces, and labor economics in the United
Kingdom were considered sufficiently similar
to those that Starbucks' management already knew. This meant
that a wholly owned UK subsidiary
could be successfully established from the outset. In May 1998,
Starbucks acquired the Sea#le Coffee
Company, which had had a presence in the United Kingdom for
some !me. This fast-growing chain was
2/1/21, 4:20 PMModes of Entry
Page 5 of
61. 8https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/modes-of-entry.html?ou=541222
modeled on its own style of opera!ons and, at the !me of the
purchase, had 56 retail units. The Sea#le
Coffee Company was an a#rac!ve acquisi!on target because of
its focus—rela!vely small market
capitaliza!on and established retail units. By 2005, Starbucks
had 469 stores in the United Kingdom,
which made it the third-largest country, a%er the United States
and Japan, to serve Starbucks coffee.
Licensing in China
In a number of developing markets, including China, Starbucks
chose to enter into minority share
licensing agreements with high-quality, experienced local
partners in order to minimize market-entry
risks. Under these agreements, the local partners absorbed the
capital costs (real estate, store
construc!on) of bringing the Starbucks brand abroad. These
steps eliminated the need for substan!al
general and administra!ve expenses by Starbucks and enabled it
to establish a presence in foreign
markets much more quickly than it would have if it had to
invest its own capital and absorb start-up
losses.
62. Risk was also a major considera!on when Starbucks looked to
enter China. While offering high-volume
opportuni!es in an untapped coffee market, the prevailing
culture and poli!cs in China poten!ally
posed significant problems. In April 2000, Beijing city
authori!es ordered Kentucky Fried Chicken to
close its store near the Forbidden City when its lease expired in
2002. Similarly, under pressure from
local authori!es, McDonald's removed its golden arches from
outlets near Tiananmen Square. These
incidents demonstrated China's ambiguous a&tude toward a
growing Western economic and cultural
influence.
Another major concern with star!ng opera!ons in China was
recrui!ng the right staff. Uniformity of
customer experience and coffee quality was the key driver
behind the Starbucks brand. Failure to
recruit the staff to ensure these key criteria not only would
mean failure for the Chinese retail outlets
but also could harm the company's image globally.
Although these factors made licensing an a#rac!ve entry model,
with growing experience in the
Chinese market, Starbucks is steadily reducing its reliance on
63. the licensing model and switching to its
core company-operated business model to increase control and
reap greater rewards.
Starbucks' globaliza!on history shows that while it was a first
mover in the United States, it was forced
to push harder in interna!onal markets to compete with exis!ng
players. In Japan, Starbucks was
ini!ally a huge success and became profitable two years earlier
than an!cipated. However, just two
years a%er Starbucks Japan had become profitable, the company
announced a loss of $3.9 million in
Japan, its second largest market at the !me, reflec!ng a major
increase in local compe!!on. Addi!onal
interna!onal challenges were a result of Starbucks' chosen entry
mode. Although joint ventures
provided Starbucks with local knowledge about the market and
a low-risk entry into unproven territory,
joint ventures did not always reap the rewards that the partners
had an!cipated. One key factor was
that it was o%en difficult for Starbucks to control the costs in a
joint venture, resul!ng in lower
profitability.
64. 2/1/21, 4:20 PMModes of Entry
Page 6 of
8https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/modes-of-entry.html?ou=541222
Glossary
expor"ng The marke!ng and direct sale of domes!cally produced
goods in another
country
fast follower A firm that uses the benefits from prior market
development by a
pioneering firm to achieve profitability more quickly
foreign direct
investment (FDI)
A firm's direct ownership of facili!es in a target country market
greenfield start-ups Wholly-owned subsidiaries created by firms
to gain entry in foreign
markets
joint ventures Methods by which firms share the resources and
risks required to enter
interna!onal markets
licensing Permits a firm (licensee) in the target country to use
the intangible
property of the licensor for a fee
strategic alliances Methods by which firms share the resources
and risks required to enter
interna!onal markets
65. 2/1/21, 4:20 PMModes of Entry
Page 7 of
8https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/221
1/learning-topic-list/modes-of-entry.html?ou=541222
Selec!ng global target markets, entry modes, and deciding how
much to adapt the
company's basic value proposi!on are in!mately related. The
choice of customers to
serve in a par!cular country or region with a par!cular culture
determines how and how
much a company must adapt its basic value proposi!on.
Conversely, the extent of a
company's capabili!es in tailoring its offerings around the globe
limits or broadens its
op!ons to successfully enter new markets or cultures.
Few companies can afford to enter all markets open to them.
The track record shows
that picking the most a#rac!ve foreign markets, determining the
best !me to enter
them, and selec!ng the right partners and level of investment
has proven difficult for
many companies, especially when it involves large emerging
66. markets such as China.
