Systems Biology and Systems Medicine: Leading-Edge Science and Technology, Healthcare, Strategic Partnerships and Commercialization
1. Biomedical Challenges at Skolkovo What type of science will be done? What is leading-edge? Systems medicine offers unique potential—for understanding disease mechanisms, the need for intimate integration of diagnosis and therapy as well as new strategies for drug target discovery. Include non-profit (academic) as well as for profit? How can you enable company creation? How can you attract existing companies? What are appropriate non-profit models? Will you try and recruit back Russian scientists from abroad—or will you do it will resident Russian scientists? Will the Skolkovo money compete with that for other Russia sciences (or the National Academy)? If so, expect resistance. Will you employ strategic partnerships to jump start the creation of Skolkovo? If so, resources will have to go to strategic partners. Will you reform your current academic science in keeping with the bold Skolkovo initiative? Two keys: give young scientists an opportunity and resources to direct their own science at an early age and realize the essential nature of good peer review in the allocation of science resources.
2. Systems Biology and Systems Medicine: Leading-Edge Science and Technology, Healthcare, Strategic Partnerships and Commercialization Lee Hood Institute for Systems Biology, Seattle
3. I Participated in Four Paradigm Changes in Biology Leading to P4 Medicine Bringing engineering to biology (high throughput biology) The human genome project Cross-disciplinary biology Systems biology Predictive, Preventive, Personalized, and Participatory medicine (P4 Medicine) Each fundamentally changed how we think about biology and medicine. Each was met initially with enormous skepticism. Each new idea needed new organizational structure.
4. The Grand Challenge of the 21st Century in Science and Technology Is Complexity New concepts, strategies and technologies permit biologists to successfully begin to attack biological complexity View biology as an informational science Systems approaches permit one to attack complexity effectively Evolving current and emerging technologies permit the exploration of new areas of data space (and improve the old) Computation and mathematical tools permit one to acquire, store, transmit, integrate, mine and create predictive models. These approaches will allow us to effectively attack some of society’s most vexing challenges—healthcare (P4 medicine), global health, environment, energy, nutrition, agriculture, etc.
5. The Foundations of Systems Biology and Systems Medicine – Four Pillars View medicine as an informational science Systems approaches allow one to understand wellness and disease—holist rather than atomistic Emerging technologies will allow us to explore new dimensions of patient data space Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease
8. The Foundations of Systems Biology and Systems Medicine–Four Pillars View medicine as an informational science Systems approaches allow one to understand wellness and disease—holist rather than atomistic (systems biology and systems medicine) Emerging technologies will allow us to explore new dimensions of patient data space Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease
15. Essentials of Systems Biology Create model from extant data—formulate hypotheses to test model through experimental perturbations of system--hypothesis-driven and hypothesis-generating Data Global data acquisition Integrate multi scale data types Delineate biological network dynamics—temporal and spatial Dealing with biological noise and technical noise in large data sets Formulate models that are predictive and actionable—descriptive, graphical or mathematical. Discovery science is key
16.
17. Institute for Systems Biology Founded 2000—10th Anniversary ISB has 12 faculty and 300 staff
18. ISB’s description of systems biology in 2000 is virtually identical to that of this National Academy of Sciences 2010 report entitled the “New Biology”. ISB was the first Systems Biology organization in 2000—today there are more than 70 world wide Report predicted that systems approaches would drive biology and medicine of the future
19. SCImago Institutions Rankings: http://www.scimagoir.com/ Inst. Nat. de Physique Nucleaire Sanger SSM Cardinal Glennon Children’s Hospital ISB CSHL International Agency for Research on Cancer Kaiser Permanente Brigham and Women’s Hospital Rockefeller Institut Catala d’Investigacio Quimica MIT Salk WHO Harvard HHMI MSFT FHCRC IBM Parc Mediterrani de la Tecnología Centro de Investigación Príncipe Felipe CNRS Chinese Academy of Science Russian Academy of Sciences National Academy of Sciences of Ukraine Tianjin University Harbin Engineering University Research Institute of Petroleum Processing ISB 1st in US and 3rd in World for Impact of Papers
21. dynamics of pathophysiology diagnosis therapy prevention A Systems View of Medicine Postulates that Disease Arises from Disease-Perturbed Networks Non-Diseased Diseased
22. A Systems Approach to a Neurodegenerative Disease (prion disease) in Mice Do the disease-perturbed networks in brain cells explain the pathophysiology of prion disease? Yes
30. FVB/B4053 Prion infected brain RNA from brain homogenate Mouse Genome array: 45,000 probe sets ~22,000 mouse genes. Uninfected brain 7400 DEGs to 333DEGs—signal to noise issues---biological/technical
31. Neuropathology Identifies 4 Networks Microglia / Astrocyte activation PrP accumulation Synaptic Degeneration Nerve cell death Infected Normal
32. Dynamics of a Brain Network in PrionNeuroddegenerative Disease in Mice Prion accumulation network
33. Sequential Disease-Perturbation of the Four Networks of Prion Disease 18~20 wk 22 wk 0 wk Clinical Signs Prion accumulation Glial Activation SynapticDegeneration Neuronal Cell Death Na+ channels Reactive Astrocytes Cholesterol transport Caspases Sphingolipid synthesis Cargo transport Leukocyte extravasation Lysosome proteolysis *Arachidonate metab./Ca+ sig.
