Successfully reported this slideshow.
Your SlideShare is downloading. ×

Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)”.ppt

Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Ad
Upcoming SlideShare
Dna and rna presentation
Dna and rna presentation
Loading in …3
×

Check these out next

1 of 30 Ad

Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)”.ppt

Download to read offline

Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)”.

Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)”.

Advertisement
Advertisement

More Related Content

Similar to Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)”.ppt (20)

Recently uploaded (20)

Advertisement

Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)”.ppt

  1. 1. Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)” Shivendra Pratap Singh Senior Scientific Assistant Forensic Science laboratory Port Blair 1
  2. 2. Criminal Law-Rape-DNA Test of accused mandatory in nature “Richpal Kharra V. State [2015 STPL (Web) 1578 Rajasthan (RAJ)” • In this present case the complainant who alleged rape on her self told the police that she was not interested in pursuing the matter and that no offence of rape had taken place with her-Police filed negative report-Held that Section 53-A of CrPC is mandatory in nature. Accused was directed to provide sample for DNA testing to be sent by investigating office to the FSL and then FSL to bring the report to the court and court may pursue the matter further, if necessary. 2
  3. 3. Section 53(A)- Examination of person accused of rape by medical practitioner. •When a person is arrested on a charge of committing an offence of rape or an attempt to commit rape should be examined by the registered medical practitioner at the request of police officer, not below the rank of Sub- Inspector. •The registered medical practitioner conducting such examination shall, without delay, examine such person and prepare a report of his examination giving the following particulars, namely- 1- The name and address of the accused and of the person by whom he was brought, 2- The age of the accused, 3- Marks of injury, if any, on the person of the accused, 4- The description of material taken from the person of the accused for DNA profiling, and”. 5- Other material particulars in reasonable detail. 3
  4. 4. Types of Sexual Offence • Natural Sexual Offence 1. Rape 2. Incest • Unnatural Sexual Offence 1. Sodomy 2. Buccal Coitus 3. Tribadism 4. Bestiality (Bestio-sexuality) 4
  5. 5. The law regarding Rape Section 375 IPC- Rape- A man is said to commit “rape” has sexual intercourse with a woman under circumstances falling under any of the six following de- scriptions:— 1. Without her consent 2. Her consent in fear of death or of hurt. 3. With her consent, when the man knows that he is not her husband, and that her consent is given because she believes that he is another man to whom she is or believes herself to be lawfully married. Natural Sexual Offence-Rape 5
  6. 6. Cont… 5. Her consent with unsoundness of mind or intoxication or the administration by him personally or through another of any stupefying or unwholesome substance. 6. With or without her consent, when she is under sixteen years of age. Section 376 IPC- Punishment for the offence of rape which may extend from seven years to life imprisonment and also fine 6
  7. 7. Natural Sexual Offence-Incest 7
  8. 8. Unnatural sexual Offenses • Sodomy- anal intercourse between two male (Homosexual sodomy) or between a male and a female (Heterosexual sodomy). • Buccal Coitus- intercourse through mouth. • Tribadism- Female homosexuality (lesbianism). • Bestiality- sexual intercourse by a human being with a animal.  All unnatuiral sexual offence punishable under section 377 IPC. 8
  9. 9. DNA the molecule of life Human body cells gene tissue chromosome DNA 9
  10. 10. Introduction to DNA • Deoxyribose Nucleic Acid-DNA • DNA has often been Described as the “BLUE PRINT “of life, containing all the information that an organism requires in Order to function & reproduce 10
  11. 11. One Strand of DNA • The backbone of the DNA molecule is phosphate, deoxyribose, and bases phosphate deoxyribose bases 11
  12. 12. One Strand of DNA • One strand of DNA is a polymer of nucleotides • One strand of DNA has many millions of nucleotides • Nucleotides include Phosphate, deoxyribose and base nucleotide 12
  13. 13. Two Stranded DNA • Remember, DNA has two strands that fit together something like a zipper. • The teeth are the nitrogenous bases . 13
  14. 14. The Shape of the Molecule • DNA is a very long polymer. • The basic shape is like a twisted ladder or zipper. • This is called a double helix. • Right handed twisted 14
  15. 15. 15
  16. 16. Four nitrogenous bases • Cytosine C • Thymine T • Adenine A • Guanine G DNA has four different bases: 16
  17. 17. Important: • Adenine and Thymine always join together A T • Cytosine and Guanine always join together C G 17
  18. 18. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in the DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTTCAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTG GTCCAACCCCCAGGCCATCA AGATGTCTCAGAGAGGCGG CTAGACACCCAGAGACCTCA AGTGACCATGTGGGAACGG GATGTTTCCAGTGACAGGCA Genotype Phenotypes Genotype 18
  19. 19. Now , how DNA transform the genetic information from one generation to another ? 19
  20. 20. MOM DAD YOU You have two copies of every chromosome –one from your father & one from your mother Each chromosome carries a copy of gene- you therefore have two copies of every gene 20
  21. 21. DNA in forensic science • The chemical structure of everyone's DNA is the same. • The only difference between individuals is the order of the base pairs. • This can give the valuable information to distinguish the individuals. • So plays an important role in forensic investigations 21
  22. 22. Individualization means… • One and only. • No other copy except the monozygotic twins. 22
  23. 23. Application of DNA testing in criminal law • Rape cases (including POCSO cases) • Dispute Paternity and maternity cases • Infant identification • Unknown body identification • Absconding solders • Murder cases 23
  24. 24. Sources of Biological Evidence • Blood • Semen • Saliva • Hair • Skin cells • Bone • Teeth • Tissue • Urine • Condoms • Envelopes • Drinking cups • Cigarette Butts 24
  25. 25. Evidence collection • Tissue - Hard e.g. Bone, Teeth - Soft, e.g. Skin cellsBrain etc. • Hair - Roots hair • Blood - Fresh Blood (in FTA card or in appropriate preservatives minimum 5 ml) - Blood Stain • Seminal Swab • Vaginal Swab Sterile cotton ear bud can be used • Saliva Swab 25
  26. 26. ‘FTA Card’ for Blood Collection 26
  27. 27. Sample Packaging • Use appropriate containers • Do not contaminate the evidence • Prevents any change from taking place between the time it is removed from the crime scene and the time it is received by the crime laboratory. • Place items collected at different locations placed in separate containers. 27
  28. 28. Obstacle in forensic Casework • Small quantity of sample to work with. • Contamination of sample. • Poor preservation of material from which DNA is to be extracted e.g. contamination of stains and decomposition of tissue. 28
  29. 29. Limitations • But frequencies are not absolutely accurate because databases are limited • Contamination at crime scene or from victim • Sloppy lab management • Contaminated lab reagents • Civil rights issues – Establish degree of probable cause before testing DNA? – Can blood collected for other reasons be used? 29
  30. 30. 30 Thank you Any Question?????

×