Research shows there is a pervasive the-grass-is-always-greener
effect that infects global
strategic decision making in many companies—especially those
without global experience
—and causes them to overes!mate the a#rac!veness of foreign
markets.
Four key factors in selec!ng global markets are (1) a market's
size and growth rate, (2) a
par!cular country or region's ins!tu!onal contexts, (3) a region's
compe!!ve
environment, and (4) a market's cultural, administra!ve,
geographic, and economic
distance from other markets the company serves.
There is a wide menu of op!ons regarding market entry, from
conserva!ve strategies,
such as first establishing an export base or licensing products to
gain experience in a
newly targeted country, to more aggressive op!ons, such as
entering an alliance, making
an acquisi!on, or even star!ng a new subsidiary.
Selec!ng the right !ming of entry is equally cri!cal. Many
companies have overes!mated
67. market poten!al abroad, underes!mated the !me and effort
needed to create a real
market presence, and have they jus!fied their overseas
expansion on the grounds of an
urgent need to par!cipate in the market early.
References
Davila, A., Foster, G., Pu#, C., & Somjen, A. (2006). Starbucks:
A global work-in-progress (Case No. IB74).
Retrieved from h#ps://www.gsb.stanford.edu/faculty-
research/case-studies/starbucks-global-work-
progress
Tellis, G. J., & Golder, P. (2002). Will and Vision: How
latecomers grow to dominate markets. New York, NY:
McGraw Hill.
Licenses and A#ribu!ons
Fundamentals of Global Strategy v. 1.0
(h#ps://saylordotorg.github.io/text_fundamentals-of-global-
strategy/) was adapted by Saylor Academy and is available
under a Crea!ve Commons A#ribu!on-
NonCommercial-ShareAlike 3.0 Unported
(h#ps://crea!vecommons.org/licenses/by-nc-sa/3.0/) license
without a#ribu!on as requested by the work's original creator or
licensor. UMUC has modified this work
69. Who Owns the Corpora!on? The Legal Debate
Do shareholders own the company? To most people, this idea is
so axioma!c that the ques!on hardly seems
worth asking. However, the long-simmering debate about the
age-old argument over the board's
responsibili!es to shareholders versus the rights of all company
stakeholders flared up again recently,
drawing a"en!on once again to that central ques!on (Bernstein,
2008).
In the latest round of this debate, two leading corporate
governance experts—Lucian Bebchuk, Harvard Law
School professor and ardent shareholder-rights proponent, and
Mar!n Lipton, founding partner of Wachtell,
Lipton, Rosen & Katz and a stalwart defender of the view that
management's preroga!ve is to act in the
best interest of the corpora!on—squared off in the pages of the
Virginia Law Review (see Bebchuk, 2007, p.
675; Lipton & Savi", 2007, p. 733). The central issue in this
debate is whether directors of a public company
owe their primary fiduciary duty to its shareholders, as Bebchuk
insists, or if they have to consider the
preroga!ves of all the stakeholders, as Lipton maintains.
Bebchuk (2007) cites a widely quoted 1988 ruling by the
Delaware courts that "the shareholder franchise is
70. the ideological underpinning upon which the legi!macy of
directorial power rests" and points out that
corporate law gives boards the authority to hire and fire
management and set the company's overall
direc!on. Next, he argues that since directors are expected to
serve as the shareholders' guardians,
shareholders must have the power to replace them. Thus, the
fear of being replaced is supposed to make
directors accountable and provide them with incen!ves to serve
shareholder interests.
He con!nues by no!ng just how infrequently US directors are
actually challenged, much less removed, and
concludes that shareholder power to replace directors in the
United States is largely a myth. To make
shareholder power real, he supports the proposal that directors
be elected by a secret ballot open to rival
candidates nominated by shareholders. To put them on an equal
foo!ng with the slate proposed by the
board's nomina!ng commi"ee (usually with management input),
he suggests that challengers be reimbursed
by the corpora!on if they receive a threshold number of votes.
Taking the opposing view and challenging the widely accepted
argument that a company's primary goal is to
71. maximize shareholder value, Lipton challenges the very no!on
that corpora!ons are the private property of
stockholders. "Shareholders do not own corpora!ons," he says.
"They own securi!es—shares of stock—
which en!tle them to very limited electoral rights and the right
to share in the financial returns produced by
the corpora!on's business opera!ons" (Lipton & Savi", 2007, p.
733). Directors, he argues, are not merely
representa!ves of shareholders who have a legal responsibility
to put investor interests first. Instead, the
role of the board is simply and du!fully to seek what is best for
the company itself, which means balancing
the interests of shareholders as well as other stakeholders, such
as management and employees, creditors,
regulators, suppliers, and consumers. He concludes that
Bebchuk's no!on that a board's primary fiduciary
obliga!on is to shareholders is a myth of corporate law.