34. Making Blood A Window Distinguishing Health and DiseaseOrgan-specific Blood Proteins 110 brain-specific blood proteins/80 liver-specific blood proteins Blood Vessel
35. Why Systems-Driven Blood Diagnostics Will Be the Key to P4 Medicine Early detection Disease stratification Disease progression Follow therapy Assess reoccurances Integrated Diagnostics
36. Disease Stratification – HerceptinWhy Diagnosis/Therapy Must Be Integrated Target treatment… Some women with metastatic breast cancer have tumors that overexpress the HER2 gene and have a poorer response to chemotherapy HercepTest® IHC Pathway® Herceptin + PathVysion® FISH HER2 pharmDx™ Identifying HER2+ patients with genetic (FISH) or immunological (IHC) tests and targeting with Herceptin improves treatment. 50% reduced risk of recurrence after one year
37. The Foundations of Systems Biology and Systems Medicine–Four Pillars View medicine as an informational science Systems approaches allow one to understand wellness and disease—holist rather than atomistic Emerging technologies will allow us to explore new dimensions of patient data space Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease
38. Big Science/Small Science Two types of big science Discovery (human genome project) Integrative, cross-disciplinary, hypothesis driven, focused on concrete objective Small science—individual investigator initiated Big and small science are synergist—and should be integrated Currently an enormous conflict at the NIH funding levels for big science. Should have a balanced portfolio of big and small science.
39. Four ISB Technology-Driven New Big Projects Complete genome sequencing of families—sequences and new stratifications to identify disease genes—1000s individuals The Human Proteome Project—SRM mass spectrometry assays for all human proteins Clinical assays for patients that allow new dimensions of data space to be explored The 2nd Human Genome Project—mining all complete human genomes and their phenotypic/clinical data
40. Whole Genome Sequencing of Families: A New Genomic Strategy Sequencing by Complete Genomics, Inc. D. Galas, J. Roach, G. Glusman and A. Smit at ISB Collaboration with human geneticists at the UW and Utah
41. Whole Genome Sequencing of Family of Four Unaffected parents Children each with 2 diseases--craniofacial malformation (Miller Syndrome) and lung disease (ciliarydyskinesia) Identify 70% of sequence errors using principles of Mendelian genetics —less than 1/100,000 error rate—now 1/ 1,000,000 Discovery of about 230,000 rare variants in family—confirmed by identification in two or more family members Reduce the genome haplotype search space for disease genes—Mendelianhaplotype blocks reduce space to ¼ haplotypes for each individual
42. Genomes of kids 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X ZNF721 DNAH5 KIAA0556 Miller’s gene DHODH Ciliarydyskenesis gene Sibling genomes are identical across ~25% of their length (23.2% here) centromere haploidentical maternal paternal recombination heterochromatin identical error region maternal recombination CNV haploidentical paternal nonidentical candidate gene
43. Family Genome Sequencing May Facilitate Finding Mendeliandisease genes Modifiers of disease genes--sequencing genomes of about 80 Huntington’s patients from families—mostly finished Genes encoding complex genetic diseases after proper patient stratification—Alzheimer’s/Parkinson’s diseases
44. Game Changer—declining cost of sequencing genomes will make them a part of your medical record in 10 years or less
45. The Human Proteome Project Strategic partners: ISB (R. Moritz)/ETH (R. Aebersold)/Agilent/AB-Sciex/Origene
46. 1. Trans Proteomic Pipeline (TPP) components * Commercial software not part of TPP
47. Drives tool development and optimization Advanced, uniform processing of all data 2. TPP: Foundation for PeptideAtlas
48. 3. Targeted Proteomics: Human SRMAtlas 4. SRM assays for most of the known 20,333 human proteins Analyze 100-200 proteins quantitatively in 1 hour 38
