This document describes research aiming to characterize the heme binding pocket of the gas-binding protein Tt H-NOX through the site-specific incorporation of unnatural amino acids (UAAs). The researchers created various mutants of Tt H-NOX with amber stop codons to enable the incorporation of UAAs. They found two UAAs could not be incorporated at position Y140 due to steric hindrance and created an additional F78A mutant to eliminate steric bulk near Y140, allowing incorporation of these UAAs. Future work will confirm UAA incorporation via mass spectrometry and use one UAA as a spectroscopic probe to study the local protein environment.

1. 1
Characterizing steric limitations of the heme pocket in the gas-binding Tt H-NOX protein
using site-specific incorporation of unnatural amino acids.
Lukasz T. Olenginski and Christine M. Phillips-Piro
Franklin & Marshall College, Department of Chemistry, Lancaster, PA 17604-3003
ABSTRACT
Heme Nitric Oxide and/or Oxygen (H-NOX) binding proteins are bacterial O2 and/or NO
gas-sensing proteins involved in signaling a variety of functions to the cell. The heme-binding
pocket in Thermoanaerobacter tencongensis H-NOX (Tt H-NOX) has been characterized using
site-directed mutagenesis with the 20 naturally occurring amino acids. The present study aims to
further characterize the heme-binding pocket of Tt H-NOX by incorporating unnatural amino
acids (UAAs) into the H-NOX scaffold, shedding light on both ligand discrimination and the
tuning of ligand affinity. Recent work suggests steric limitations in this pocket, whereby larger
UAAs have seen limited incorporation at the Y140 site. The present study demonstrates the
utility of an additional pocket mutation (F78A), which eliminates steric bulk near Y140, in
permitting the incorporation of two previously unsuccessful UAAs (mNO2Y, pNH2F). Future
work is focused on confirming UAA incorporation at the Y140 site via mass spectrometry as
well as probing Tt H-NOX local protein environment using pCNF as a spectroscopic probe.
INTRODUCTION
The genetically encoded method for incorporating unnatural amino acids (UAAs) has
allowed the thoughtful addition of a multitude of functionalities site-specifically in proteins with
a variety of applications.1-6 While successful incorporation of UAAs has proven difficult,
Franklin and Marshall College has witnessed significant success in incorporating both
commercially available UAAs and novel UAAs synthesized in-house.4-10 With this local
expertise, we have tremendous potential for incorporating UAAs into the protein systems of
interest (Figure 1). Further, structural studies on proteins containing UAAs have been elusory,
highlighting the importance of a systematic structure-function study of UAA-incorporated
proteins.
Heme-based sensors are a diverse group of signal transducing proteins that respond to
gases like nitric oxide (NO), oxygen (O2), and carbon monoxide (CO).11 The past 20 years has
witnessed an explosion in the number of known sensor proteins, from just two recognized
members, FixL and soluble guanylate cyclase (sGC), to four distinct families comprising more
ClBrIC
NN
H
H
HO
N
O O
1 2 3 4 5 6
Figure 1. The commercially available UAAs used in the present study. 1: 3-Nitro-L-Tyrosine (mNO2Y), 2: 4-
Amino-L-Phenylalanine (pNH2F), 3: 4-Cyano-L-Phenylalanine (pCNF), 4: 4-Iodo-L-Phenylalanine (pIF), 5: 4-
Bromo-L-Phenylalanine (pBrF), 6: 4-Chloro-L-Phenylalanine (pClF),.