Learning Topic
2/1/21, 4:20 PMGovernance and Accountability
Page 2 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
72. Focus of US Governance Law: Conduct or Accountability?
Governance in the United States has evolved as a medley of
federal law—including not only corpora!on law
but also tax and labor law—state law, and a series of codes of
various self-regula!ng authori!es ranging
from the NYSE to the accoun!ng industry. State law has
tradi!onally been the ul!mate arbiter of
governance issues. In contrast, in the United Kingdom,
corporate reform can be affected simply through an
act of Parliament.
This unusual history of governance law in the United States has
created an opening to support different
interpreta!ons of a variety of its provisions. For example, the
law not only iden!fies shareholders as the
owners of the corpora!on but also defines them as investors who
receive ownership in the corpora!on in
return for money or assets they invest. It s!pulates that
shareholders are responsible for elec!ng a board of
directors, the operators of the corpora!on who have overall
responsibility for the business of the
corpora!on, but it does not meaningfully address the
implementa!on of this statute. It also specifies that
the board of directors, rather than its shareholders, directs a
73. company's business and affairs.
Addi!onal guidance about a board's fiduciary role is contained
in statutes governing the role and conduct of
individual board members. Specifically those defining a
director's obliga!on in terms of such principles as
the duty of care, duty of loyalty, and the business judgment
rule. The duty of care requires directors to be
informed, prior to making a business decision, of all material
informa!on reasonably available to them in the
exercise of their management of the affairs of a corpora!on. The
duty of loyalty protects the corpora!on
and its shareholders. It requires directors to act in good faith
and in the best interests of the corpora!on and
its shareholders. The prevalent legal standard is that the duty of
loyalty requires that the director be
"disinterested," such that he or she "neither appears on both
sides of a transac!on nor expects to derive any
personal financial benefit from it," and his or her decision must
be "based on the corporate merits of the
subject before the board rather than extraneous considera!ons or
influences" (The American Law Ins!tute,
1994, p. 61). The business judgment rule protects directors from
liability for ac!on taken by them if they act
on an informed basis in good faith and in a manner they
74. reasonably believe to be in the best interests of the
corpora!on's shareholders. The business judgment rule does not
apply in cases of fraud, bad faith, or self-
dealing.
As long as these principles are adhered to and as long as
directors are careful and loyal to corporate and
shareholder interests, they have wide discre!on to exercise their
business judgment as they see fit. None of
these principles provide clear guidance to the central ques!on of
who owns the corpora!on.
Corporate Purpose: A Societal Perspec!ve
One reason that US governance law is some!mes indeterminate
is that the enormous differences between
the two legal views described above reflect a broader,
philosophical debate on the role and purpose of
corpora!ons in society. Indeed, opposing views on the purpose
and accountability of the corpora!on—
shareholders versus stakeholders, or private (property) versus
public (social and poli!cal en!ty) concep!ons
of the corpora!on—have been part of the governance debate for
well over 100 years.
Shareholder capitalism, un!l recently prevalent mainly in the
United States and the United Kingdom, holds
75. that a company is the private property of its owners. From a
legal perspec!ve, the Anglo-American
corpora!on is essen!ally a capital market ins!tu!on, primarily
accountable to shareholders, charged with
crea!ng wealth by exploi!ng market opportuni!es. Stakeholder
capitalism, on the other hand, embodies a
more organic view of the corpora!on in which companies have
broader obliga!ons that balance the
interests of shareholders with those of other stakehol ders,
notably employees but also including suppliers,
2/1/21, 4:20 PMGovernance and Accountability
Page 3 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
distributors, customers, and the community at large. Under this
set of beliefs, the corpora!on is seen as an
ins!tu!on with a con!nuing purpose, and therefore, with a life of
its own. Shareholders and wealth crea!on
for owners do not dictate its priori!es. Rather, a deep concern
for employees, suppliers, and customers, and
implicitly for its own con!nued existence, defines the corporate
mission.
76. Stakeholder capitalism can take different forms, reflec!ng the
degree of commitment to different
stakeholders. Germany's legal system, for example, makes it
clear that firms do not have a sole duty to
pursue the interests of shareholders. Under Germany's system of
codetermina!on, employees and
shareholders in large companies hold an equal number of seats
on the companies' supervisory boards, and
the interests of both par!es must be taken into account in
decision making. In Denmark, employees in firms
with more than 35 workers elect one-third of the firm's board
members, with a minimum of two. In Sweden,
companies with more than 25 employees must have two labor
representa!ves appointed to the board.
These employee board members have all the rights and du!es of
other board members.
