SlideShare a Scribd company logo
1 of 1
Download to read offline
PRECISION DEVICE FOR THE RAPID DIAGNOSTIC OF MICROVILLUS INCLUSION DISEASE
Theodore J Hall, Biomedical Engineer
Dr. Michael Caplan Ph.D. , School of Biological Health Systems and Engineering
David Carpentieri, M.D. , Mitchell Shub, M.D. , Phoenix Children’s Hospital
-Microvillus Inclusion Disease (MVID) is a
rare genetic disease which leads to a non-
functioning brush border in the small
intestine.
-Due to the 1977 CàT single nucleotide
mutation, this disease un-proportionally
affects people of the Navajo nation.
-Current diagnosis methods have patients
waiting over 4 weeks for results, a critical
window for patient survivability. With
implementation of the Tentacle Probe (TP),
diagnostic cost and time is reduced to $100
and 24 hours.
Background
Equations
Legend
pr is the probability of reaction; v is the average velocity
R is the sum of the radii of the two molecules; P is the probe concentration
T is the target concentration; kf is the association rate constant
[1] Erickson, Robert P., et al. American Journal of Medical Genetics. Part
A: Navajo Microvillous Inclusion Disease is due to a Mutation in MYO5B.
146A Vol. Wiley-Liss, 12/15/2008. Web. 22 Nov. 2015.
[2] Satterfield, B.C., J.A.a. West, and M.R. Caplan. “Tentacle Probes:
Eliminating False Postives without Sacrificing Sensitivity.” Nucleic Acids
Research(2007). Print..
[3] Christine Beeson, Jeffrey C. Weiss, Robert D. Ligensky. Microvillus
Inclusion Disease- A Deadly Masquerador.
	
  
[2]
Works Cited[2]
[2]
Future Work
Methods
-Diagnostic device will follow the steps: 1) DNA
acquisition via blood sample 2) DNA purification 3)
rt-PCR analysis of DNA with TP 3) output result of
patient diagnosis
-Development of wild type probe has the ability to
predict the likelihood of passing down the mutation to
further generations
	
  	
   Sequence of the TP:
(5’	
  -­‐	
  [BHQ1]	
  -­‐	
  ccgCAAGCGTTGAGCTTGcgg	
  -­‐	
  [orange	
  560]	
  -­‐	
  [linker	
  9]	
  -­‐
GACATAGTGAGGTGTCGTGGCA	
  -­‐	
  3’)	
  
The TP combined with DNA containing the target mutation was run through a melting curve.
As temperature increased the probe and DNA melted, allowing for a binding event to occur.
The binding event demonstrates that the probe will bind to the target mutation
-Tentacle Probe (TP) is used in a rt-PCR
machine. When the probe binds to the target
mutation it will fluoresce; as shown in the melt
curve.
-The mutation is detected by the levels of
fluorescence. The resulting exponential
fluorescence curve serves as the diagnostic
determinant.
-Since an rt-PCR machine is used to amplify the
DNA and the TP is used to detect the mutation, a
rapid and accurate diagnostic result can be
obtained
Results

More Related Content

What's hot

Sigma xi presentation final1
Sigma xi presentation   final1Sigma xi presentation   final1
Sigma xi presentation final1mukta936
 
Candidemia in HIV-positive patients in Dschang District Hospital (West Region...
Candidemia in HIV-positive patients in Dschang District Hospital (West Region...Candidemia in HIV-positive patients in Dschang District Hospital (West Region...
Candidemia in HIV-positive patients in Dschang District Hospital (West Region...Claude Nangwat
 
01 sergio lopez soria
01 sergio lopez soria01 sergio lopez soria
01 sergio lopez soriaMerial EMEA
 
Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...
Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...
Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...Guy Boulianne
 
TrujilloHectorUCSFPoster
TrujilloHectorUCSFPosterTrujilloHectorUCSFPoster
TrujilloHectorUCSFPosterHector Trujillo
 
Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...
Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...
Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...Guy Boulianne
 
Aeras schofield 21112013
Aeras schofield 21112013Aeras schofield 21112013
Aeras schofield 21112013AerasGlobalTB
 