2. 2
than 50 sensors.12 Heme-based sensors now feature four diverse heme-binding motifs: the heme-
binding PAS domain, globin-coupled sensor (GCs), CooA, and Heme Nitric Oxide and/or
Oxygen (H-NOX) binding domains.11-13 Containing both a PAS-like domain and an H-NOX
domain, the signal transducing protein sGC responds to nitric oxide (NO), a potent modulator of
cardiovascular physiology in mammals.14 A group of prokaryotic proteins have been found to be
related in sequence to the NO-binding sGCs.13,15-17 In facultative aerobes, these domains are
predicted to contain ~190 residues and are found in an operon with a histidine kinase (HK).11
Homologous domains are found in obligate anaerobes, where they fuse through membrane-
spanning region to a predicted methyl-accepting chemotaxis protein (MCP) domain.11 Similar to
the sGCs, the heme domains from facultative aerobes bind NO, but not O2. In contrast, the heme
domain bound to and MCP from the obligate anaerobe Thermoanaerobacter tengcongensis binds
O2, NO, and CO.13 In light of this discovered specificity for oxygen in some of these domains
they have also been referred to as Heme Nitric Oxide and/or Oxygen (H-NOX) binding domains.
Pellicena et al. (2004) reported the crystal structure of the O2-bound H-NOX domain
from T. tengcongensis (Tt H-NOX). Structural analysis reveals the H-NOX family to have
evolved a novel protein fold consisting of seven -helices and a four-stranded anti-parallel -
sheet (Figure 1). A major finding from the structure of the Tt H-NOX domain and critical to
ligand discrimination is the hydrogen bonding network that surrounds the bound O2
molecule.11,15,18-21 Y140 is involved in a 2.7 Å H-bond to O2 as well as to N74 and W9 are
(Figure 2).11 H-NOX sequence alignments strongly suggest that all three of these residues are
unique to members of the H-NOX family that bind O2.11
Figure 2. The heme binding pocket of Tt H-NOX with O2 bound (PDB ID: 1U55). The heme
and some residues shown in orange sticks. Y140 and H-bonding network known to be crucial
for tight O2 binding affinity.

3. 3
Gas ligand affinity to the heme of H-NOX proteins has been studied using site-directed
mutagenesis (SDM) with the 20 naturally occurring amino acids.18,20,22-30 For instance, P115, a
conserved residue in the H-NOX family, was mutated to an alanine and used to demonstrate that
decreasing heme distortion increases affinity for oxygen, providing a clear link between the
heme conformation and Tt H-NOX structure.19 Y140L provided further evidence that the distal
pocket tyrosine not only stabilizes the O2 complex but also discriminates between NO and O2
using a kinetic selection.18 Furthermore, the double mutant F78Y/Y140L demonstrated that O2
binding could be rescued as long as there was a distal pocket tyrosine.11,18
Due to the many findings highlighting the importance of a distal pocket tyrosine, we aim
to focus our tuning of gas ligand affinity on Y140. However, we aim to expand the sensitivity
range of Tt H-NOX by incorporating UAAs at the 140 site. Specifically, we propose to
incorporate unnatural tyrosine analogs with either withdrawing groups (EWG) or electron
donating groups (EDG) at the para-position on the phenyl ring to either make the 140 site a
better or poorer hydrogen bond donor and thus a stronger or weaker O2 binder, respectively
(Figure 3). We will begin by incorporating a variety commercially available UAAs 1-6.
Ultimately, we aim to structurally characterize mutant H-NOX proteins containing 1 and 2 and
assess their O2 binding affinity, relating the hydrogen bond donating ability of the 140 site to the
O2 affinity of Tt H-NOX and any structural alterations that may have occurred.
O
O
His
H
O
Fe
O
O
His
H
O
Fe
N
O
His
H
O
Fe
Stronger
H-Bond
donor
Weaker
H-Bond
donor
H
L-3-Nitrotyrosine L-4-Aminophenylalanine
(mNO2Y) (pNH2F)
Tyrosine
NO
O
O2 affinity
Figure 3. Method of tuning the hydrogen bonding environment in the heme pocket of Tt H-NOX.

