Symposium talk, Combio conference 2011, Cairns AUS

1. `
Morgane Moreau
Dr Schaeffer’s laboratory - Supramolecular and Synthetic Biology Group
JCU -Townsville -Australia

2. `
DNA replication in E. coli
• E. coli genome Replicating chromosome
– Single circular chromosome
– 4600 kbp
– Completely sequenced (K12)
Replication fork
• Replication
– Single origin (oriC)
– Semi-conservative
– Complex termination region
Tanner et al, Nat Struct Mol Biol, 2008

3. `
Termination region
• 14 putative Termination sites (Ter sites)
TerA-L, TerY and TerZ share a 14 bp core sequence*
• Bound to monomeric protein Tus
Tus: **
2 pairs of
Blockage end Permissive end antiparallel ß-strands
*Within ORF
*Duggin and Bell, J Mol Biol, 2009; **Mulcair et al, Cell, 2006

4. Polarity of`fork stalling
Adapted from Mulcair et al, Cell, 2006

5. The TT-lock
`
Mulcair et al, Cell, 2006

6. Preferential binding of TusGFP to
`
double stranded Ter sites
• PCR-based Ter selection assay
– TusGFP + 10 fold excess Ter sites
and oriC (equimolar, double stranded)
– Immunoprecipitation with anti-GFP
• Tus affinity for ds-Ter sites

7. Comparison of Tus affinity for each ds and
TT-lock`Ter site
strategy
• Mimicking the TT-lock and comparing Tus affinity with ds-
Ter analogues
Ter structure tested
ds
TT-lock
Free C(6)
• Ligand-induced stability assay with in house
GFP-Basta (GFP-Based Stability Assay)*
TusGFP Isothermal denaturation Measure residual Aggregation
+ & centrifugation of fluorescence in SN rate &
Ter site aggregates as a function of time Half life
*Moreau et al, Mol BioSyst, 2010

8. Comparison of Tus affinity for each ds
`
and TT-lock Ter site
• Tagg 1/2 of Tus-Ter complexes at 250 mM KCl
In vitro global affinity In vivo efficiency
(GFP-Basta) (Duggin and Bell 2009)
• Strong binders form a strong TT-lock
• Moderate binders vary in their TT-lock forming efficiencies
• TerF does not form a TT-lock
In vivo efficiency relates to TT-lock induced stability for Tus-Ter complexes
suggests that the TT-lock occurs in vivo

9. Binding kinetics of Tus for its Ter sites
`
strategy
• Surface Plasmon Resonance (150 & 250 mM KCl)
– Molecular velcro ds TT-lock
Biotin-C4GC5
-CCCCGCCCCC
– Complementary partially
ss-Ter or TT-lock
GGGGCGGGGGTGAAATCAATGTTGTATGTTATT
ACTTTAGTTACAACATACTTATT
Each
Ter
GGGGCGGGGGTGAAATCAATGTTGTAT
ACTTTAGTTACAACATA

10. Binding kinetics of Tus for its Ter sites
`
Continued
– 250 mM KCl (top panel) TT-lock
Legend :
– 150 mM KCl (bottom panel) ds
Ter: A B C D E F G H I J
Ter: A B C D E F G H I J

11. Nucleotides involved in Tus binding
`
and TT-lock formation
TerF 4 T-C 21 affects binding*
Fold increase 8 T-G 20 affects binding*
in KD*
60 A-C 18 reduces binding to Q250*
3TT T-G 5 affects binding to R198*& kd TT-lock**
**
250 mM KCl 150 mM KCl
*Coskun-Ari et al, J Biol Chem, 1997; ** Mulcair et al, Cell, 2006

12. Nucleotides involved in Tus binding
`
and TT-lock formation
TerF T-C 21 affects binding*
Fold increase
T-G 20 affects binding*
in KD*
A-C 18 reduces binding to Q250*
T-G 5 affects binding to R198*& kd TT-lock**
TerH 10 T-G 21 reduces binding *
3 T-A 20 reduces binding *
3TT T-G 5 affects TT-lock formation
H I J
KCl
H I J
* Kamada et al, Nature, 1996 & Coskun-Ari et al, J Biol Chem, 1997; ** Mulcair et al, Cell, 2006

