1. ORIGINAL ARTICLE
The Human Cystatin M/E Gene (CST6): Exclusion
Candidate Gene For Harlequin Ichthyosis
Patrick L. J. M. Zeeuwen, BeverlyA. Dale,n Gys J. de Jongh, Ivonne M. J. J. van Vlijmen-Willems,
Philip Fleckman,n Janet R. Kimball,n Karen Stephens,n and Joost Schalkwijk
Department of Dermatology, University Medical Center Nijmegen, Nijmegen, the Netherlands; nDepartments of Oral Biology, Biochemistry, Laboratory
Medicine, and Medicine/Dermatology & Medical Genetics, University of Washington, Seattle,Washington, USA
Cystatin M/E is a recently discovered cysteine protei-nase
inhibitor whose expression is largely con¢ned to
cutaneous epithelia. In human skin it is expressed in
sweat glands, hair follicles, and stratum granulosum of
the epidermis where it presumably acts as a substrate
for transglutaminase. Very recently we reported that a
null mutation in the mouse cystatin M/E gene (Cst6)
causes the murine ichq phenotype, which is character-ized
by abnormalities in corni¢cation and desquama-tion,
demonstrating an essential role for cystatin M/E
in the ¢nal stages of epidermal di¡erentiation.We here
obtained the complete sequence of the human cystatin
M/E gene (CST6), which provides a tool to investigate
CST6 as a candidate gene in skin diseases characterized
by abnormal corni¢cation. The involvement of CST6 in
harlequin ichthyosis in humans was evaluated by se-quencing
the entire coding region and intron^exon
boundaries for mutations in 11 sporadic harlequin
ichthyosis patients. No CST6 mutations were detected
in this group, which comprised type 1 and type 2 harle-quin
ichthyosis patients. Disturbed transcription/trans-lation
due to mutations in regulatory and noncoding
regions of cystatin M/E was unlikely because cystatin
M/E protein expression was observed in all patients
examined, as assessed by immunohistochemistry.
Although our results indicate that CST6 is not a major
gene contributing to type 1 and 2 harlequin ichthyosis,
these data may facilitate further analysis of the role of
cystatin M/E in normal human skin and other genetic
disorders of corni¢cation. Key words: cysteine proteinases/
hair follicle/mouse mutation/skin/stratum corneum. J Invest
Dermatol 121:65 ^68, 2003
We have previously reported that a new member
of the human cystatin superfamily, named cy-statin
M/E (Ni et al, 1997; Sotiropoulou et al,
1997), has an unusually tissue-speci¢c expres-sion
pattern, which is largely limited to cuta-neous
epithelia (Zeeuwen et al, 2001, 2002a). Cystatin M/E is a 14
kDa secreted protein that shares 30^35% homology with the hu-man
family 2 cystatins. It has a similar overall structure such as a
signal peptide and two intrachain disul¢de bonds, but possesses
the unusual characteristic of being a glycoprotein. The reported
tissue-speci¢c expression pattern is in contrast with other cystatin
family members, which are mainly ubiquitously expressed. CST6
has been assigned to chromosome 11q13 (Stenman et al, 1997),
whereas all other family type 2 cystatin genes are clustered in a
narrow region on chromosome 20p11.2 (Schnittger et al, 1993),
which further suggests that cystatin M/E is an atypical protein
and only distantly related to the other known family members.
