2. Division of Entomology
FOH, SHALIMAR SKUAST-K
DOCTORAL CREDIT SEMINAR-II
(ENTO-692)
Speaker : WASIM YOUSUF MIR
Registration number : 2020-1029-D
Seminar title : Molecular Taxonomy – A Way Forward
Seminar incharge : Dr. Zakir Husain Khan
Dr. Barkat Hussain
2
9. 9
Limitations of Traditional Taxonomy
Variations in taxonomically
important traits
Inadequate morphology based
approach to species identification
Requires high level of expertise for
species identification
10. The new horizon of ‘Taxonomy’
Nucleic
acid
Protein
Molecular
Taxonomy
10
11. 11
The classification of organisms on
the basis of the distribution and
composition of chemical substances
in them
14. 14
Origin of
“Molecular Taxonomy”
“We establish that the mitochondrial gene
cytochrome c oxidase I (COI) can serve
as the core of a global bio-identification
system for animals”
(Proceedings of Royal Society of London, 2003)
Paul D N Hebert (Born: 1947)
Image source: Official Website, University of Guelph, Canada
15. 15
DNA barcoding first came to the attention
in 2003 when Paul Hebert’s research group
published a paper titled "Biological
identifications through DNA barcodes`
19. Uses of DNA Barcoding
• Identification of biotypes/genetic groups.
• Quarantine stations.
• Conservation biology and biodiversity.
• Fragments of insects can be used.
• Biosecurity.
• Determination of food webs
• Molecular phylogeny.
19
20. 20
Tools used in molecular taxonomy
DNA barcodes
A 648 base-pair region in the Mitochondrial cytochrome c
oxidase 1 gene (COI) highly effective in identifying birds,
butterflies, fish, Insects and many other animal groups.
o Bacteria: 16s ribosome
o Plants: Plastid DNA (matK gene)
o Animals: Mitochondrial DNA (COI gene)
21. DNA Barcode generated for the following
natural enemies and pests
21
Parasitoids DNA barcode
Trichogramma achaeae TRINB001-10
T. brassicae, T. chilotreae TRINB002-10, TRINB003-10
T. Chilonis TRINB004-10
T. dendrolimi TRINB005-10
T. flandersi TRINB006-10
Predator DNA barcode
Chrysoperla zastrowi sillemi
CZASG001-10
30. 30
Case study 1: DNA barcoding of flies commonly prevalent in
poultry farms of Bengaluru District
(Archana et al., 2016)
Specimens of flies collected from 11 different poultry farms
Larval form
Adult form
Larva reared to form adult
Identification:
Morphological
Adult identification
• Length of fly
• Eyes
• Antennae
• Wing pattern
• Colour of flies
• Head pattern
• Thorax pattern
Larval identification
• Length of larvae
• Integument
• Spines
• Cephalopharyngeal
skeleton
• Respiratory structures
such as anterior and
posterior spiracles.
33. 33
Case study 2: Identifying the larva of Syrphid fly Merodon avidus
(Diptera: Syrphidae)
Merodon specimen collected from Cerdap National Park, Eastern Serbia from the
bulbs of grass lily, Ornithogalum umbellatum
Total genomic DNA extracted from 50 mg of larval tissue
Sequences retrieved from GenBank:
Merodon clavipes (HE653247)
Merodon desuturinus (DQ387899)
Merodon avidus (DQ845109)
Merodon italicus (HE653253)
Merodon loewi (DQ885923);
Merodon nigritarsis (DQ386323);
Merodon pruni (HE653260)
Merodon rufus (KM507174)
Merodon trebevicensis (DQ885919)
Merodon velox (HE653265)
Specie recognised through mt DNA sequencing: Merodon avidus
(Andric et al., 2014)
34. 34
Morphological description of Merodon avidus larva:
Overall appearance:
• Length 8.6 mm and greatest width 3.1 mm
• “Short tailed” larva with external mouth-hooks and sclerotised mandibular
lobes. Uniformly beige to brown in colour.
• Sub cylindrical in cross-section, tapered anteriorly, with the anal segment
inclined dorsally.
• Integumental vestiture well-developed, with short, blunt and slightly
sclerotised spicules smaller on the ventral surface.
• Prolegs absent.
