2. dependent and -independent methods and its toxicity was analyzed.
Our results indicated that the toxic genes of pirAB on the plasmid in V.
owensii SH-14 can induce signs consistent with shrimp AHPND, which
contribute to better understanding of the diversity of the AHPND-pa-
thogenic bacteria and the spreading of pirAB via plasmid among the
members of Vibrio in the natural environments.
2. Materials and methods
2.1. Sample collection
Shrimp L. vannamei (body weight 13–15 g) were collected from
farming ponds and individually packaged in an aseptic plastic bag in
Shanghai in June 2013. Water and sludge from shrimp ponds were
sampled in aseptic bottles, respectively. Wild crayfish and Chinese
mitten crab were collected from river close to the shrimp ponds. Oyster
samples were collected along the seashore of East China Sea. Animal
samples were transported to laboratory on ice and stored at −80 °C in
laboratory before using. Water and sludge were transported to labora-
tory on ice and processed immediately.
2.2. Bacteria isolation and PCR identification
One hundred forty frozen L. vannamei were defrosted and dissected,
and 30 mg HP were aseptically collected from each shrimp. HP DNAs
were extracted using TIANamp Marine Animals DNA Kit (Tiangen,
Beijing, China) and subjected to multiplex PCR detection for AHPND
with specific primer sets of AP3 F/R (Sirikharin et al., 2014), 392F/R
(Han et al., 2015a) and pndA F/R (Table 1), for amplification of pirA,
pirB and pndA genes (Lee et al., 2015; Xiao et al., 2017), respectively.
The PCR thermal program was as follows: denaturation at 95 °C for
4 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing
at 54 °C for 30 s and extension at 72 °C for 45 s, and a final extension
step at 72 °C for 10 min. The positive PCR products were verified by
sequencing (Sangon Biotech Shanghai).
To isolate AHPND pathogens, one shrimp that was positive for pirA,
pirB and pndA based on multiplex PCR detection was selected, and
30 mg of its HP were dissected, homogenized in 0.1 M PBS (pH = 7.4)
and serially diluted 10, 100 and 1000 folds. The dilutions were spread
on CHROMagar plates for specific isolation of Vibrio spp.. Colonies were
subjected to multiplex PCR specific for pirA, pirB and pndA as described
above, and the positive ones were also checked for tlh, tdh and trh genes
as previously described (Nishibuchi et al., 1985; Taniguchi et al., 1985).
2.3. Bacteria cultivation and observation
Glycerol-preserved positive bacterial isolate SH-14 was streaked
onto CHROMagar plates, which were cultured overnight at 37 °C. A
colony that was positive for pirA, pirB and pndA based on multiplex PCR
was picked and cultured in flasks containing sterile TSB+ (Tryptic soy
broth added with 1.5% sodium chloride) at 37 °C, 200 rpm. Bacterial
density was determined using a microplate reader (Synergy 2, BioTek
Instruments) at the excitation wavelength of 600 nm.
Two mL of bacterial culture (OD600: 0.6–0.8) was centrifuged at
6000g for 2 min and the supernatant was discarded. The pellets were
fixed in 2.5% glutaraldehyde at 4 °C for about 2 h. Cell morphology was
observed with scanning electron microscope (SEM) and transmission
electron microscope (TEM) following the procedures described in (Lu
et al., 2014) and (Sun et al., 2014), respectively.
2.4. Genomic sequencing and phylogenetic analysis
The genomic DNA of strain SH-14 was extracted with TIANamp
Bacteria DNA Kit (Tiangen, Beijing) and sequenced on an Illumina
MiSeq sequencer (Majorbio Bio-Pharm Technology, Shanghai).
Type strains of the core Harveyi members: V. campbellii 15,631
(BBKW01000000), V. jasicida LMG25398 (BAOG01000000), V. owensii
DY05 (JPRD01000000), V. harveyi NBRC15634 (BAOD01000000), V.
rotiferianus LMG21460 (BAOI01000000) and V. parahaemolyticus RIMD
2,210,633 (BA000031 and BA000032), AHPND-causing strain V.
parahaemolyticus 3HP (JPKS01000041) and AHPND toxins-related or
plasmid-related strains (Xiao et al., 2017): V. campbellii 151112C
(NZ_BBKW01000191), V. campbellii KC13.17.5 (BBXN01000000), V.
owensii 051011B (BBLB01000000), were selected for phylogenetic
analysis. Nucleotide sequence of five protein-coding loci rpoA (RNA
polymerase α-subunit), pyrH (uridylate kinase), topA (topoisomerase I),
ftsZ (cell division protein FtsZ) and mreB (rod shaping protein MreB)
(Cano-Gómez et al., 2010) were identified in these strains based on
blastN similarity comparison (E-value < 1 0 −5
) and included in phy-
logenetic analysis. Maximum-likelihood trees were constructed with the
alignments of these concatenated sequences by MUSCLE (Edgar, 2004)
in MEGA6 (Tamura et al., 2013) with 100 bootstrap replicates.