We have shown that cystatin M/E could act as a substrate for epi-dermal
transglutaminases suggesting a role in the formation of
the stratum corneum (Zeeuwen et al, 2001), which integrity is
maintained by continuous renewal and shedding of old corneo-cytes
at the skin surface.This process of desquamation is the ¢nal
event in terminal di¡erentiation of the epidermis and is likely to
be regulated by the concerted action of proteolytic enzymes and
their inhibitors (Egelrud and Lundstrom, 1991; Kalinin et al,
2001). Recently we demonstrated that homozygosity for a null
mutation in the cystatin M/E gene (Cst6) of ichq mice is responsi-ble
for juvenile lethality and defects in epidermal corni¢cation
and desquamation (Zeeuwen et al, 2002b). Sundberg et al (1997)
previously described the mouse ichq mutant, which presents as
an ichthyosiform dermatitis. The ichq mouse phenotype includes
hyperkeratosis, abnormally large mitochondria, absence of lamel-lar
granules, and a characteristic keratin expression pattern in the
interfollicular epidermis; some of these morphologic and bio-chemical
features are similar to human type 2 harlequin ichthyo-sis
(HI), suggesting that the ichq mouse might be a good model
for the human disorder. HI (MIM 242500) is a severe congenital
skin disorder usually leading to a stillborn fetus or early neonatal
death. Its clinical features at birth include ectropion, eclabium, ear
dysmorphology, and a thickened ¢ssured epidermis (Williams
and Elias, 1987). Histopathologically, HI is characterized by exces-sive
epidermal and follicular hyperkeratosis. Biochemical and ul-trastructural
abnormalities have suggested genetic heterogeneity
and division into three subtypes (Dale et al, 1990; Dale and Kam,
1993; Akiyama et al, 1998). These three subtypes have been de¢ned
based on expression of epidermal structural proteins; in types 1
and 2 pro¢laggrin is expressed but not processed to ¢laggrin,
whereas type 3 lacks pro¢laggrin; types 2 and 3 both have kera-tins
6 and 16 in addition to the normal keratins 5/14 and 1/10 seen
Manuscript received November 4, 2002; revised December 16, 2002;
accepted for publication February 20, 2003
Address correspondence and reprint requests to: Patrick L. J. M. Zeeu-wen,
Department of Dermatology, University Medical Center Nijmegen,
Nijmegen Center for Molecular Life Sciences, PO Box 9101, 6500 HB
Nijmegen, the Netherlands. Email: p.zeeuwen@derma.umcn.nl
0022-202X/03/$15.00 . Copyright r 2003 by The Society for Investigative Dermatology, Inc.
65

2. 66 ZEEUWEN ETAL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
in all three subtypes. As HI is an extremely rare congenital and
usually lethal disease in humans, its etiology and pathogenesis
have been di⁄cult to investigate. Prior to the identi¢cation of
Cst6 as the causative gene in ichq mice, several candidate genes in
the ichq region of mouse chromosome 19 (Capn1, Plcb3, Rela, and
Ikka/Chuk) and in the homologous region on human chromo-some
11q13 (CAPN1 and RELA) were tested and excluded as cau-sative
for the HI phenotype (Dunnwald et al, 2003); however, the
identi¢cation of Cst6 as causative in ichq mice provides an excel-lent
tool to investigate CST6 as a candidate gene in human
HI. Furthermore, this knowledge could be valuable to study the
pathophysiology and biochemical mechanisms of skin diseases
characterized by abnormal corni¢cation. In this study, we report
CST6 genomic organization and the mutational analysis of
the entire coding region of the gene in 11 individuals a¡ected
with HI.
MATERIALS AND METHODS
Cloning and sequencing An incomplete sequence of CST6 was
obtained by aligning (ClustalW, http://searchlauncher.bcm.tmc.edu/)
genomic and mRNA sequences found in the public database (GenBank
accession nos. U62800, AJ328230, NT_033241, AK092391). In order to
close the remaining sequence gap in intron 1, we designed two
oligonucleotide primers based on the known cDNA sequence of cystatin
M/E, which could amplify a genomic fragment that includes intron 1;
forward primer, 50 -ATGGCGCGTTCGAACCTCC-30; and reverse
primer, 50 -GTACTTGATGCCGGCCACC-30. Polymerase chain reactions
(PCR) were carried out using the GC-RICH PCR System (Roche
Diagnostics, Mannheim, Germany) according to the protocol provided
by the manufacturer. As a template for the PCRwe used genomic DNA
isolated from the whole blood of healthy volunteers. The E 800 bp
ampli¢cation product was cloned into plasmid Topo-TA (Invitrogen,
Carlsbad, California) and the insert was sequenced, using the vector
primers, at the DNA Sequencing Facility, Department of Human
Genetics, UMCN, Nijmegen, the Netherlands. The GC-rich part of
intron 1 was sequenced by BaseClear Labservices, Leiden, the
Netherlands. The sequencing primers (¢rst sense then anti-sense) that
are used to complete the CST6 sequence were, 50 -ATGGGGTGGA
TCGGGGAGGA-30; and 50-GGGTCTTGACCCTTGATCCTCACT-30.