• Anal segment with two pairs of lappets
Larva in ventral view (mh-mouth hooks; prp- posterior respiratory process)
35. 35
Am- antenno maxillary organs; mh- mouth hooks; as- anterior spiracles; pps – primordia of pupal spiracles
Head
Primordia of pupal spiracles
Thorax
(Andric et al., 2014)
37. 37
Case study 3 : Use of DNA barcodes to identify invasive
armyworm Spodoptera species in Florida
Spodoptera species not reported in Florida:
Spodoptera litura
Spodoptera littoralis
Collection of Spodoptera species present in area using pheromone traps
DNA barcoding of S. litura and S. littoralis as collected from Taiwan and Portugal
respectively
Comparison of DNA barcodes between the locally collected and exotic
specimens
Discrimination of the different species obtained using morphological
characteristics
Derivation of DNA barcoding data base to aid further studies and monitoring
(Nagoshi et al., 2011)
38. 38
Case study 4 : DNA barcoding of Indian ant species based on
cox1 gene
Sixteen species of ants collected from Karnataka, India
Specimens sequenced and barcoded for 658 bp region of mitochondrial
cytochrome c oxidase subunit 1 gene (cox1)
Species collected
Camponotus irritans
C. parius
C. compressus GR-17
C. Compressus
Anoplolepis gracilipes
Oecophylla samaragdina
Paratrechina longicornis
Plagiolepis sp.
Aphaenogaster beccarii
Pheidologeton diversus
Solenopsis geminata
Monomorium scabriceps
Myrmicaria brunnea
Leptogenys chinensis
Technomyrmex albipes
Tapinoma melanocephalum
(Ojha et al.,2014)
45. Case study 6:Molecular identification of Geometrid moths on BLAST
similarity bases in Kashmir valley Deelak Amin 2020
Species identification Gene
sequence
Identification
percentage
Accession no. New accession No.
allotted by NCBI
Alcis repandata COI 99.73 % KX071762.1 MN689335
Alcis vaeiegate COI 95.76% KX072097.1 MN689347
Alcis jubata COI 100 % MH522795.1 MN689352
Alcis perpicuata COI 96.03% MH522795.1 MN689360
Hypomecis infixaria COI 96.42 % KF394488.1 MN689349
Arichanna lapsariata COI 96.24 % KJ183242.1 MN689327
Antipercnia cordiforma COI 100 % KF522339.1 MN689351
Antipercnia
pseudoalbinigrata
COI 94.49 % KF522338.1 MN689324
Ascotis selenaria COI 100 % LC047740.1 MN689337
Ascotis imparata COI 96.18 % KX047239.1 MN689334
Lassaba contaminata COI 100 % KX951570.1 MN689342
45
46. 46
Chorodna baramulia COI 97.42 % KF394785.1 MN689336
Medasina albidaria COI 100 % JQ344892.1 MN689361
Psilalcis inceptaria COI 96.33 % KX951566.1 MN689343
Opisthograptis moelleri COI 100 % KF522465 MN689345
Ourapteryx pluristrigata COI 95.19 % KX863183.1 MN689331
Ourapteryx sambucaria COI 95.46 % KX043018.1 MN689338
Ourapteryx
caschmirensis
COI 96.46 % KX071652.1 MN689339
Ourapteryx sambucaria COI 100 % KX043018.1 MN689325
Cepphis advenaria COI 100 % KX071413.1 MN689358
Eutrapela clemataria COI 100 % MG357360.1 MN689356
Abraxas cashmiria sp. COI 96.07 % KX043487.1 MN689326
Biston betularia COI 100 % KT145262.1 MN689344
Biston suppressaria COI 100 % KF748229.1 MN689346
Thinopteryx crocoptera COI 100 % KF522515.1 MN689330
Lomographa tributaria COI 100 % KU381109.1 MN689354
CONTD.
47. 47
Odontopera bidentata COI 100 % KX788620.1 MN689357
Psyra bluethgeni COI 100 % AB265329.1 MN689362
Aspitates pseudogilvaria COI 96.07 % MH522797.1 MN689353
Tanaoctenia haliaria COI 100 % JN269164.1 MN689329
Xenoplia kashmirensis COI 94.08 % KX951577.1 MN689348
Heterothera quadrifulta COI 96.61 % HM876588.1 MN689355
Callipia vicinaria COI 100 % MF422047.1 MN689333
Photoscotosia miniosata COI 100 % KX862449.1 MN689332
Aplocera plagiata COI 100 % KX343550.1 MN689363
Pingasa ruginaria COI 100 % HM422803.1 MN689340
Pachyodes amplificata COI 100 % MG014818.1 MN689328
Chlorissa viridata COI 100 % HM391782.1 MN689359
Problepsis albidior COI 100 % MH197457.1 MN689341
CONTD.