For the phylogenetic tree of 16 rRNA gene, SH-14 was compared to
the species of Vibrio and its relatives mentioned in Bergey's Manual of
Systematic Bacteriology (Brenner et al., 2006). Twenty sequences with
pairwise identity of more than 97% and coverage of more than 90%
were retrieved. Sequences were aligned and phylogenetic trees were
constructed using MUSCLE (Edgar, 2004) and maximum-likelihood
algorithm with 100 bootstrap, respectively.
2.5. SDS-PAGE and Western blot analysis of toxins PirAB
The strain SH-14 and one positive control strain V. parahaemolyticus
F6 were cultured separately in TSB+ for 12 h at 37 °C, 200 rpm. The
crude proteins in supernatant were precipitated by ammonium sulfate
(AS) with 40% saturation at 0 °C (Xiao et al., 2017). Subsequently, the
proteins were separated by SDS-PAGE (10%) and transferred to PVDF
membrane. Western blot was performed using antibodies against PirA
and PirB (Lee et al., 2015).
2.6. Stability of toxin genes in SH-14
Stability of the toxin genes pirAB was analyzed. One positive colony
of strain SH-14, revived on CHROMagar plates, was transferred into
50 mL of fresh TSB+ and cultured at 37 °C, 200 rpm for 12 h, and was
designated as the reference group. One mL of the bacterial culture was
transferred into 50 mL fresh TSB+ and cultured for 6 h, and was con-
sidered as the first generation. This transfer and culture procedure was
repeated 9 times. DNA was extracted from 1 mL of bacterial culture in
three parallel experiments for both the reference group and each of the
first generation group.
Quantitative PCR was performed on an ABI 7500 Fast system
(Applied Biosystems). The pirB and pndA (a reference gene) were am-
plified with specific primer sets of pirB 2F/7R and pndA 1F/2R
(Table 1), respectively. Approximately 10 ng DNA was added into 20 μL
PCR mix (Roche). The relative changes in the number of pirB gene were
analyzed with the 2−ΔΔC
T method (Livak and Schmittgen, 2001).
Table 1
Primers used in this study.
Target gene Primer Sequence (5′-3′) Products (bp)
pndA pndA F AGTCTGGAGAGCATGGGATG 489
pndA R TGATCTCTGCTGGCGGTAGA
pirB pirB 2F ACGAGCACCCATCACTTCAT 194
pirB 7R ACATGGCTTGTGGTCTGGAT
pndA pndA 1F GAGGGTTGCCAGAACGTTTG 100
pndA 2R CACCGTATGTATGACTGCGC
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
157
3. 2.7. Immersion bioassay
SPF shrimp L. vannamei (0.5–2 g body weight) were obtained from a
local supply and maintained in tanks containing artificial seawater
(13‰ salinity, 27 °C) for several days. Immersion bioassay was per-
formed as previously described (Tran et al., 2013) with the exception of
15 min pre-immersion in 108
CFU/mL. Shrimp were divided into three
groups (pirAB+
, pirAB−
, negative control), each group containing three
replicates. Thirty shrimp, which were cultured in a tank containing
19.8 L artificial seawater, were found in each group. Two hundred
milliliters of each prepared bacterial culture (pirAB+
or pirAB−
), ap-
proximately 108
CFU/mL (OD600 = 0.6–0.8), were added into the ex-
perimental tanks, and the bacterial density was adjusted to 106
CFU/
mL. Shrimp that were immersed in 200 mL sterile TSB+ were used as
the negative control. Mortality was recorded two times per day.
After immersion challenging bioassay, shrimp that were collected
from the pirAB+
, pirAB−
and TSB+ groups were subjected to bacterial
re-isolation. Five shrimp were used in each group. The isolation pro-
cedures were the same as described above. Colonies on plates were
counted and detected with multiplex PCR.
Meanwhile, shrimp HP DNA was extracted from shrimp using
TIANamp Marine Animals DNA Kit, and qPCR was performed as pre-
viously described with slight modifications (Han et al., 2015b). The
standard plasmid was constructed as previously described (Liu et al.,
2017). Results of qPCR ware compared with colony counting on plates
and the copy number of virulent plasmid per cell was estimated (Liu
et al., 2017).
2.8. Histopathology
After immersion bioassay, three shrimp were sampled from each
group of pirAB+
, pirAB−
and TSB+, and subjected to histopathological
analysis. The HPs were dissected immediately and fixed in 4% PFA at
4 °C for 48 h. The samples were then sectioned into 4 μm and stained
with hematoxylin and eosinphloxine (H&E) (Lightner, 1996) before
observation under microscope.
2.9. Oral injection
L. vannamei (body weight 18 ± 5 g) and Macrobrachium rosenbergii
(body weight 17 ± 5 g) were sampled from shrimp farming ponds in
Shanghai. The shrimp were cultured in tanks containing 20 L fresh
water for several days to adapt to the laboratory environment before
injection.