Dr. X.J. Meng - Designing PRRSV Vaccines for Heterologous Protection
Dr. X.J. Meng - Designing PRRSV Vaccines for Heterologous ProtectionDr. X.J. Meng - Designing PRRSV Vaccines for Heterologous Protection
Dr. X.J. Meng - Designing PRRSV Vaccines for Heterologous ProtectionJohn Blue
 
Dr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy Measures
Dr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy MeasuresDr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy Measures
Dr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy MeasuresJohn Blue
 
Bacterial recombination
Bacterial recombinationBacterial recombination
Bacterial recombinationRamaJumwal2
 
Environmental Factor - August 2015_ Intramural papers of the month
Environmental Factor - August 2015_ Intramural papers of the monthEnvironmental Factor - August 2015_ Intramural papers of the month
Environmental Factor - August 2015_ Intramural papers of the monthXunhai 郑训海
 
Phenotypic and functional analysis of NK and NKT like cells
Phenotypic and functional analysis of NK and NKT like cellsPhenotypic and functional analysis of NK and NKT like cells
Phenotypic and functional analysis of NK and NKT like cellsSubrat Thanapati
 
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...Guy Boulianne
 
Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification ExternalEvents
 
molecular detection of tuberculosis and rifampin resistance.
molecular detection of tuberculosis and rifampin resistance.molecular detection of tuberculosis and rifampin resistance.
molecular detection of tuberculosis and rifampin resistance.Khaled AlKhodari
 
Development of monoclonal antibodies Workshop
Development of monoclonal antibodies WorkshopDevelopment of monoclonal antibodies Workshop
Development of monoclonal antibodies WorkshopAngel Hernández
 
mRNA-1273 (Moderna COVID vaccine)
mRNA-1273 (Moderna COVID vaccine)mRNA-1273 (Moderna COVID vaccine)
mRNA-1273 (Moderna COVID vaccine)Serena Hijazeen
 

What's hot (20)

Sigma xi presentation final1
Sigma xi presentation   final1Sigma xi presentation   final1
Sigma xi presentation final1
 
Candidemia in HIV-positive patients in Dschang District Hospital (West Region...
Candidemia in HIV-positive patients in Dschang District Hospital (West Region...Candidemia in HIV-positive patients in Dschang District Hospital (West Region...
Candidemia in HIV-positive patients in Dschang District Hospital (West Region...
 
01 sergio lopez soria
01 sergio lopez soria01 sergio lopez soria
01 sergio lopez soria
 
Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...
Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...
Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine ...
 
TrujilloHectorUCSFPoster
TrujilloHectorUCSFPosterTrujilloHectorUCSFPoster
TrujilloHectorUCSFPoster
 
Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...
Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...
Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild ...
 
Aeras schofield 21112013
Aeras schofield 21112013Aeras schofield 21112013
Aeras schofield 21112013
 
Dr. X.J. Meng - Designing PRRSV Vaccines for Heterologous Protection
Dr. X.J. Meng - Designing PRRSV Vaccines for Heterologous ProtectionDr. X.J. Meng - Designing PRRSV Vaccines for Heterologous Protection
Dr. X.J. Meng - Designing PRRSV Vaccines for Heterologous Protection
 
Dr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy Measures
Dr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy MeasuresDr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy Measures
Dr. Brian Payne - PCV2: Diagnostics, Control, Protection, and Efficacy Measures
 
GKA deel 2 college 15
GKA deel 2 college 15GKA deel 2 college 15
GKA deel 2 college 15
 
Bacterial recombination
Bacterial recombinationBacterial recombination
Bacterial recombination
 
2007 pcrrflp csp variants
2007 pcrrflp csp variants2007 pcrrflp csp variants
2007 pcrrflp csp variants
 
Environmental Factor - August 2015_ Intramural papers of the month
Environmental Factor - August 2015_ Intramural papers of the monthEnvironmental Factor - August 2015_ Intramural papers of the month
Environmental Factor - August 2015_ Intramural papers of the month
 
Phenotypic and functional analysis of NK and NKT like cells
Phenotypic and functional analysis of NK and NKT like cellsPhenotypic and functional analysis of NK and NKT like cells
Phenotypic and functional analysis of NK and NKT like cells
 
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination I...
 
Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification Web applications for rapid microbial taxonomy identification
Web applications for rapid microbial taxonomy identification
 
molecular detection of tuberculosis and rifampin resistance.
molecular detection of tuberculosis and rifampin resistance.molecular detection of tuberculosis and rifampin resistance.
molecular detection of tuberculosis and rifampin resistance.
 
Development of monoclonal antibodies Workshop
Development of monoclonal antibodies WorkshopDevelopment of monoclonal antibodies Workshop
Development of monoclonal antibodies Workshop
 
Chen 2008
Chen 2008Chen 2008
Chen 2008
 
mRNA-1273 (Moderna COVID vaccine)
mRNA-1273 (Moderna COVID vaccine)mRNA-1273 (Moderna COVID vaccine)
mRNA-1273 (Moderna COVID vaccine)
 

Viewers also liked

2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...
2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...
2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...Scott Fleurant
 
Instruction
InstructionInstruction
Instructionoseng
 
Descargar Mensajes Bonitos De Buenas Noches Sin coste
Descargar Mensajes Bonitos De Buenas Noches Sin coste
Descargar Mensajes Bonitos De Buenas Noches Sin coste
Descargar Mensajes Bonitos De Buenas Noches Sin coste neighborlywarlo04
 
Rent reciept.print
Rent reciept.printRent reciept.print
Rent reciept.printN1604
 
12 -13 YWES supply list
12 -13 YWES supply list12 -13 YWES supply list
12 -13 YWES supply listJennifer Green
 
Expresiones irracionales
Expresiones irracionalesExpresiones irracionales
Expresiones irracionalesChristiam3000
 
Lana del rey poster analysis
Lana del rey poster analysisLana del rey poster analysis
Lana del rey poster analysiskatiekatiekatie
 

Viewers also liked (11)

2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...
2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...
2013 OCB Pine Tree State ~ Bodybuilding, Figure & Bikini Championships - Adva...
 
Resumé
ResuméResumé
Resumé
 
Dejadles disfrutar del fútbol
Dejadles disfrutar del fútbolDejadles disfrutar del fútbol
Dejadles disfrutar del fútbol
 
Instruction
InstructionInstruction
Instruction
 
Descargar Mensajes Bonitos De Buenas Noches Sin coste
Descargar Mensajes Bonitos De Buenas Noches Sin coste
Descargar Mensajes Bonitos De Buenas Noches Sin coste
Descargar Mensajes Bonitos De Buenas Noches Sin coste
 
Rent reciept.print
Rent reciept.printRent reciept.print
Rent reciept.print
 
CalendarRackCard
CalendarRackCardCalendarRackCard
CalendarRackCard
 
Losmateriales
LosmaterialesLosmateriales
Losmateriales
 
12 -13 YWES supply list
12 -13 YWES supply list12 -13 YWES supply list
12 -13 YWES supply list
 
Expresiones irracionales
Expresiones irracionalesExpresiones irracionales
Expresiones irracionales
 
Lana del rey poster analysis
Lana del rey poster analysisLana del rey poster analysis
Lana del rey poster analysis
 

Similar to Hall, Theodore

Amany m. elshamy why the negative covid19 pcr test is a misguide results
Amany m. elshamy why the negative covid19 pcr test is a misguide resultsAmany m. elshamy why the negative covid19 pcr test is a misguide results
Amany m. elshamy why the negative covid19 pcr test is a misguide resultsAmany Elshamy
 
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouterswvdamme
 
Bk virus nephropathy
Bk virus nephropathyBk virus nephropathy
Bk virus nephropathyVishal Golay
 
Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...
Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...
Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...CrimsonpublishersCJMI
 
Vaccine Breakthrough Infections with SARS-CoV-2 Variants.pptx
Vaccine Breakthrough Infections with SARS-CoV-2 Variants.pptxVaccine Breakthrough Infections with SARS-CoV-2 Variants.pptx
Vaccine Breakthrough Infections with SARS-CoV-2 Variants.pptxGierelma J.T.
 