Patients and mutation analysis Eleven sporadic cases of HI, which
comprised type 1 and type 2, were investigated. A group of eight cases
were classi¢ed as two type 1 HI cases and six type 2 HI cases (Dale et al,
1990). Four of these cases were previously described (Dale et al, 1990; Dale
and Kam, 1993). The remaining three cases could not be classi¢ed by
phenotype. Two of them were previously published as a case report
(Herterich et al, 1993; Stewart et al, 2001), and one case was not published
before. Exons of the CST6 gene were PCR ampli¢ed using intron-speci¢c
primers and 100 ng genomic DNA (Table I). PCRwere carried out using a
DNA thermal cycler (TB1, Biometra, G˛ttingen, Germany) in 25 mL
mixtures. The following bu¡er conditions were used: 10 mM Tris^HCl,
pH 9.0, 1 to 1.5 mM magnesium chloride, 50 mM potassium chloride,
0.1% Triton X-100, all four deoxyribonucleoside triphosphates (each at
200 mM), 1 unit of Taq DNA Polymerase (Promega, Madison,Wisconsin),
and 20 pmol of each primer. After an initial incubation of 6 min at 941C
ampli¢cation was conducted for 35 cycles as follows: 1 min at 941C, 1 min
at annealing temperature and 2 min at 721C. An additional 10 min at 721C
was used for the last cycle. For precise PCR conditions see Table I.
Ampli¢cation products were puri¢ed, and sequencing was performed on
both strands with the same ampli¢cation primers at the DNA Sequencing
Facility, Department of Human Genetics, UMCN, Nijmegen, the
Netherlands.
Immunohistochemistry Human autopsy or biopsy material from HI
patients was processed for immunohistochemistry as previously described
(Zeeuwen et al, 2002a). Immunohistochemical staining was performed as
previously described using a⁄nity-puri¢ed polyclonal rabbit antibodies
directed against human cystatin M/E (Zeeuwen et al, 2001). Antigen
retrieval procedures were not necessary.
RESULTS
Genomic organization of CST6 At the time we started this
investigation the CST6 gene was partially represented in the
public databases by a number of genomic and mRNA entries,
but hitherto no complete genomic sequence was available.
Using a system that facilitates PCR on GC-rich templates we
completed the genomic sequence of cystatin M/E (deposited as
CST6 in the GenBank database, accession no. AY145051). At
present, the full-length gene can also be extracted from a
sequence derived from human genomic chromosome 11 DNA,
which has recently been deposited in the public database
(GenBank accession no. AP001201); however, there are still
minor divergences between the sequenced part of intron 1 of
this entry compared with our sequence data. The CST6 gene is
organized in three exons and two introns, and from the
translation start site to the translation termination site it spans
1354 bp of genomic DNA. Exon^intron boundaries were
established using the cystatin M/E cDNA sequence as described
previously (Sotiropoulou et al, 1997), and by the identi¢cation of
conserved splice site consensus sequences. Analysis of the
genomic sequence revealed a polyadenylation signal in the 30 -
noncoding region of the gene; however, no identi¢able CAAT-box
or TATA-box were found in the 50 -£anking sequence. The
ATG start codon of CST6 lies in a Kozak consensus sequence
(Kozak, 1987). Database analysis (http://fruit£y.org/cgi-bin/
seq_tools/promoter.pl) predicted three transcription start sites
at, respectively, ^75 bp, ^42 bp, and ^34 bp upstream to
the translation initiation codon. This is in accordance with the
average length of the expressed sequence tags found in the
public database, in which the start positions vary between
approximately ^60 bp and ^20 bp.
Mutation analysis of CST6 in HI patients The major e¡ect
due to the absence of cystatin M/E in ichq mice appears to be on
the corni¢cation or desquamation process, which most likely
induces juvenile lethality of these mice (Zeeuwen et al, 2002b).