For oral injection of L. vannamei, the shrimp were divided into three
groups with ten shrimp in each group. The bacteria, pirAB+
and
pirAB−
, were cultured as described above until OD600 reached 0.6–0.8.
Two hundred fifty milliliters of each bacteria culture (pirAB+
or
pirAB−
) were collected and centrifuged at 6000g for 10 min. The pellets
were re-suspended in 10 mL fresh TSB+. One hundred microliters of
pirAB+
or pirAB−
suspension were orally injected, respectively. The
same volume of fresh TSB+ was injected for control group. Cumulative
mortality was calculated. As for oral injection of M. rosenbergii, the
procedures were the same as those for L. vannamei injection.
2.10. Distribution of AHPND pathogen SH-14
Approximately 600–800 mL fresh water that was collected from
shrimp ponds was filtered with 0.22 μm membranes, and bacterial DNA
was extracted with TIANamp Marine Animals DNA Kit. Thirty milli-
gram sludge from shrimp ponds was subjected to DNA extraction with
TIANamp Stool DNA Kit. DNA from eleven Chinese mitten crabs, fifteen
crayfish and ten oysters were extracted with TIANamp Marine Animals
DNA Kit. All DNA was analyzed for SH-14 with multiplex PCR.
3. Results
3.1. Isolation and characterization of the pirAB-positive strain (pirAB+
)
One hundred and forty L. vannamei were screened with multiplex
PCR. Three shrimp revealed positive bands for pirAB and pndA genes,
suggesting that these three shrimp may carry AHPND pathogens. One of
these three shrimp was then used for isolation of AHPND pathogenic
strains. Eighty colonies that were grown on CHROMagar plates were
randomly selected and identified with multiplex PCR. Fifty-five co-
lonies were positive for pirA, pirB and pndA genes, while the others were
negative (Fig. 1A). Subsequently, one positive colony was chosen and
cultured in TSB+. The cultures were then spread on CHROMagar
plates. Ten colonies were selected and re-checked with multiplex PCR
and were all tested positive. PCR products of pirA and pirB genes were
sequenced and were found to be 100% similar to that of AHPND V.
parahaemolyticus. One positive colony, named SH-14, was cultured in
TSB+ with subsequent addition of 50% sterile glycerol and stored at
−80 °C. The SH-14 strain was used in the following study. Notably, the
SH-14 strain was negative for V. parahaemolyticus species-specific gene
tlh and the human pathogen markers, tdh and trh genes. However the
pirAB+
V. parahaemolyticus F6 strain was positive for tlh gene but ne-
gative for tdh and trh genes. Our results suggest that SH-14 is a candi-
date of AHPND-pathogenic bacteria, however, it does not belong to V.
parahaemolyticus.
After cultured on CHROMagar plates for 12–15 h, the strain SH-14
formed mauve colonies with jagged edges with small red dots in the
center. As shown in Fig. 2A, the color became darker as the colonies
grew older. By contrast, after cultured on TCBS agar plates for 8 h at
37 °C, the V. owensii strain SH-14 formed yellow colonies while that of
the V. parahaemolyticus F6 strain appeared to be green (Fig. 3).
The SH-14 cells were rod-shaped with a length of 1.86 ± 0.15 µm
and a width of approximately 0.57 µm (Fig. 2B). TEM revealed that the
strain SH-14 had a single-ended flagellate (approximately 4 µm in
length) (Fig. 2C–E).
Fig. 1. (A) Multiplex PCR detection of toxic genes. The pirAB genes were detected in the
SH-14 strain, but not in the mutant strain pirAB−
. The pndA gene was present in both
strains. Marker: 100 bp. (B) Western blot analysis of the toxins PirAB. The toxin proteins
PirA and PirB were detected in the culture medium of the V. owensii (V. o) SH-14 strain
pirAB+
(Right). The V. parahaemolyticus (V. p) F6 was used as a positive control (Left).
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
158
4. 3.2. Genomic and phylogenetic analysis of SH-14
The raw data of whole genomic sequences was assembled into 147
contigs (Liu et al., 2015). A large plasmid containing the binary toxin
genes pirAB, which shared 100% sequence identity with that in the
AHPND-pathogenic V. parahaemolyticus strains. Interestingly, the pirAB
genes were only detected in this plasmid. In addition, the plasmid also
contained pndA. Subsequently, Western blot was performed to in-
vestigate whether PirAB proteins were present in the bacterial culture
suspension. As shown in Fig. 1B, similar to the positive strain V.
parahaemolyticus, two hybridization bands, approximately 16 kDa
(PirA) and 53 kDa (PirB), were observed for the strain SH-14. The re-
sults indicated that the pirAB+
SH-14 secreted toxins PirAB into the
culture medium.