Nanomaterials for Virus Detection
Nanomaterials for Virus DetectionNanomaterials for Virus Detection
Nanomaterials for Virus DetectionRichardJGray
 
Laboratory diagnosis of Tuberculosis gs
Laboratory diagnosis of Tuberculosis gs Laboratory diagnosis of Tuberculosis gs
Laboratory diagnosis of Tuberculosis gs Gaurav S
 
his_12960_Rev2_EV.PDF
his_12960_Rev2_EV.PDFhis_12960_Rev2_EV.PDF
his_12960_Rev2_EV.PDFDavid Park
 
Creutzfeld-Jakob Disease: Diagnosis and Management of Prion Diseases
Creutzfeld-Jakob Disease: Diagnosis and Management of Prion DiseasesCreutzfeld-Jakob Disease: Diagnosis and Management of Prion Diseases
Creutzfeld-Jakob Disease: Diagnosis and Management of Prion Diseasesapplebyb
 
Dr. Thomas Yankeelov: Integrating Advanced Imaging and Biophysical Models to...
Dr. Thomas Yankeelov:  Integrating Advanced Imaging and Biophysical Models to...Dr. Thomas Yankeelov:  Integrating Advanced Imaging and Biophysical Models to...
Dr. Thomas Yankeelov: Integrating Advanced Imaging and Biophysical Models to...Dawn Yankeelov
 
256358677-Advanced-Diagnostic-Aids-ppt.ppt
256358677-Advanced-Diagnostic-Aids-ppt.ppt256358677-Advanced-Diagnostic-Aids-ppt.ppt
256358677-Advanced-Diagnostic-Aids-ppt.pptNivedithaS22
 
Cancer vaccine from mice to humans
Cancer vaccine from mice to humansCancer vaccine from mice to humans
Cancer vaccine from mice to humansHoussein A Sater
 

Similar to Hall, Theodore (20)

Amany m. elshamy why the negative covid19 pcr test is a misguide results
Amany m. elshamy why the negative covid19 pcr test is a misguide resultsAmany m. elshamy why the negative covid19 pcr test is a misguide results
Amany m. elshamy why the negative covid19 pcr test is a misguide results
 
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
2008 Aids Community Support & Art Outcomes S Afr Edwin Wouters
 
Plos
PlosPlos
Plos
 
Bk virus nephropathy
Bk virus nephropathyBk virus nephropathy
Bk virus nephropathy
 
NDBD
NDBDNDBD
NDBD
 
Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...
Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...
Molecular Dıagnostic Tests Used in the Dıagnosis of Tuberculosis_Crimson Publ...
 
Uk variant SARS CoV 2
Uk variant SARS CoV 2Uk variant SARS CoV 2
Uk variant SARS CoV 2
 
Clin Infect Dis.-2007-Hoen-381-90
Clin Infect Dis.-2007-Hoen-381-90Clin Infect Dis.-2007-Hoen-381-90
Clin Infect Dis.-2007-Hoen-381-90
 
Vaccine Breakthrough Infections with SARS-CoV-2 Variants.pptx
Vaccine Breakthrough Infections with SARS-CoV-2 Variants.pptxVaccine Breakthrough Infections with SARS-CoV-2 Variants.pptx
Vaccine Breakthrough Infections with SARS-CoV-2 Variants.pptx
 
CCR3.pdf
CCR3.pdfCCR3.pdf
CCR3.pdf
 
Nanomaterials for Virus Detection
Nanomaterials for Virus DetectionNanomaterials for Virus Detection
Nanomaterials for Virus Detection
 
Art orieliz
Art orielizArt orieliz
Art orieliz
 
Laboratory diagnosis of Tuberculosis gs
Laboratory diagnosis of Tuberculosis gs Laboratory diagnosis of Tuberculosis gs
Laboratory diagnosis of Tuberculosis gs
 
his_12960_Rev2_EV.PDF
his_12960_Rev2_EV.PDFhis_12960_Rev2_EV.PDF
his_12960_Rev2_EV.PDF
 