As this matches the most striking clinical feature of HI in
humans, we investigated CST6 as a disease causing candidate
gene in human HI. The entire protein-coding region plus
intron^exon boundaries of CST6 were screened for mutations in
11 HI patients using a set of intron-speci¢c primers (Table I). No
causative mutations for HI have been detected in the CST6 gene.
Cystatin M/E expression in HI patients The expression of
cystatin M/E was examined in skin biopsies of HI type 1 and
type 2 patients using a⁄nity-puri¢ed polyclonal antibodies
against recombinant cystatin M/E. We found cystatin M/E
expression in di¡erentiated keratinocytes of the infundibular
epithelium of hair follicles (Fig 1a), and in the stratum
granulosum of the interfollicular epidermis (Fig 1b). In contrast
to the expression pattern as previously observed in normal adult
skin (Fig 1d) (Zeeuwen et al, 2001, 2002a) we found no cystatin
M/E immunolocalization in the secretory coil epithelium of
Table I. Primers and PCR conditions used for analysis of the CST6 gene
Exon Forward Reverse Product Size (bp) Annealing Temp (1C) MgCl2 (mM)
1 GCTCGGCACTCACGGCTCTG GGAGGCAGAATGCGACCAGGC 102 59 1
ATGGCGCGTTCGAACCTCC TCCCAGCACCCCGCCCGCC 263 55 1
2 GGGCAACAGGAGAATATATC CAAACCAGTTCAGGATGGAC 285 54 1.5
3 TCAGTGATTGTCCCTCTCTTG TGACAGATACGGCCCACGG 277 53 1

3. EXCLUSION VOL. 121, NO. 1 JULY 2003 OF CST6 AS CANDIDATE GENE FOR HI 67
Figure 1. Immunohistology of HI skin. Formalin-¢xed sections of biopsies were incubated with puri¢ed rabbit anti-cystatin M/E polyclonal antibo-dies.
(A) Hair follicle in epidermal skin of HI type 1. Strong staining of di¡erentiated keratinocytes of the infundibular epithelium. (B) Skin of HI type 2.
Staining of cystatin M/E was observed in the stratum granulosum just beneath the thick stratum corneum. SC, stratum corneum; SG, stratum granulosum;
SB, stratum basale. (C) Sweat glands in the skin of HI type 2. The secretory coils (arrows) as well as the ductal part of the glands are both completely
negative. (D) The secretory coil epithelium of the eccrine sweat glands in normal adult skin is strongly positive (arrows), whereas the ductal part shows a
more di¡use staining for cystatin M/E (arrowheads). (E) Skin of age-matched control (neonatal skin, 3 mo of age) shows a normal cystatin M/E staining
pattern of the stratum granulosum. (F) Sweat glands in neonatal skin (1mo of age). The secretory coil epithelium of the eccrine sweat glands shows a very
di¡use to absent staining for cystatin M/E. Scale bars: (A) 50 mm; (B^F) 25 mm.

4. 68 ZEEUWEN ETAL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
eccrine sweat glands (Fig 1c). Samples of neonatal skin (1 and 3
mo of age) that were used as age-matched controls also showed
an almost complete absence of cystatin M/E expression in the
secretory coil epithelium of eccrine sweat glands (Fig 1f),
whereas the staining pattern in the stratum granulosum of these
neonatal skin was similar to that of adult epidermis (Fig 1e).
DISCUSSION
In this paper, we report the genomic organization of the human
CST6 gene and mutational analysis in HI patients. CST6 contains
three exons within E1.4 kb of genomic sequence. Characteriza-tion
of the genomic sequence of CST6 shows some di¡erences
with the other cystatin 2 family members.We found that the size
of both introns was remarkably smaller compared with other cy-statin
family 2 members (e.g., cystatin S, SA, SN, C, D). These
cystatins harbor introns of, respectively, 1.1 to 2.2 kb, whereas
the introns of the CST6 gene are only 542 bp and 365 bp long.
Besides these family 2 cystatins contain an identi¢able TATA-box
in their 50 -£anking sequence, whereas CST6 lacks this conserved
sequence.