BLAST search yielded 19 different species of Vibrio with pairwise
identity of more than 97% and coverage of more than 90% compared to
the 16S rRNA gene of SH-14. Detailed phylogenetic analysis based on
these sequences (Fig. 4A) indicated that SH-14 was affiliated to the
Harveyi clade and was most closely related to V. owensii DY05 (99.9%
of sequence similarity). To avoid any potential species misidentification
Fig. 2. Morphology of the V. owensii SH-14 pirAB+
strain. (A) Colonies on the CHROMagar plates. (B) Scanning electron micrographs. (C) Transmission electron micrographs. (D) and (E)
A typical flagellum. (D) High magnification of part of (C), (E) High magnification of part of (D).
A. V. owensii SH-14 B. V. parahaemolyticus F6
Fig. 3. Colony appearance of V. owensii SH-14 (A) and V. parahaemolyticus F6 (B) on TCBS plates.
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
159
5. in this clade (Gomez-Gil et al., 2004), we confirmed this relationship
via phylogenetic analysis of 5 concatenated key proteins (Cano-Gómez
et al., 2010), which clearly indicated that SH-14 represented a strain of
V. owensii with strong bootstrap support (Fig. 4B).
3.3. Stability of toxin genes in the strain SH-14
The amplification efficiency of qPCR was 99.96 ± 3.26% for pirB
and 95.45 ± 0.39% for pndA, which met the requirements for the
2−ΔΔC
T method in relative quantitative PCR. As shown in Fig. 5, the pirB
gene increased in the first two generations, but then decreased con-
tinuously from the third to fifth generation, and eventually remained at
a stable level. This indicated that a dynamic equilibrium was reached
between strain pirAB+
and pirAB−
under nutrient-rich pure culture
conditions. Furthermore, the loss rate of pirAB toxin genes was ap-
proximately 22%.
3.4. Toxicity of the V. Owensii strain SH-14
For the pirAB+
group, the death of post-larvae shrimp was first
observed within 12 h, and the cumulative mortality reached 100% in
4 days (Fig. 6A). In addition, their HPs appeared obscure and became
atrophic (Fig. 7B, D). In contrast, normal HPs (Fig. 7A, C) and no
mortality (Fig. 6A) were observed in both the pirAB−
and the TSB+
groups.
Upon histopathological analysis, shrimp HPs exhibited normal
Fig. 4. Phylogenetic trees. (A) Phylogenic tree of
the 16S rRNA gene in the V. owensii SH-14 and its
related species. The Maximum Likelihood tree
was constructed using the alignment of a total of
1328 positions. The robustness of the tree was
evaluated using bootstrap analysis (repeat
for100). Percentage values are indicated on the
branching nodes. Bar = 0.5 substitutions per 100
nucleotides. Members of the Harveyi clade were
indicated in blue. (B) Phylogenic tree of con-
catenated gene sequences of rpoA, pyrH, topA, ftsZ
and mreB from core strains in the Harveyi clade.
The Maximum Likelihood tree was constructed
with a concatenated alignment of a total of 3316
positions in the final dataset and 100 bootstrap
analyses. Plasmids that are associated with
AHPND are indicated in brackets. Different Vibrio
species are indicated in different colors. The V.
owensii SH-14 is shown in bold. Bar = 1 sub-
stitutions per 100 nucleotides.
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
160
6. structure of tubule epithelial cells in both the pirAB−
and the TSB+
groups (Fig. 8A, B). However, the HPs of shrimp immersed with the
pirAB+
strains revealed severe tubule epithelial cell sloughing and
nuclear karyomegaly, accompanied by hemocytic infiltration (Fig. 8C,
D). These results indicated that only the pirAB+
strains were able to
induce AHPND in post-larvae of L. vannamei.
The target bacteria, approximately 105
CFU/HP, were re-isolated
from the HPs of infected shrimp in the pirAB+
group. One hundred and
fifty-seven colonies were randomly selected, which were all positive for
pirA, pirB and pndA genes based on multiplex PCR analysis. No target
bacteria were isolated from shrimp in either the pirAB−
group or the
TSB+ group.
As demonstrated by qPCR analysis, copies of virulent plasmid in the
pirAB+
strain-infected shrimp were (4.13 ± 6.42) × 106
copies/HP
(n = 90 shrimp), which equaled to (1.29 ± 2.0) × 105
CFU/HP (Liu
et al., 2017), and were in line with the plating results
((2.79 ± 3.24) × 105
CFU/HP, n = 5 shrimp). However, as for the
shrimp in the pirAB−
and TSB+ group, copies of virulent plasmid were
hardly detected. Taken together, our results suggest that during the
immersion bioassay, the pirAB+
strains entered shrimp HPs, while the
pirAB−
strains did not.
In addition, adults of L. vannamei that were cultured in freshwater
were orally infected through injection instead of immersion, in order to
avoid effect of water salinity on the survival of SH-14. Bacteria, pirAB+
and pirAB−
, of 109
CFU were used for oral injection. The cumulative
mortality of the pirAB+
group reached 100% within 48 h; however, no
death was observed in the pirAB−
group (Fig. 6B). It appeared that both
the post-larvae and adults of L. vannamei were susceptible to infection
of the pirAB+
strains. As for M. rosenbergii, after same amount of bac-
teria as that used for L. vannamei was orally injected, death was ob-
served in neither the pirAB+
nor the pirAB−
group. This indicates that
M. rosenbergii is resistant to the infection of both the pirAB+
and pirAB−
strains.