The situa!on differs somewhat in France. French firms with
more than 50 workers have employee
representa!ves at board mee!ngs, but they do not have the right
to vote. More conven!onal
codetermina!on systems exist for former public-sector French
firms that have been priva!zed. These
systems can be introduced voluntarily by companies. In Finland,
companies can also voluntarily adopt
77. employee representa!ves on the board. Across the European
Union (EU) as a whole, another type of worker
par!cipa!on in decision making is the works council, a group
that has a say in such issues as layoffs and
plant closures. A corpora!on with at least 1,000 employees, of
which there are 150 or more in at least two
EU countries, must have a European Works Council.
Japanese firms also differ from those in the United States and
the United Kingdom. Japanese execu!ves do
not have a fiduciary responsibility to stockholders, but they can
be liable for gross negligence in performing
their du!es. At the same !me, it is accepted prac!ce in Japan that
managers align their priori!es with the
interests of a variety of stakeholders. For example, a recent
survey revealed that if Japanese execu!ves feel
that the company is going through a tough period financially,
keeping their employees on the job is much
more important than maintaining dividends to shareholders.
Specifically, only 3 percent of Japanese
managers said companies should maintain dividend payments to
stockholders under such circumstances.
This compares with 41 percent in Germany, 40 percent in
France, and 89 percent in both the United States
and the United Kingdom.
78. In the United States, these issues also con!nue to be debated.
Some !me ago Reason (2005) magazine
featured a spirited debate featuring the late Milton Friedman,
former senior research fellow at the Hoover
Ins!tu!on and Paul Snowden Russell Dis!nguished Service
Professor of Economics at the University of
Chicago; John Mackey, founder and CEO of Whole Foods
Market; and others, on the purpose of the
corpora!on. Friedman, a Nobel laureate in economics and the
author of a famous 1970 New York Times
Magazine ar!cle !tled "The Social Responsibility of Business Is
to Increase Its Profits," had no pa!ence with
capitalists who claimed that "business is not concerned 'merely'
with profit but also with promo!ng
desirable 'social' ends; that business has a 'social conscience'
and takes seriously its responsibili!es for
providing employment, elimina!ng discrimina!on, avoiding
pollu!on, and whatever else may be the
catchwords of the contemporary crop of reformers" (Friedman,
1970).
He wrote that such people are "preaching pure and
unadulterated socialism. Businessmen who talk this way
are unwi$ng puppets of the intellectual forces that have been
undermining the basis of a free society these
79. past decades."
2/1/21, 4:20 PMGovernance and Accountability
Page 4 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
Mackey disagreed vehemently with Friedman. A self-described
ardent libertarian who likes to quote Ludwig
von Mises on Austrian economics and Abraham Maslow on
humanis!c psychology, and is a student of
astrology, Mackey believes Friedman's view of business is too
narrow and underes!mates the humanitarian
poten!al of capitalism. Selected por!ons of this debate are
reprinted below, beginning with Mackey's
passionate, personal vision of the social responsibility of
business.
In 1970 Milton Friedman wrote that "there is one and only one
social responsibility of business—to use
its resources and engage in ac!vi!es designed to increase its
profits so long as it stays within the rules
of the game, which is to say, engages in open and free
compe!!on without decep!on or fraud." That's
80. the orthodox view among free market economists—that the only
social responsibility a law-abiding
business has is to maximize profits for the shareholders.
I strongly disagree. I'm a businessman and a free market
libertarian, but I believe that the enlightened
corpora!on should try to create value for all of its
cons!tuencies. From an investor's perspec!ve, the
purpose of the business is to maximize profits. But that's not the
purpose for other stakeholders—for
customers, employees, suppliers, and the community. Each of
those groups will define the purpose of
the business in terms of its own needs and desires, and each
perspec!ve is valid and legi!mate.
(Friedman, Mackey, & Rodgers, 2005)
Mackey con!nues, "We have not achieved our tremendous
increase in shareholder value by making
shareholder value the primary purpose of our business…the
most successful businesses put the customer
first, ahead of the investors. In the profit-centered business,
customer happiness is merely a means to an
end: maximizing profits. In the customer-centered business,
customer happiness is an end in itself, and will
be pursued with greater interest, passion, and empathy than the
profit-centered business is capable of."
81. Not surprisingly, Friedman respected Whole Foods' success but
took issue with its business philosophy.
"Maximizing profits is an end from the private point of view,"
he wrote. "It is a means from the social point of
view. A system based on private property and free markets is a
sophis!cated means of enabling people to
cooperate in their economic ac!vi!es without compulsion; it
enables separated knowledge to assure that
each resource is used for its most valued use, and is combined
with other resources in the most efficient
way."