As we have recently reported that a null mutation in the mouse
cystatin M/E gene causes the HI phenotype, we evaluated the in-volvement
of CST6 in human HI patients. In this study, we could
not detect any disease causing mutations in CST6 coding regions
or splice sites among the 11 HI patients we have analyzed.With
this work and that of Dunnwald et al (2003), three genes in the
11q13 region have been eliminated as causative for human type 1
and 2 HI. A normal cystatin M/E expression pattern in the skin
of HI patients was observed, except for the secretory coils of
sweat glands, where cystatin M/E appeared to be absent. The pre-sence
of immunoreactive cystatin M/E protein suggests that de-fects
in transcription/translation due to mutations in noncoding
sequences, are unlikely to be the cause of disease in this group of
patients. The cystatin M/E de¢ciency in the sweat glands of these
neonatal skin samples was surprising, as in normal adult human
skin the sweat glands are strongly positive. To investigate this we
used age-matched controls for the expression of the protein. In-terestingly,
we con¢rmed the absence of strong cystatin M/E ex-pression
in sweat glands, in samples of neonatal skin (1 and 3 mo
of age). This ¢nding con¢rms a previous observation that di¡er-ences
exist in the maturation and regulation of di¡erentiation be-tween
epidermis and sweat ducts (Dale et al, 1990).Taken together,
these data indicate that CST6 is unlikely to be a major gene re-sponsible
for type 1 and 2 HI. The genomic organization of the
CST6 gene and the designed primer sets described in this study
will facilitate further investigation of other HI patients, in parti-cular
type 3 patients, which were not included in this study. As
HI is a very heterogeneous disease, it could still be possible that
the underlying gene defect in some sporadic HI cases could be
due to mutations in CST6. These data also may facilitate studies
regarding the role of cystatin M/E in normal skin or as a candi-date
gene for other genetic disorders of corni¢cation and desqua-mation.
We speculate that cystatin M/E plays an important part in
keratinization, and is a crucial protein in pathways leading to
terminal di¡erentiation of epidermal keratinocytes. The analysis
of the function of cystatin M/E and the identi¢cation of its puta-tive
target proteinase is clearly a direction for future research.
We thank Dr H.A. van den Bergen (Laboratory of Pathology, Isala Klinieken,
Zwolle, the Netherlands), Prof. Peter Steijlen (Department of Dermatology, Univer-sity
Medical Center, Nijmegen, the Netherlands), Dr Jill Clayton-Smith (Depart-ment
of Clinical Genetics, St Mary’s Hospital, Manchester, UK), Dr Nicole JoyeŁ
and Dr Mary Gonzales (Laboratoire D’embryologie Pathologique et de CytogeŁ
neŁ-tique,
Ho“spital Saint-Antoine, Paris, France), Dr Keith Meredith (Neonatology,
Memorial Hospital, Colorado Springs, Colorado), Dr Lakshmi Mehta (Genetics,
North Shore Hospital,Manhasset, NewYork), DrMichael He¡ernan (Dermatology,
Washington University, St Louis, Missouri), Dr Linda Seely and Dr Sheldon Kor-ones
(Reproductive Genetics, University ofTennessee, Memphis,Tennessee), DrVin-nie
Biggs (Pediatrics, Northern Navajo Medical Center, Shiprock, New Mexico), Dr
David Witt (Dermatology, Kaiser-Permanente, San Jose, California), Dr Denize
Main (Genetics, California Paci¢c Medical Center, San Francisco, California) and
Dr Ephraim Kam (Seattle,Washington), and Dr M. Levy (Dermatology, Texas
Childrens Hospital, Houston, Texas) for providing patient samples. This work was
¢nancially supported by grant 902.11.092 from the Netherlands Organization for
Scienti¢c Research (NWO), by US PHS NIH grant P01 AR21557 and by the
Odland Endowed Research Fund.
REFERENCES
Akiyama M, Dale BA, Smith LT, Shimizu H, Holbrook KA: Regional di¡erence in
expression of characteristic abnormality of harlequin ichthyosis in a¡ected fe-tuses.