3.5. Distribution of the V. Owensii strain SH-14
The water and sludge that were sampled from shrimp farm were
negative for pirAB and pndA, so were the tested crayfish, Chinese mitten
crab, and oysters.
4. Discussion
Since the emergence of shrimp AHPND, V. parahaemolyticus appears
to be the only pathogen involved in disease outbreaks. Here, however, a
V. owensii strain that harbors a plasmid containing toxin genes pirAB
was confirmed to be capable of inducing shrimp AHPND. Interestingly,
to date, all known AHPND-causing bacteria of V. owensii, V. para-
haemolyticus and V. campbellii all harbor a similar plasmid, which shares
more than 99% identity and encodes the conjugative transfer gene
clusters and the mobilization protein genes (Xiao et al., 2017). Given
the facts that V. owensii, V. parahaemolyticus (Tran et al., 2013) and V.
campbellii (Ke et al., 2017; Xuan et al., 2017) are all closely related
halophilic bacteria and often colonize the same ecological niches, it is
reasonable to speculate that horizontal transfer of the virulent plasmid
may occur among these species. Further studies are required to confirm
this hypothesis.
By chance, a natural pirAB−
mutant of V. owensii SH-14 strain was
Ref. 1 2 3 4 5 6 7 8 9
0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
Q
R
Generations
Fig. 5. Stability of the toxic gene pirB. The relative changes of the pirB gene (target) to
pndA (reference) were analyzed with the 2−ΔΔC
T method. X-axis: Generations of the SH-14
strain; Y-axis: Relative quantity.
0 12 24 36 48 60 72 84 96
pirAB+
pirAB
-
TSB+
Post challenge (h) Post challenge (h)
A. Post-larvae B. Adults
0
20
40
60
80
100
)
%
(
l
a
v
i
v
r
u
S
)
%
(
l
a
v
i
v
r
u
S
pirAB+
pirAB
-
TSB+
Fig. 6. Challenging bioassay. Survival of post-larvae (A) and adults (B) of L. vannamei that were challenged with the pirAB+
, pirAB−
strains and fresh TSB+, respectively. Three replicates
were conducted for each group.
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
161
7. obtained, which does not contain the pirAB genes (Xiao et al., 2017). It
has been suggested that the transfer of pirAB was mediated by a Tn903
composite transposon on the plasmid (Xiao et al., 2017). In order to
understand the stability of pirAB genes, the V. owensii SH-14 strains
(pirAB+
) were subjected to continuous subculture in TSB+ liquid
medium. Our results indicate that the pirAB genes tend to be lost under
pure culture conditions until a dynamic equilibrium between the
pirAB+
and pirAB−
strains was reached in the bacterial population. In
contrast, however, the SH-14 strains that were re-isolated from the
diseased shrimp in the bioassay were all positive for pirAB, and the
pirAB−
strains were not detected. Moreover, no target bacteria were re-
isolated after shrimp were challenged with the pirAB−
strains. Hence,
we propose that the pirAB genes are essential for V. owensii SH-14 co-
lonization and infection in shrimp, which are unstable with no selective
pressure (shrimp host), e.g., under nutrient-rich pure culture condi-
tions.
In this study, the immersion challenging bioassay was conducted
directly with 106
CFU/mL of the target bacteria without the pre-im-
mersion of shrimp in 108
CFU/mL of bacteria for 15 min as previously
described (Tran et al., 2013; Hong et al., 2016). As a result, the mor-
tality reached up to 100% within 4 days, which are two days later than
when pre-immersion was performed in previous study (Tran et al.,
2013; Hong et al., 2016). Notably, approximately 105
CFU/HP of the
pirAB+
strains were re-isolated from the diseased shrimp. However, the
Fig. 7. Gross signs of L. vannamei that were challenged with the pirAB−
(A) and pirAB+
(B) strains. (C) and (D) HP dissected from the shrimp in (A) and (B), respectively. White arrow:
incomplete or obscure HP; Black arrow: atrophic HP.
Fig. 8. Histological analysis of hepatopancreas (HP) of the shrimp from the immersion bioassay. (A, B) Shrimp that were challenged with the strain pirAB−
exhibited normal structures of
HP. (C, D) Shrimp that were challenged with the strain pirAB+
showed: (C) Tubule epithelial cells were seriously sloughed into the HP tubule lumens, and (D) Nuclear karyomegaly
(arrows), accompanied with hemocytic infiltration, surrounded the remnants of HP tubules.
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
162
8. number of cells were far less in comparison to the seeded infection dose
(approximately 2 × 1010
CFU), even at the lowest dose of 104
CFU/mL
for AHPND induction (Joshi et al., 2014). It remains unclear whether
such high number of pathogenic bacteria is required for AHPND out-
break in the natural environments or how the infection is initiated (Lai
et al., 2015). We plan to investigate the minimum number of patho-
genic cells sufficient for adult shrimp infection and mortality using oral
injection in our future study. Nevertheless, results from this study
contribute to better understanding of AHPND infection and shed light
on the potential mechanism of its spread and transfer in the natural
environment.