Mackey replied, "While Friedman believes that taking care of
customers, employees, and business
philanthropy are means to the end of increasing investor profits,
I take the exact opposite view: Making high
profits is the means to the end of fulfilling Whole Foods' core
business mission. We want to improve the
health and well-being of everyone on the planet through higher-
quality foods and be"er nutri!on, and we
can't fulfill this mission unless we are highly profitable. High
profits are necessary to fuel our growth across
the United States and the world. Just as people cannot live
without ea!ng, so a business cannot live without
82. profits. But most people don't live to eat, and neither must a
business live just to make profits" (Friedman,
Mackey, & Rodgers, 2005).
Mackey's logic was perhaps most effec!vely first ar!culated by
Peter Drucker in 1974 in his famous book
Management: Tasks, Responsibili!es and Prac!ces. "The purpose
of a business is not to make a profit,"
Drucker wrote. "Profit is a necessity and a social responsibility.
A business, regardless of the economic and
legal arrangements of society, must produce enough profit to
cover the risks of commi$ng today's
economic resources to the uncertain!es of the future; to produce
the capital for the jobs of tomorrow; and
to pay for all the non-economic needs and sa!sfac!ons of society
from defense and the administra!on of
jus!ce to the schools and the hospitals, and from the museums to
the boy scouts. But profit is not the
purpose of business. Rather a business exists and gets paid for
its economic contribu!on. Its purpose is to
create a customer" (Drucker, 1974, p. 67).
2/1/21, 4:20 PMGovernance and Accountability
Page 5 of
83. 14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
This discussion raises ques!ons that transcend the legal debate
on fiduciary obliga!ons. It asks us to
consider ques!ons, such as, What does society want from
corpora!ons? What are the moral obliga!ons and
responsibili!es of business? Who has the right to make such
decisions in a public company? Is shareholder
wealth maximiza!on the right objec!ve? What obliga!ons does a
company have to other stakeholders, such
as employees or suppliers, and the community at large? Are
these objec!ves necessarily in conflict with
each other? If so, how should trade-offs be made? Furthermore,
the discussion suggests that to be
consistent and effec!ve, directors and boards should have ready
answers to many, if not all, of the ques!ons
and know where they agree or disagree. As we shall see,
regre"ably, this is not true. Not only has the United
States, as a society, changed its perspec!ve on this issue several
!mes, but also, today, the majority of
directors remain confused, some!mes in!midated, by the law and
o&en are unwilling or unable to debate
these issues openly.
84. The Primacy of Shareholder Interests: A Historical Perspec!ve
During the first part of the nineteenth century, the corpora!on
was viewed as a social instrument for the
state to carry out its public policy goals, and each instance of
incorpora!on required a special act of the
state legislature. The func!on of the law was to protect
stakeholders by making sure corpora!ons would not
pursue ac!vi!es beyond their original charter or state of
incorpora!on. By the end of the nineteenth
century, states began to allow general incorpora!on, which
fueled an explosive growth in the crea!on of
companies for private business purposes. In its a&ermath,
concern for stakeholder welfare gave way to the
concept of managing the corpora!on for shareholders' profits.
This sec!on draws on Sundaram and Inkpen
(2004).
In 1919 the primacy of shareholder value maximiza!on was
affirmed in a ruling by the Michigan State
Supreme Court in Dodge vs. Ford Motor Company. Henry Ford
wanted to invest Ford Motor Company's
considerable retained earnings in the company rather than
distribute it to shareholders. The Dodge
brothers, minority shareholders in Ford Motor Company,
brought suit against Ford, alleging that his
85. inten!on to benefit employees and consumers was at the expense
of shareholders. In their ruling, the
Michigan court agreed with the Dodge brothers:
A business corpora!on is organized and carried on primarily for
the profit of the stockholders. The powers
of the directors are to be employed for that end. The discre!on
of directors is to be exercised in the choice
of means to a"ain that end, and does not extend to a change in
the end itself, to the reduc!on of profits, or
to the non-distribu!on of profits among stockholders in order to
devote them to other purposes (Dodge v.
Ford Motor Co., 1919).
In The Modern Corpora!on and Private Property, published in
1932, Adolph Berle and Gardiner Means
provided important intellectual support for the shareholder
value norm. In this now classic book, the authors
called a"en!on to a new phenomenon affec!ng corpora!ons in the
United States at the !me. They noted
that ownership of capital had become widely dispersed among
many small shareholders, yet control was
concentrated in the hands of just a few managers. Berle and
Means warned that the separa!on of
ownership and control would destroy the very founda!on of the
86. exis!ng economic order and argued that
managing on behalf of the shareholders was the sine qua non of
managerial decision making because
shareholders were property owners.
Following the 1929 stock market crash and the Great
Depression, stakeholder concerns were being voiced
once again. If the corpora!on is an en!ty separate from its
shareholders, it was argued, it has ci!zenship
responsibili!es (Dodd, 1932, p. 1145–1163). According to this
point of view, rather than being an agent for
shareholders, the role of management is that of a trustee with
ci!zenship responsibili!es on behalf of all
2/1/21, 4:20 PMGovernance and Accountability
Page 6 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
cons!tuencies, even if it means a reduc!on in shareholder value.