Prenat Diagn 18:425^436, 1998
Dale BA, Kam E: Harlequin ichthyosis.Variability in expression and hypothesis for
disease mechanism. Arch Dermatol 129:1471^1477, 1993
Dale BA, Holbrook KA, Fleckman P, Kimball JR, Brumbaugh S, Sybert VP: Het-erogeneity
in harlequin ichthyosis, an inborn error of epidermal keratinization:
Variable morphology and structural protein expression and a defect in lamellar
granules. J Invest Dermatol 94:6^18, 1990
Dunnwald M, Zuberi AR, Stephens K, Le R, Sundberg JP, Fleckman P, Dale BA:
The ichq mutant mouse, a model for the human skin disorder harlequin
ichthyosis: Mapping, keratinocyte culture, and consideration of candidate
genes involved in epidermal growth regulation. Exp Dermatol 2003: in press,
Egelrud T, Lundstrom A: A chymotrypsin-like proteinase that may be involved
in desquamation in plantar stratum corneum. Arch Dermatol Res 283:108^112,
1991
Herterich R, Hofweber K, Hammerschmid K, Steijlen PM, Happle R: Harlequin-
Ichthyosis. Erfolgreiche Therapie mit oralen Retinoiden. Padiatr Praxis Z Kin-der-
Jugendmedizin 46:93^99, 1993
Kalinin A, Marekov LN, Steinert PM: Assembly of the epidermal corni¢ed cell
envelope. J Cell Sci 114:3069^3070, 2001
Kozak M: At least six nucleotides preceding the AUG initiator codon enhance
translation in mammalian cells. J Mol Biol 196:947^950, 1987
Ni J, Abrahamson M, Zhang M, et al: Cystatin E is a novel human cysteine protei-nase
inhibitor with structural resemblance to family 2 cystatins. J Biol Chem
272:10853^10858, 1997
Schnittger S, Rao VV, Abrahamson M, Hansmann I: Cystatin C (CST3), the candi-date
gene for hereditary cystatin C amyloid angiopathy (HCCAA), and other
members of the cystatin gene family are clustered on chromosome 20p11.2.
Genomics 16:50^55, 1993
Sotiropoulou G, Anisowicz A, Sager R: Identi¢cation, cloning, and characterization
of cystatin M, a novel cysteine proteinase inhibitor, down-regulated in breast
cancer. J Biol Chem 272:903^910, 1997
Stenman G, Astrom AK, Roijer E, Sotiropoulou G, Zhang M, Sager R: Assignment
of a novel cysteine proteinase inhibitor (CST6) to 11q13 by £uorescence in situ
hybridization. Cytogenet Cell Genet 76:45^46, 1997
Stewart H, Smith PT, Gaunt L, et al: De novo deletion of chromosome 18q in a baby
with harlequin ichthyosis. AmJ Med Genet 102:342^345, 2001
Sundberg JP, Boggess D, Hogan ME, et al: Harlequin ichthyosis (ichq): A juvenile
lethal mouse mutation with ichthyosiform dermatitis. AmJ Pathol 151:293^310,
1997
Williams ML, Elias PM: Genetically transmitted, generalized disorders of corni¢ca-tion.
The ichthyoses. Dermatol Clin 5:155^178, 1987
Zeeuwen PL, Vlijmen-Willems IM, Jansen BJ, et al: Cystatin M/E expression is
restricted to di¡erentiated epidermal keratinocytes and sweat glands: A
new skin-speci¢c proteinase inhibitor that is a target for cross-linking by
transglutaminase. J Invest Dermatol 116:693^701, 2001
Zeeuwen PL, Vlijmen-Willems IM, Egami H, Schalkwijk J: Cystatin M/E
expression in in£ammatory and neoplastic skin disorders. Br J Dermatol
147:87^94, 2002a
Zeeuwen PL, Vlijmen-Willems IM, Hendriks W, Merkx GF, Schalkwijk J: A null
mutation in the cystatin M/E gene of ichq mice causes juvenile lethality and
defects in epidermal corni¢cation. Hum Mol Genet 11:2867^2875, 2002b