We noticed that both the post-larvae and adults of L. vannamei
shrimp cultured in freshwater did not show any AHPND clinical signs
when challenged with the SH-14 strains via immersion. In addition, the
strains could not be re-isolated from the water even within less than
1 min after its release into the water (data not shown). However, the
adults of L. vannamei shrimp that were cultured in freshwater could be
infected by the SH-14 strains through oral injection. These indicate that
salinity is crucial for the survival of free living SH-14 in the water en-
vironment, and different ages of L. vannamei shrimp are all susceptible
to the infection. This may explain why AHPND was mainly found in
farmed post-larvae of L. vannamei, rather than in adults, since the post-
larvae were cultured in salted water while adults were cultured in
freshwater. It is possible that the SH-14 strain adopt different metabolic
mechanisms in various water and shrimp host environments. Based on
this logic, wild adult L. vannamei in seawater is likely to be susceptible
to the infection of SH-14 and other AHPND-causing strains. Therefore,
for shrimp industry in inland areas, early desalination, e.g., shortening
of the time that shrimp are farmed in seawater, could help monitor the
outbreaks of AHPND.
The V. owensii SH-14 strain was isolated from adult L. vannamei that
were cultured in freshwater ponds in Shanghai, where outbreaks of
AHPND have not been observed locally. Given that the SH-14 strain was
not detected in the water and sludge from the same pond and that the
strain was unable to survive in freshwater, we speculated that the
bacteria might be present in the shrimp and their dosage was not high
enough to induce AHPND (Joshi et al., 2014). In fresh water environ-
ment, the spread of AHPND-causing strains among shrimp may occur
through feeding on the ones that carry the strains.
The SH-14 strain did not infect adult M. rosenbergii via oral injec-
tion, and we found no SH-14 strain in both Chinese mitten crab and
crayfish that were collected from neighboring rivers and in oysters
sampled from nearby seashore. These suggest that the SH-14 strain is
specific to Penaeus.
In summary, a novel AHPND-causing strain was isolated from
farmed adult L. vannamei in Shanghai, China. It belongs to V. owensii,
which challenges the popular belief that V. parahaemolyticus is the only
AHPND-pathogenic bacterial species. The toxic genes of pirAB on the
plasmid in the V. owensii SH-14 were confirmed to be involved in
shrimp AHPND, and horizontal transfer of the virulent plasmid may
have occurred among closely related vibrio species of V. owensii, V.
campbellii and V. parahaemolyticus. Our studies offer important insights
to understanding the mechanisms of AHPND outbreaks and spread in
the natural environment.
Acknowledgements
We thank Prof. Chu-Fang Lo of National Cheng Kung University,
Taiwan for providing PirAB antibodies and Prof. Yong Zhao of Shanghai
Ocean University, Shanghai for providing the V. parahaemolyticus strain
F6.
This work was supported partially by the National Natural Science
Foundation of China (41376135, 31570112 and 31601570), Doctoral
Fund of Ministry of Education of China (20133104110006), Innovation
Program of Shanghai Municipal Education Commission (14ZZ144),
China, and Funding Program for Outstanding Dissertations of Shanghai
Ocean University (2015).
Appendix A. Supplementary material
Supplementary data associated with this article can be found, in the
online version, at http://dx.doi.org/10.1016/j.jip.2018.02.005.
References
Brenner, D.J., Boone, D.R., Garrity, G.M., Goodfellow, M., Krieg, N.R., Rainey, F.A., et al.,
2006. Bergey’s Manual® of Systematic Bacteriology: Volume Two The
ProteobacteriaPart B The Gammaproteobacteria.
Cano-Gómez, A., Goulden, E.F., Owens, L., Høj, L., 2010. Vibrio owensii sp. nov., isolated
from cultured crustaceans in Australia. FEMS Microbiol. Letter 302 (2), 175–181.
http://dx.doi.org/10.1111/j.1574-6968.2009.01850.x.
Edgar, R.C., 2004. MUSCLE: a multiple sequence alignment method with reduced time
and space complexity. BMC Bioinf. 5 (1), 113.
Gomez-Gil, B., Soto-Rodríguez, S., Lozano, R., Betancourt-Lozano, M., 2014. Draft
genome sequence of Vibrio parahaemolyticus strain M0605, which causes severe
mortalities of shrimps in Mexico. Genome Announcements 2 (2). http://dx.doi.org/
10.1128/genomeA.00055-14. e00055-00014.
Gomez-Gil, B., Soto-Rodriguez, S., Garcia-Gasca, A., Roque, A., Vazquez-Juarez, R.,
Thompson, F.L., et al., 2004. Molecular identification of Vibrio harveyi-related iso-
lates associated with diseased aquatic organisms. Microbiology 150 (6), 1769–1777.