In the following years, states adopted a
number of stakeholder statutes reflec!ng this new sense of
corporate responsibility toward
nonshareholding cons!tuencies, such as labor, consumers, and
the natural environment.
87. By the end of the twen!eth century, however, despite state-level
legisla!ve efforts to the contrary,
American-style market-driven capitalism had prevailed and the
pendulum swung back to the shareholder.
Friedman's (1970) view that the "sole social responsibility of
business is to increase profits" energized a push
back on corporate social responsibility. In the mean!me, agency
theory emerged. Agency theory is directed
at the dilemma in which one party (the shareholder as the
principal) delegates work to another
(management as the agent) who performs that work. Agency
theory is concerned with resolving two
problems that can occur in such a rela!onship. The first is the
agency problem that arises when (1) the
desires or goals of the principal and agent conflict and (2) it is
difficult or expensive for the principal to verify
what the agent is actually doing. The issue here is that the
principal cannot verify that the agent has
behaved appropriately. The second is the problem of risk
sharing that arises when the principal and agent
have different a$tudes toward risk. In this situa!on, the
principle and the agent may prefer different ac!ons
because of the different risk preferences and the concept of the
corpora!on as a nexus of contracts
88. (Easterbrook & Fischel, 1991). The nexus of contracts theory
views the firm not as an en!ty but as an
aggregate of various inputs brought together to produce goods
or services. Employees provide labor.
Creditors provide debt capital. Shareholders ini!ally provide
equity capital and subsequently bear the risk of
losses and monitor the performance of management.
Management monitors the performance of employees
and coordinates the ac!vi!es of all the firm's inputs. The firm is
seen as simply a web of explicit and implicit
contracts establishing rights and obliga!ons among the various
inputs making up the firm.
To protect the interests of other stakeholders, 30 states in the
United States enacted stakeholder statutes
that allowed directors to consider the interests of
nonshareholder cons!tuencies in corporate decisions.
Thus, the law gave boards la!tude in determining what is in the
best long-term interests of the corpora!on
and how to take the interests of other stakeholders into account.
Nevertheless, the mainstream US
corporate law remains commi"ed to the principle of shareholder
wealth maximiza!on.
Governance Without a Shared Purpose?
89. The lack of a clear, shared consensus about why a company
exists, to whom directors are accountable, and
what criteria they should use to make decisions—in the law as
well as in society at large—is a significant
obstacle to increasing the effec!veness of the corporate
governance func!on. When boards operate with
tacit assump!ons about their objec!ves and loyal!es, they may
hide poten!al disagreements among their
members and sacrifice effec!veness. Such hidden disagreements
make it difficult to get consensus on
complex issues, such as what qualifica!ons a CEO should have,
whether or not to outsource parts of the
value chain, or how to evaluate and compensate top
management.
Lorsch (1989) first iden!fied the confusion among directors
about their accountabili!es. Based on their
beliefs, he categorized directors as belonging to one of three
groups: tradi!onalists, ra!onalizers, or broad
construc!onists. Each has a different vision of what the modern
corpora!on's fundamental purpose is and,
therefore, to whom and for what a board should be held
accountable.
Tradi!onalists see themselves as accountable to shareholders
only. For them, there is no need to debate the
90. fundamental purpose of the modern corpora!on—it is and
always has been the maximiza!on of shareholder
value. They do not believe there is a conflict between pu$ng the
shareholder first and responding to the
needs of other cons!tuencies, and therefore experience li"le role
ambiguity or conflict. Members of this
2/1/21, 4:20 PMGovernance and Accountability
Page 7 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
group find support for their posi!on in a narrow interpreta!on of
current state and federal law. They also
tend to view the highly publicized abuses at Enron, WorldCom,
Vivendi, and other companies as anomalies
made possible by imperfec!ons in the current system, rather
than as indicators of more systemic problems.
A second, larger group—the ra!onalizers—experiences more
anxiety about their role as directors. They
recognize that, in today's complex, global economy, real
tensions can occur between the interests of
different cons!tuencies and that not all decisions can be reduced
to the simple formula that assumes what
91. is good for the shareholder is good for everyone else. Examples
include whether or not to close a domes!c
plant in favor of manufacturing in a low-cost, foreign loca!on;
whether or not to outsource produc!on to
lower cost suppliers; or how to respond to pressures for greener
opera!ons.
The final group, which Lorsch labels the broad construc!onists,
recognizes specific responsibili!es to
cons!tuencies other than shareholders and is willing to act on its
convic!ons. Directors belonging to this
group constantly struggle to balance their views with the more
tradi!onal view of a director's
accountabili!es and—to stay within the boundaries of the law—
frame their decisions in terms of what is in
the best long-term interest of the corpora!on as a whole.