13. Nucleotides involved in Tus binding
`
and TT-lock formation
TerF T-C 21 affects binding*
Fold increase
T-G 20 affects binding*
in KD*
A-C 18 reduces binding to Q250*
T-G 5 affects binding to R198*& kd TT-lock**
TerH T-G 21 reduces binding *
T-A 20 reduces binding *
T-G 5 affects TT-lock formation
TerI 10 T-G 21 reduces binding *
26 A-T 9 affects binding to K89, R232,
*
l153, Y156, R139 (Sp/ bkn interactions)
1 A-C 7 silent*
H I J 3TT T-C 5 produce a weak TT-lock
KCl
H I J
* Kamada et al, Nature, 1996 & Coskun-Ari et al, J Biol Chem, 1997; ** Mulcair et al, Cell, 2006

14. Nucleotides involved in Tus binding
`
and TT-lock formation
TerF T-C 21 affects binding*
Fold increase
T-G 20 affects binding*
in KD*
A-C 18 reduces binding to Q250*
T-G 5 affects binding to R198*& kd TT-lock**
TerH T-G 21 reduces binding *
T-A 20 reduces binding *
T-G 5 affects TT-lock formation
TerI T-G 21 reduces binding *
A-T 9 affects binding to K89, R232,
*
l153, Y156, R139 (Sp/ bgd interactions)
A-C 7 silent*
H I J T-C 5 produce a weak TT-lock
KCl
TerJ 1 T-A 21 silent *
H I J 26 A-T 9 affects binding to K89, R232, l153,
Y156, R139 (Sp/ bgd interactions) *
Has the conserved T5
* Kamada et al, Nature, 1996 & Coskun-Ari et al, J Biol Chem, 1997; ** Mulcair et al, Cell, 2006

15. `
Conclusion
• Not all Ter sites mediate a TT-lock
i.e TerF and TerH
But still able to mediate some fork arrest
when replisome approaches towards the
No TT-lock
non permissive face
No TT-lock • Fork arrest is achieved through a combination
of affinity for Ter sites AND formation of a TT-lock
• Perspective: moderate or low binders are found on the outer termination
region and might have lost their binding properties or they have another
function in chromosome domains rearrangement/management during DNA
replication.

16. `
Ongoing work
In vivo use of Ter sites ?
Tracking replication forks movement during the cell cycle
using ChIP-chip in synchronised cell to locate the termination region
(Immunoprecipitation of DnaA, SSB and Tus bound DNA using specifically raised Ab
and sequence analysis)

17. Acknowledgments
`
Thank you for your attention
The lab
Dr P. Schaeffer
Dr. I. Morin
S. Askin
A. Cooper
Fundings
QTHA
JCU
JCU IPRS (Scholarship)

18. Nucleotides involved in Tus binding
`
and TT-lock formation
TerF 4 T-C 21 affects binding*
Fold increase 8 T-G 20 affects TT-lock formation *
in KD* *
60 A-C 18 reduces binding to Q250
3TT T-G 5 affect TT-lock**
TerH 10 T-G 21 reduces binding *
3 T-A 20 reduces binding *
3TT T-G 5 affects TT-lock formation
TerI 10 T-G 21 reduces binding *
26 A-T 9 affects binding to K89, R232,
*
l153, Y156, R139 (Sp/ bkn interactions)
1 A-C 7 silent*
H I J 3TT T-C 5 produce a weak TT-lock
KCl
TerJ 1 T-A 21 silent *
H I J 26 A-T 9 affects binding to K89, R232, l153,
Y156, R139 (Sp/ bgd interactions) *
Has the conserved T5
* Kamada et al, Nature, 1996 & Coskun-Ari et al, J Biol Chem, 1997; ** Mulcair et al, Cell, 2006

19. Ter sites, chromosome domains,
Perspectives Fis and H-NS binging and
`
transcriptome perturbation
• Only strong binders are
within a domain
• Other Ter sites flank left and
right domain
• Coincide with H-NS
binding
• Moderate binders might be
helped by complex DNA
topology to pause forks
Valens et al, EMBO J, 2004; Scolari et al. Mol BioSyst, 2011