Gomez-Jimenez, S., Noriega-Orozco, L., Sotelo-Mundo, R.R., Cantu-Robles, V.A., Cobian-
Guemes, A.G., Cota-Verdugo, R.G., et al., 2014. High-quality draft genomes of two
Vibrio parahaemolyticus strains aid in understanding acute hepatopancreatic ne-
crosis disease of cultured shrimps in Mexico. Genome Announcements 2 (4). http://
dx.doi.org/10.1128/genomeA.00800-14. e00800-00814.
Han, J.E., Tang, K.F., Tran, L.H., Lightner, D.V., 2015a. Photorhabdus insect-related (Pir)
toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of acute
hepatopancreatic necrosis disease (AHPND) of shrimp. Diseases Aquatic Organ. 113
(1), 33. http://dx.doi.org/10.3354/dao02830.
Han, J.E., Tang, K.F.J., Pantoja, C.R., White, B.L., Lightner, D.V., 2015b. QPCR assay for
detecting and quantifying a virulence plasmid in acute hepatopancreatic necrosis
disease (AHPND) due to pathogenic Vibrio parahaemolyticus. Aquaculture 12–15.
http://dx.doi.org/10.1016/j.aquaculture.2015.02.024.
Hong, X., Xu, D., Zhuo, Y., Liu, H., Lu, L., 2016. Identification and pathogenicity of Vibrio
parahaemolyticus isolates and immune responses of Penaeus (Litopenaeus) vannamei
(Boone). J. Fish Dis. http://dx.doi.org/10.1111/jfd.12441.
Joshi, J., Srisala, J., Truong, V.H., Chen, I.-T., Nuangsaeng, B., Suthienkul, O., et al.,
2014. Variation in Vibrio parahaemolyticus isolates from a single Thai shrimp farm
experiencing an outbreak of acute hepatopancreatic necrosis disease (AHPND).
Aquaculture 428, 297–302. http://dx.doi.org/10.1016/j.aquaculture.2014.03.030.
Ke, H.-M., Prachumwat, A., Yu, C.-P., Yang, Y.-T., Promsri, S., Liu, K.-F., et al., 2017.
Comparative genomics of Vibrio campbellii strains and core species of the Vibrio
Harveyi clade. Sci. Rep. 7.
Kondo, H., Tinwongger, S., Proespraiwong, P., Mavichak, R., Unajak, S., Nozaki, R., et al.,
2014. Draft genome sequences of six strains of Vibrio parahaemolyticus isolated from
early mortality syndrome/acute hepatopancreatic necrosis disease shrimp in
Thailand. Genome Announcements 2 (2). http://dx.doi.org/10.1128/genomeA.
00221-14. e00221-00214.
Kondo, H., Van, P.T., Dang, L.T., Hirono, I., 2015. Draft genome sequence of non-Vibrio
parahaemolyticus acute hepatopancreatic necrosis disease strain KC13. 17.5, isolated
from diseased shrimp in Vietnam. Genome Announcements 3 (5). http://dx.doi.org/
10.1128/genomeA.00978-15. e00978-00915.
Lai, H.-C., Ng, T.H., Ando, M., Lee, C.-T., Chen, I.-T., Chuang, J.-C., et al., 2015.
Pathogenesis of acute hepatopancreatic necrosis disease (AHPND) in shrimp. Fish
Shellfish Immunol. 47 (2), 1006–1014. http://dx.doi.org/10.1016/j.fsi.2015.11.008.
Leano, E.M., Mohan, C.V., 2012. Early mortality syndrome threatens Asia's Shrimp Farms.
Global Aquacult. Advocate(4).
Lee, C.-T., Chen, I.-T., Yang, Y.-T., Ko, T.-P., Huang, Y.-T., Huang, J.-Y., et al., 2015. The
opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by ac-
quiring a plasmid that expresses a deadly toxin. Proc. Natl. Acad. Sci. U S A. (No.34),
pp. 10798–10803, doi: http://dx.doi.org/10.1073/pnas.1503129112.
Lightner, D.V., 1996. A handbook of shrimp pathology and diagnostic procedures for
diseases of cultured penaeid shrimp.
Lightner, D.V., Redman, R.M., Pantoja, C.R., Noble, B.L., Tran, L., 2012. Early Mortality
Syndrome Affects Shrimp In Asia. Global Aquaculture Advocate (No.1).
Liu, L., Jiang, L., Yu, Y., Xia, X., Pan, Y., Yan, S., et al., 2017. Rapid diagnosis of Vibrio
owensii responsible for shrimp acute hepatopancreatic necrosis disease with iso-
thermal recombinase polymerase amplification assay. Mol. Cell Probes. http://dx.doi.
org/10.1016/j.mcp.2017.02.001.
Liu, L., Xiao, J., Xia, X., Pan, Y., Yan, S., Wang, Y., 2015. Draft genome sequence of vibrio
owensii strain SH-14, which causes shrimp acute hepatopancreatic necrosis disease.