48. Case study 7: Molecular identification of Giant yellow
aphids(GWA), Tuberolachnus salignus based on mtCOI region
Hussain et al.,2020
The mtCOI region of the insect was amplified using universal primers
LCO1490: GGTCAACAAATCATCATAAAGATATTGG
HCO2198: TAAACTTCTGGATGTCCAAAAAATCA
48
49. Phylogenetic tree showing genetic relatedness among population using
Maximum Parismony Method
Hussain et al.,2020
49
50. Case study 8: Sequence of different RAPD-primers used for
molecular differentiation among different generations of ERM
selected through repeated applications of fenazaquin
Dr. Asma sherwani 2006
50
51. 51
Conclusion
With the existence of millions of species and significant variations in their life-
stage, the correct identification becomes a challenge task for taxonomy.
The new method called DNA barcoding, a tool of molecular taxonomy is used
to identify known and unknown species on the basis of the pattern of
nucleotide arrangement in a fragment of DNA from target species.
DNA-based approach for species identification are technically simple, more
accurate and applicable to large-scale screening and provides efficient
platforms to identify insect species .
DNA barcoding is inseparably linked with traditional taxonomy which
complements the taxonomic studies .
52. 52
Future prospects
DNA barcoding can be successfully employed in monitoring exotic insect
pest invasions.
The integration of morphological taxonomy with molecular taxonomy shall
ease the integrated pest management programmes at early stages and speed
the execution of plan.
The development of DNA barcode library at regional level can help in
monitoring species decline and loss of biodiversity.
Taxonomy term was proposed by de Candolle in 1813 which means law of arrangements ( taxis- arrangement or order; nomos- law); Greek, taxis or ta ´ksis: arrangement or rank
This classification involves grouping of organisms into series of hierarchical categories like kingdom, phylum, class, order, family, genus and species
Taxanomy refers to the classification of organisms on the basis of biology.whileas systematics refers to study and classification of organisms for the determination of evolutionary relationship of organisms.
Taxanomy does not deal with the evolutionary history of organisms. Systematics deal with the evolutionary history of organisms
Taxanomy is important to identify different species of insects. With the large number of insect species in the world it is critical to have a system for organizing them.Taxanomy is the science responsible for this.
Taxonomy based on external features, is still considered to be the base of this science, but there are problems too. Phenotypic characters are highly variable in respect to climatic conditions and often create major problems in proper identification.
Significant variation in taxonomically important traits, whether environmentally or genetically controlled, lead to incorrect identifications
Some life stages like eggs and young larvae lack any distinguishing features, So identification on morphological basis is difficult for such stages.
Taxonomic keys are present for certain life stages, such as adults, larvae, and pupae; however, it is difficult for non-experts to use taxonomic keys.
New horizon of taxanomy is molecular taxanomy which is based on chemical compostion like nucleic acid and proteins
Identity is easier to define 2. DNA readily available 3. fully preserved insect not needed 4).Any stage of insect can be identified
Phenotypically these look like a single species but in actual theses are 8 species of 4 genera and two subfamilies. Their identification is possible only when we go for molecular level
Paul Hebert: He applied the technique invented by Carl Woese and colleagues in the 1980s for arthropods identification and called it as DNA barcoding.
DNA barcoding has three main steps 1. DNA EXTRACTION 2.PCR AMPLIFICATION 3.DNA SEQUENCING. DNA isolation is a key step because without high quality DNA , the PCR amplication will not be optimal
TAGGING
FREEZ KILL THE INSECT AT -80 DEGREE AND CRUSH THE ADULT BY USING DNA extraction kit then incubate for 3hrs at 56 degree cel and then 100 degree cel for 10 mins
Rbcl-------ribulose bisphosphate carboxylase
In fungi-----ITS Region ( Intervening Transcribed Sequences) non coding regions
One of the DNA barcoding project is international barcode of life
Morphological identification of adult flies was done by using keys . The characters for morphological identification of fly included length of fly, eyes, antennae, wing pattern, and colour of flies, thorax and abdominal pattern. Morphological identification of larvae was done by using keys. Basic morphological features of larva used for identification purpose included length of larvae, integument, spines, cephalopharyngeal skeleton, respiratory structures such as anterior and posterior spiracles.