49. Making Blood a Window into Health and Disease for 100s millions of patients: 50 organ-specific blood proteins from each of 50 organs Integrated nanotech/microfluidics platform 300 nanoliters of plasma cells out Assay region 5 minute measurement Uses fraction of droplet of blood Assay takes 5 minutes Dynamic range 106 Potential for thousands of protein assays on one chip Jim Heath, et al
51. Individual Patient Information-Based Assays of the Present/ Future (I) Genomics Complete individual genome sequences—predictive health history—will be done sequencing families Complete individual cell genome sequences—cancer. Complete MHC chromosomal sequence in families—autoimmune disease and allergies 200 Actionable SNPs—pharmacogenetics-related and disease-related genes Sequence 1000 transcriptomes—tissues and single cells—stratification disease Analyze aging transcriptome profiles—tissues and single cells—wellness Analyze miRNA profiles—tissues, single cells and blood—disease diagnosis Proteomics Organ-specific blood MRM protein assays—110 brain, 80 liver and 20 lung 2500 blood organ-specific blood proteins from 300 nanoliters of blood in 5 minutes—twice per year (50 proteins from 50 organs)—wellness assessment. New protein capture agents. Array of 13,000 human proteins—against autoimmune or allergic sera--stratify. Single molecule protein analyses—blood organ-specific proteins and single cell analyses
52. Individual Patient Information-Based Assays of the Present/ Future (II) Single cells Analyze10,000 B cells and 10,000 T cells for the functional regions of their immune receptors—past and present immune responsiveness—follow vaccinations—identify autoimmune antibodies. Analyze individual blood macrophages—inflammation, etc. Use pore technology to separate epithelial cells from blood cells—cancer iPS (stem) cells Analyze individual stem (iPS) cells from each individual differentiated to relevant tissues to get important phenotypic information—molecular, imaging and higher level phenotypic measurements.
55. Induced Pluripotent Stem CellsTwo Critical Characteristics What’s so special about iPS cells? Replicate Indefinitely Make all 100s or more cell types in human body Induced Pluripotent Stem (iPS) Cells
56. The Foundation of Systems Biology and Systems Medicine–Four Pillars View medicine as an informational science Systems approaches allow one to understand wellness and disease—holist rather than atomistic Emerging technologies will allow us to explore new dimensions of patient data space Transforming analytic tools will allow us to decipher the billions of data points for the individual--sculpting in exquisite detail wellness and disease
57. Phenome Transcriptome Transactional Epigenome Single Cell iPS Cells Social Media TeleHealth UUAGUG AUGCGUCUAGGCAUGCAUGCC Na143 K 3.7 BP 110/70 HCT32 BUN 12.9 Pulse 110 PLT150 WBC 92 110101000101010101101010101001000101101010001 110101000101010101101010101001000101101010001 110101000101010101101010101001000101101010001 110101000101010101101010101001000101101010001 110101000101010101101010101001000101101010001 110101000101010101101010101001000101101010001 Genome GCGTAG ATGCGTAGGCATGCATGCCATTATAGCTTCCA Proteome arg-his-pro-gly-leu-ser-thr-ala-trp-tyr-val-met-phe-asp-cys In 10 years a Virtual Cloud of Billions of Data Points Will Surround Each Individual
59. Predictive, Personalized, Preventive and Participatory (P4) Medicine Driven by systems approaches to disease, new measurement (nanotechnology) and visualization technologies and powerful new computational tools, P4 medicine will emerge over the next 10-20 years 49
61. ISB Strategic Partnerships: Objectives Critical to fulfill ISB’s mission of attacking big scientific problems Complementary scientific/medical expertise New funding resources Assess to new patient materials and records Access to novel technologies and analytic tools Gather the best scientists in the world to do big science—integrative, cross-disciplinary, hypothesis-driven science.