Genome Announcements 3 (6). http://dx.doi.org/10.1128/genomeA.01395-15.
e01395-01315.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 (4),
402–408. http://dx.doi.org/10.1006/meth.2001.1262.
Lu, M., Wang, X., Sun, G., Qin, B., Xiao, J., Yan, S., et al., 2014. Fine structure of tibetan
kefir grains and their yeast distribution, diversity, and shift. PLoS ONE 9 (6),
e101387. http://dx.doi.org/10.1371/journal.pone.0101387. eCollection 2014.
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
163
9. NACA-FAO, 2011. Quarterly Aquatic Animal Disease Report (Asia and Pacific Region),
2011/2, April-June 2011 (NACA, Bangkok).
Nishibuchi, M., Ishibashi, M., Takeda, Y., Kaper, J.B., 1985. Detection of the thermostable
direct hemolysin gene and related DNA sequences in Vibrio parahaemolyticus and
other vibrio species by the DNA colony hybridization test. Infect’. Immun. 49 (3),
481–486.
Nunan, L., Lightner, D., Pantoja, C., Gomez-Jimenez, S., 2014. Detection of acute hepa-
topancreatic necrosis disease (AHPND) in Mexico. Dis. Aquatic Organ. 111 (1),
81–86.
Restrepo, L., Bayot, B., Betancourt, I., Pinzón, A., 2016. Draft genome sequence of pa-
thogenic bacteria Vibrio parahaemolyticus strain Ba94C2, associated with acute he-
patopancreatic necrosis disease isolate from South America. Genom. Data 9,
143–144. http://dx.doi.org/10.1016/j.gdata.2016.08.008.
Sirikharin, R., Taengchaiyaphum, S., Sanguanrut, P., Chi, T.D., Mavichak, R.,
Proespraiwong, P., et al., 2015. Characterization and PCR Detection of binary, pir-
like toxins from Vibrio parahaemolyticus isolates that cause acute hepatopancreatic
necrosis disease (AHPND) in shrimp. PLoS ONE 10 (5), e0126987. http://dx.doi.org/
10.1371/journal.pone.0126987. eCollection 2015.
Sirikharin, R., Taengchaiyaphum, S., Sritunyalucksana, K., Thitamadee, S., Flegel, T.W.,
Mavichak, R., et al., 2014. A new and improved PCR method for detection of AHPND
bacteria. Network of Aquaculture Centres in Asia and the Pacific, Bangkok, Thailand
http://www.enaca.org/modules/news/article.php.
Sun, G., Xiao, J., Wang, H., Gong, C., Pan, Y., Yan, S., et al., 2014. Efficient purification
and concentration of viruses from a large body of high turbidity seawater. Methodsx
1 (C), 197–206. http://dx.doi.org/10.1016/j.mex.2014.09.001.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular
evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30 (12), 2725–2729.
Taniguchi, H., Ohta, H., Ogawa, M., Mizuguchi, Y., 1985. Cloning and expression in
Escherichia coli of Vibrio parahaemolyticus thermostable direct hemolysin and
thermolabile hemolysin genes. J. Bacteriol. 162 (2), 510–515.
Thitamadee, S., Prachumwat, A., Srisala, J., Jaroenlak, P., Salachan, P.V.,
Sritunyalucksana, K., et al., 2016. Review of current disease threats for cultivated
penaeid shrimp in Asia. Aquaculture 452, 69–87.
Tran, L., Nunan, L., Redman, R.M., Mohney, L.L., Pantoja, C.R., Fitzsimmons, K., et al.,
2013. Determination of the infectious nature of the agent of acute hepatopancreatic
necrosis syndrome affecting penaeid shrimp. Dis. Aquatic Organ. 105 (1), 45–55.
http://dx.doi.org/10.3354/dao02621.
Xiao, J., Liu, L., Ke, Y., Li, X., Liu, Y., Pan, Y., et al., 2017. Shrimp AHPND-causing
plasmids encoding the PirAB toxins as mediated by pirAB-Tn903 are prevalent in
various Vibrio species. Sci. Rep. 7, 42177. http://dx.doi.org/10.1038/srep42177.
Xuan, D., Wang, H., Xie, G., Zou, P., Guo, C., Yan, L., et al., 2017. An isolate of Vibrio
campbellii carrying the pirVP gene causes acute hepatopancreatic necrosis disease.
Emerg. Microbes. Infect. 6 (1), e2.
Yang, Y.-T., Chen, I.-T., Lee, C.-T., Chen, C.-Y., Lin, S.-S., Hor, L.-I., et al., 2014. Draft
genome sequences of four strains of Vibrio parahaemolyticus, three of which cause
early mortality syndrome/acute hepatopancreatic necrosis disease in shrimp in China
and Thailand. Genome Announcements 2 (5). http://dx.doi.org/10.1128/genomeA.
00816-14. e00816-00814.
L. Liu et al. Journal of Invertebrate Pathology 153 (2018) 156–164
164