Lorsch summarized his findings sta!ng, "Thus we found the
majority of directors felt trapped in a dilemma
between their tradi!onal legal responsibility to shareholders,
whom they consider too interested in short-
term payout, and their beliefs about what is best, in the long
run, for the health of the company." He further
observed that in many boards a group norm had evolved,
prohibi!ng open discussion of a board's true
purpose and that a lot of directors were unaware of recent
92. rulings in the evolving legal context that grant
them the la!tude to consider cons!tuencies other than
shareholders.
In recent years the issue of a board's primary role and
accountability has, if anything, become even more
confusing. Despite strong rhetoric from many quarters
advoca!ng maximiza!on of shareholder value as a
company's primary goal, there is a growing recogni!on that a
company and the board have broader
responsibili!es. This trend reflects the fact that real —that is,
economic and psychological rather than legal—
ownership of the corpora!on is moving from shareholders to
employees, customers, and other stakeholders
that make up the human capital of the firm.
This trend has created problems for directors. As Carter &
Lorsch (2004) note, "Boards have a real challenge
in deciding to whom they are really responsible and where their
commitments ul!mately lie. Directors must
think about and discuss among themselves the cons!tuencies and
the !me horizons they have in mind as
they think about the board's responsibili!es. Many boards have
skirted discussion of these complex issues.
They seem too abstract, and reaching a consensus among board
members about them can take more of that
93. most precious commodity—!me—than directors want to
devote."
Is Shareholder Value Maximiza!on the Right Objec!ve?
In their widely cited book The Value Impera!ve —Managing for
Superior Shareholder Returns, McTaggart,
Kontes, and Mankins (1994) write, "Maximizing shareholder
value is not an abstract, shortsighted,
imprac!cal, or even, some might think, sinister objec!ve. On the
contrary, it is a concrete, future-oriented,
pragma!c, and worthy objec!ve, the pursuit of which mo!vates
and enables managers to make substan!ally
be"er strategic and organiza!onal decisions than they would in
pursuit of any other goal. And its
accomplishment is essen!al to the welfare of all the company's
stakeholders, for it is only when wealth is
created that customers will con!nue to enjoy a flow of new,
be"er, and cheaper products and the world's
economies will see new jobs created and old ones improved."
Implicit in this statement are three important assump!ons, all of
which can be challenged:
2/1/21, 4:20 PMGovernance and Accountability
94. Page 8 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
Shareholder value is the best measure of wealth crea!on for the
firm.
Shareholder value maximiza!on produces the greatest
compe!!veness.
Shareholder value maximiza!on fairly serves the interests of the
company's other stakeholders.
With respect to the first assump!on, it can be argued that firm
value, which also includes the values to all
other financial claimants, such as creditors, debt holders, and
preferred shareholders, is a be"er indicator of
wealth. The importance of dis!nguishing between firm value and
shareholder value lies in the fact that
managers and boards can make decisions that transfer value
from debt holders to shareholders and
decrease total firm and social value while increasing
shareholder value.
The second assump!on—that shareholder value maximiza!on
produces the greatest long-term
compe!!veness—can also be challenged. An increasingly
influen!al group of cri!cs, which also includes a
substan!al number of CEOs, thinks product-market rather than
95. capital-market objec!ves should guide
corporate decision making. They worry that companies that
adopt shareholder value maximiza!on as their
primary purpose lose sight of producing or delivering a product
or service as their central mission, and that
shareholder value maximiza!on creates a gap between the
mission of the corpora!on and the mo!va!ons,
desires, and capabili!es of the company's employees who only
have direct control over real, current,
corporate performance. They note that shareholder value
maximiza!on is simply not inspiring for
employees, even though they o&en share in some of the gains
through benefit, bonus, or op!on plans. To
many of them, shareholders are nameless and faceless, under no
obliga!on to hold their shares for any
length of !me, never sa!sfied, and always asking, "What will
you do for me next?" Worse, they say, not only
does shareholder-value apprecia!on fail to inspire employees, it
may encourage them to view maximizing
one's financial well-being as a legi!mate or even the only goal.
Instead, they want companies to create a
moral purpose that not only provides a clear focus on crea!ng
compe!!ve advantage for the company but
also unites its purpose, strategy, goals, and shared values into
96. one overall, coherent management framework
that has the power to mo!vate cons!tuents and the legi!macy of
the corpora!on's ac!ons in society
(Ellsworth, 2002, p. 6).
The third assump!on—that shareholder maximiza!on is
congruent with fairly serving the interests is the
firm's other stakeholders—is perhaps most controversial.