Creutzfeld-Jakob Disease: Diagnosis and Management of Prion Diseases
Creutzfeld-Jakob Disease: Diagnosis and Management of Prion DiseasesCreutzfeld-Jakob Disease: Diagnosis and Management of Prion Diseases
Creutzfeld-Jakob Disease: Diagnosis and Management of Prion Diseases
 
Dr. Thomas Yankeelov: Integrating Advanced Imaging and Biophysical Models to...
Dr. Thomas Yankeelov:  Integrating Advanced Imaging and Biophysical Models to...Dr. Thomas Yankeelov:  Integrating Advanced Imaging and Biophysical Models to...
Dr. Thomas Yankeelov: Integrating Advanced Imaging and Biophysical Models to...
 
256358677-Advanced-Diagnostic-Aids-ppt.ppt
256358677-Advanced-Diagnostic-Aids-ppt.ppt256358677-Advanced-Diagnostic-Aids-ppt.ppt
256358677-Advanced-Diagnostic-Aids-ppt.ppt
 
Cancer vaccine from mice to humans
Cancer vaccine from mice to humansCancer vaccine from mice to humans
Cancer vaccine from mice to humans
 
Kelley VanBuskirk
Kelley VanBuskirkKelley VanBuskirk
Kelley VanBuskirk
 
Applications of molecular genetics
Applications of molecular geneticsApplications of molecular genetics
Applications of molecular genetics
 

Hall, Theodore

  • 1. PRECISION DEVICE FOR THE RAPID DIAGNOSTIC OF MICROVILLUS INCLUSION DISEASE Theodore J Hall, Biomedical Engineer Dr. Michael Caplan Ph.D. , School of Biological Health Systems and Engineering David Carpentieri, M.D. , Mitchell Shub, M.D. , Phoenix Children’s Hospital -Microvillus Inclusion Disease (MVID) is a rare genetic disease which leads to a non- functioning brush border in the small intestine. -Due to the 1977 CàT single nucleotide mutation, this disease un-proportionally affects people of the Navajo nation. -Current diagnosis methods have patients waiting over 4 weeks for results, a critical window for patient survivability. With implementation of the Tentacle Probe (TP), diagnostic cost and time is reduced to $100 and 24 hours. Background Equations Legend pr is the probability of reaction; v is the average velocity R is the sum of the radii of the two molecules; P is the probe concentration T is the target concentration; kf is the association rate constant [1] Erickson, Robert P., et al. American Journal of Medical Genetics. Part A: Navajo Microvillous Inclusion Disease is due to a Mutation in MYO5B. 146A Vol. Wiley-Liss, 12/15/2008. Web. 22 Nov. 2015. [2] Satterfield, B.C., J.A.a. West, and M.R. Caplan. “Tentacle Probes: Eliminating False Postives without Sacrificing Sensitivity.” Nucleic Acids Research(2007). Print.. [3] Christine Beeson, Jeffrey C. Weiss, Robert D. Ligensky. Microvillus Inclusion Disease- A Deadly Masquerador.   [2] Works Cited[2] [2] Future Work Methods -Diagnostic device will follow the steps: 1) DNA acquisition via blood sample 2) DNA purification 3) rt-PCR analysis of DNA with TP 3) output result of patient diagnosis -Development of wild type probe has the ability to predict the likelihood of passing down the mutation to further generations     Sequence of the TP: (5’  -­‐  [BHQ1]  -­‐  ccgCAAGCGTTGAGCTTGcgg  -­‐  [orange  560]  -­‐  [linker  9]  -­‐ GACATAGTGAGGTGTCGTGGCA  -­‐  3’)   The TP combined with DNA containing the target mutation was run through a melting curve. As temperature increased the probe and DNA melted, allowing for a binding event to occur. The binding event demonstrates that the probe will bind to the target mutation -Tentacle Probe (TP) is used in a rt-PCR machine. When the probe binds to the target mutation it will fluoresce; as shown in the melt curve. -The mutation is detected by the levels of fluorescence. The resulting exponential fluorescence curve serves as the diagnostic determinant. -Since an rt-PCR machine is used to amplify the DNA and the TP is used to detect the mutation, a rapid and accurate diagnostic result can be obtained Results