Barcode for all 5 species was generated using Barcode of life data system(BOLD)_Systems and submitted to GenBank and accession numbers were obtained. In the present study, identification of five different fly species based on morphology was also confirmed by DNA barcoding to prove their correct identity.
With the help of molecular taxanomy phylogenetic tree was constructed .Tree clustered into three major clade, first clade consisting of Musca domestica, second clade consisting of Hydroteae capensis and Sarcophaga ruficornis, whereas third clade consisting of Chyrsomya megacephala. Hydroteae illucens clustered as an outgroup .
Larvae were found in the bulbs of Ornithogalum and in the surrounding soil. DNA barcoding was used to identify the species and scanning electron microscopy was used to describe the morphological characteristics of Merodon avidus. Reared material previously identifed as Merodon constans is shown to belong to M. hurkmansi .
This revealed that DNA barcoding has the potential to be an efficient and accurate supplement to morphological methods for the identification of invasive Spodoptera pests in North America. Five species of armyworm was confirmed from DNA barcoding these are Spodoptera litura,Spodoptera littoralis, S. dolichos, S. pulchella, S. frugiperda,
This study shows the integration of DNA Sequencing data with traditional taxanomy will serve as a modle that can be applied across displine .it will increase the rate of species identification which will eventually help to deal with current biodiversity or in situation where species identification is difficult, the potential of DNA barcoding is more
All coxl1 sequence were submitted to NCBI GENE BANK under accession number………………..(Accession number is a unique identifier for a sequence recorded)
A total of 24 samples of whitefly was collected from different host growing in open and protected environment from 15 different locations of cental Kashmir viz Srinagar, budgam, and ganderbal. Whitefly population were collected from vegetable hosts such as beans,cucumber, eggplant,tomato,potato and squash and ornamental hosts including gerbera,salvia hibiscus and geranium. 100 samples were taken from each district and collected samples was used for the analysis of whitefly using mtCOI gene markers
DNA extraction: by SDS + Proteniase-K method
PCR amplification: the amplified mt COI gene region was visualized by electrophoresis in 1.2 % agarose gel
Sequencing:
BLAST(Basic local alignment search tools): is used to find regions of similarity between query sequence and the exsisting sequence present in the NCBI data base
Blast search sequences from current study revealed that whitefly samples collected during the survey belongs to two species namely bemesia tabaci and Trialeurodes vaporariorum. The whitefly population M1,M4,M6,M7,M8,M9,M10,M11,M12,M13,M14,M17,M18,M22,M23,M24,M25,M26 belongs to Bemisia tabaci and M3,M15,M16,M20,M21 belongs to Trialeurodes vaporariorum
In this study among the generated sequences each sequence was compared with its similar sequence available in NCBI database and optimal dendrogram was constructed by using MEGA Software v 8.05 and different texa were clustered together in a bootstrap test
BLAST: Basic local alignment search tool
39 sps of geometrid moth were identified on BLAST similarity bases from COI Gene sequence and new accession number of each identified species were allotted by NCBI and at the same time nucleotide sequence obtained were subjected to BLAST analysis which showed identification percentage of all the 39 sps.
Both morphological and molecular studies confirmed that the presence of Giant willow aphid in Ladakh region of jammu and Kashmir. The molecular identification was based on mtCOI region
The phylogenetic analysis also suggested the significant relatedness within Giant willow aphid population from different geographical regions
Genetic relatedness of P ulmi population was studied in fenazaquin selected generation developed through recurrent selection pressure . Five primers OPF-04,OPF-01,OPF-07,OPL-08OPR-07 was used for RAPD-PCR assay. All the five primers were amplified a total of 186 fragments of which 141 were polymorphic thereby suggested high probability these primers offers leading to differentiation amoung various populations P.ulmi. The genetic relatedness dendrogram showed genetic divergence of 53.8-95.1 percent