Proponents of shareholder value maximiza!on—
including many economists and finance theorists—are adamant
that maximizing shareholder value is not only
superior as a fiduciary standard or management objec!ve but
also as a societal norm. Jensen (2001), for
example, writes, "Two-hundred years of research in economics
and finance have produced the result that if
our objec!ve is to maximize the efficiency with which society
u!lizes its resources (that is to avoid waste
and to maximize the size of the pie), then the proper and unique
objec!ve for each company in the society is
to maximize the long-run total value of the firm. Firm value
will not be maximized, of course, with unhappy
customers and employees or with poor products. Therefore,
consistent with stakeholder theory value-
maximizing firms will be concerned about rela!ons with all their
cons!tuencies. A firm cannot maximize
97. value if it ignores the interest of its stakeholders."
McTaggart et al. (1994) also believe shareholder value
maximiza!on allows managers and boards to resolve
any conflicts to everyone's long-term benefit. Consider, for
example, their prescrip!on for resolving trade-
offs between customer- and shareholder-focused investments.
"As long as management invests in higher
levels of customer sa!sfac!on that will enable shareholders to
earn an adequate return on their investment,
there is no conflict between maximizing shareholder value and
maximizing customer sa!sfac!on. If,
however, there is insufficient financial benefit to shareholders
from a"empts to increase customer
sa!sfac!on, the conflict should be resolved for the benefit of
shareholders to avoid diminishing both the
financial health and long-term compe!!veness of the business."
2/1/21, 4:20 PMGovernance and Accountability
Page 9 of
14https://leocontent.umgc.edu/content/umuc/tgs/mba/mba670/22
11/learning-topic-list/governance-and-
accountability.html?ou=541222
Not surprisingly, stakeholder theorists take a different point of
98. view. They argue that shareholders are but
one of a number of important stakeholder groups and that, like
customers, suppliers, employees, and local
communi!es, have a stake in and are affected by the firm's
success or failure. To stakeholder theory
advocates, an exclusive focus on maximizing stockholder wealth
is both unwise and ethically wrong. Instead,
the firm and its managers have special obliga!ons to ensure that
the shareholders receive a fair return on
their investment. But the firm also has special obliga!ons to
other stakeholders, which go above and beyond
those required by law (Freeman, 1984, p. 17).
More recently, Ian Davis, managing director of McKinsey,
cri!cized the shareholder value maximiza!on
doctrine on altogether different grounds. He observed that, in
today's global business environment, the
concept of shareholder value is rapidly losing relevance in the
face of the larger role played by government
and society in shaping business and industry elsewhere in the
world. "In much of the world," he wrote,
"government, labor and other social forces have a greater
impact on business than in the U.S. or other more
free-market Western socie!es. In China, for example,
government is o&en an owner. If you're talking in
99. China about shareholder value, you will get blank looks.
Maximiza!on of shareholder value is in danger of
becoming irrelevant (Davis, 2006).
Finally, a growing number of par!es, including CEOs, while not
ques!oning that shareholder value
maximiza!on is the right objec!ve, are concerned about its
implementa!on. They worry that the stock
market has a bias toward short-term results and that stock price,
the most common gauge of shareholder
wealth, does not reflect the true long-term value of a company.
Lucent Technologies CEO Henry Schacht,
for example, has stated, "What has happened to us is that our
execu!on and processes have broken down
under the white-hot heat of driving for quarterly revenue
growth" (Loomis, 2003).
Stakeholder Theory: A Viable Alterna!ve?
Although the recogni!on of stakeholder obliga!ons has been
with us since the birth of the modern
corporate form, the development of a coherent stakeholder
theory awaited a shi& in legal thinking from a
perspec!ve on shareholders as owners to one of investors, more
on a par with providers of other inputs that
a company needs to produce goods or services. Whereas the
100. ownership perspec!ve, rooted in property law,
provides a natural basis for the primacy of shareholder rights,
the view of the corpora!on as a bundle of
contracts permits a different view of the fiduciary obliga!ons of
corporate managers. According to Freeman
and McVea (2001), "The stakeholder framework does not rely
on a single overriding management objec!ve
for all decisions. As such it provides no rival to the tradi!onal
aim of 'maximizing shareholder wealth.' To the
contrary, a stakeholder approach rejects the very idea of
maximizing a single-objec!ve func!on as a useful
way of thinking about management strategy. Rather, stakeholder
management is a never ending task of
balancing and integra!ng mul!ple rela!onships and mul!ple
objec!ves.
To pragma!sts, the rejec!on of a single criterion for making
corporate decisions is problema!c. Directors
occasionally face situa!ons in which it is impossible to advance
the interests of one set of stakeholders and
simultaneously protect those of others. Whose interests should
they pursue when there is an irreconcilable
conflict? Consider the decision whether or not to close down an
obsolete plant. The closing will harm the
plant's workers and the local community but will benefit