62. ISB’s Strategic Partners for P4 Medicine Develop the P4 tools and strategies for patient assays—State of Luxembourg--$100 million over 5 years Bring P4 medicine to patients with the creation of the non-profit P4 Medical Institute (P4MI) in partnership with Ohio State Medical School—two pilot projects—wellness and heart failure
63. ISB/LuxembourgStrategic Partnership Helping to creating a Center for System biomedicine similar to ISB—Rudi Balling Director—recruit and training of personnel Helping establish biotech industry in Luxembourg—start ups and established companies--integrated personalized medicine company—Integrated Diagnostics Two collaborative research projects--$100 million to ISB over 5 years
64. The P4 Medicine Institute (http://www.P4MI.org) Non-profit 501c3--ISB and Ohio State founding members Vision--identify, recruit and integrate strategic partners with ISB to bring P4 medicine to patients—create a small network of large and small medical centers Convince a skeptical medical community through demonstration with two Ohio pilot projects (and others)—wellness and heart failure—exhibit success and power of P4 medicine Seek academic and industrial partners who share the P4 vision and have complementary skills/resources Bringing on consultants to analyze the societal challenges of P4 medicine—ethics, security, confidentiality, policy, regulation, economics, etc.
78. Alexandria Real Estate Investment CorpAccelerator Corporation 1616 Eastlake Avenue East Carl Weissman CEOSeattle CEO: Carl Weissman Location: Seattle – 10 minute drive from ISB
79. Essential Components for Starting Companies A good scientific idea that creates a marketable product Clear business plan that is milestone driven Good management—the CEO is critical Capital—with staying power if the company is successful—in biotech company development is expensive and takes time Those who can critically evaluate startups—and can select the 1/100 successful companies—this is critical Skilled workforce—good young scientists A clearly formulated one or more provisional exit strategies Entrepreneurial scientists—with an inclination to think about how their science can be transferred to society—how do we train? Fostering serial entrepreneurs A source of good science for company ideas—usually outstanding academic centers Intellectual property is key National and international opportunities for funding
81. Conceptual Themes of P4 Medicine Disease Demystified Wellness Quantified P4 Medicine Predictive Preventive Personalized Participatory
82. P4 Medicine Will Transform the Health Care Industry Healthcare System Will impact the health care system significantly: Pharmaceuticals Biotechnology Diagnostics IT for healthcare Healthcare industry Health insurance Medicine--diagnostics, therapy, prevention, wellness Nutrition Assessments of environmental toxicities Academia and medical schools Fundamentally new ideas need New organizational structures
83. Digitalization of Biology and Medicine Will Transform Medicine Analysis of single molecules, single cells, single organs and single individuals I Phone-like device with digitalize personal records—monitoring and access A revolution that will transform medicine even more than digitalization transformed information technologies and communications Digitization of medicine will lead to dramatically lower healthcare costs Single cell Single molecule Single individual
84.
85. Systems analysis of biology and medicine--e.g., ability to attack big problems such as P4 medicine
90. Biomedical Challenges at Skolkovo What type of science will be done? What is leading-edge? Systems medicine offers unique potential—for understanding disease mechanisms, the need for intimate integration of diagnosis and therapy as well as new strategies for drug target discovery. Include non-profit (academic) as well as for profit? How can you enable company creation? How can you attract existing companies? What are appropriate non-profit models? Will you try and recruit back Russian scientists from abroad—or will you do it will resident Russian scientists? Will the Skolkovo money compete with that for other Russia sciences (or the National Academy)? If so, expect resistance. Will you employ strategic partnerships to jump start the creation of Skolkovo? If so, resources will have to go to strategic partners. Will you reform your current academic science in keeping with the bold Skolkovo initiative? Two keys: give young scientists an opportunity and resources to direct their own science at an early age and realize the essential nature of good peer review in the allocation of science resources.