4. 4
MATERIALS AND METHODS
Cloning Tt H-NOX into appropriate expression vector. Tt H-NOX was cloned out of the pCW
vector (Appendix A) and digested with the restriction enzymes NcoI and XhoI (Appendix B).
Simultaneously, the pBAD vector containing sfGFP was digested with the same restrictions
enzymes and the Tt H-NOX insert was ligated into the empty pBAD vector using the following
plasmid/insert ratios – 1:1, 1:2, 2:1 (Appendix B).
SDM to create Tt H-NOX Amber (TAG) mutants. Successful cloning of Tt H-NOX out of pCW
and into pBAD required the second residue (K) to be mutated to glutamate, and thus once it was
in pBAD it was mutated back to the native lysine using the QuikChange® protocol (Appendix
C). The C terminus His6-tag was removed (necessary for successful crystallization) by the
insertion of a TAA stop codon after the protein sequence and before the His6-tag (Appenix A).
Lastly, TAG was inserted at the 140 site in order for the pDULE vector – containing both the
tRNA and the aminoacyl-tRNA synthetase – to add UAAs (Appendix B). The end result of the
multiple rounds of SDM was a non-His6-tagged Tt H-NOX construct with TAG at the 140 site
(Tt H-NOX-Y140TAG). All other TAG mutants (F52, F78, Y85, F151, F169, F183, Y185) were
created in the same manner – using the QuikChange® protocol (Appendix C).
SDM to Create Additional Tt H-NOX mutants. In an attempt to incorporate larger UAAs, an
additional mutation was made to the heme pocket (F78A). This mutant was generated using the
Tt H-NOX-Y140TAG construct as a template. Thus, this new construct (Tt H-NOX-Y140TAG-
F78A) contained both a TAG at the 140 site and the F78A mutation. Additionally, due to the
nontrivial nature of purifying non-His6-tagged Tt H-NOX constructs, Tt H-NOX_His6 TAG
mutants were created. The primers used to create the TAG mutants listed above (F52, F78,
F78A, Y85, F151, F169, F183, Y185) were used again, except the Wt Tt H-NOX_His6 (for F52,
F78, Y85, F151, F169) and Tt H-NOX-Y140TAG_His6 (for F78A) were used as the template.
Perhaps due to their proximity to the protein’s C-terminus, attempts to insert TAG at F183 and
Y185 were unsuccessful. Successful His6_TAG mutants included F52, F78, F78A, Y85, F151,
F169. These additional Tt H-NOX mutants were again created using the QuikChange® protocol
(Appendix C).
Tt H-NOX Expression. Appropriate Tt H-NOX expression construct and desired pDULE
synthetase construct were dual-transformed into chemically competent DH10B E. coli cells in
the afternoon and then plated on LB/Ampicillin/Tetracycline Agar plates and incubated at 37 C
overnight (Appenidx D). The next morning, the plates were taken out of the incubator,
parafilmed, and stored in the refrigerator at 4 C. Later that afternoon, the plates were taken out
of the refrigerator and used to make starter cultures in non-inducing media (Appendix E). The
next morning, auto-induction media was prepared (Appendix E). Expression volume was 250 ml
in a 500 ml baffled flask. Expression cultures were inoculated with starter culture (1ml:1 L) and
grown up at 37 C and 250 rpm for 30-36 hrs. Directly following incubation of the expression
cultures, the UAA solutions were prepared (Appendix E). Approximately 1 hour after the start of
incubation, the UAA solution (1 uM) and heme-precursor, 5-aminolevulinic acid (1 uM), were
added to the cultures. After 30-36 hrs, the cultures were spun down at 5000 rpm for 10 min and
the cell pellets were flash frozen and stored at -80 C.
Expressions were also performed in a yeast extract media. The Tt H-NOX expression
construct was transformed into the same cell line as described above. However, when making

5. 5
starter cultures, LB broth was used rather than non-inducing media. The yeast extract media was
prepared the day before the expression. Expression volume was 1 L in a 2 L baffled flask; thus
45 g yeast extract, 10 ml glycerol, and 900 ml ddH2O were added to each flask and autoclaved.
Before inoculation 100 ml of a 170 mM KH2PO4, 720 mM K2HPO4 phosphate buffer was added
to each expression culture. Cultures were inoculated as described above and allowed to grow at
37 C and 250 rpm. Once the OD600 reached ~ 0.7-0 .8 the incubation temperature was dropped
to 18 C and the cultures were induced with the same amount of 20% arabinose as prescribed in
the auto-induction media (2.5 ml/L). UAA and ALA solution were added in the same manner as
before (1 hr after induction). Cultures grew at 18 C and 250 rpm overnight and the next
morning the cell pellet was collected in the same fashion as mentioned above.
Tt H-NOX Purification. Round 1 – Cell pellet was thawed on ice, re-suspended in either 10 ml
(250 ml culture) or 40 ml (1 L culture) Lysis Buffer (50 mM TEA, pH 8.5, 20 mM NaCl), and
lysed by the addition of Lysozyme (0.25 mg/ml). PMSF (0.5 mM) and DNAse (3.75 mM) were
also added in order to inhibit endogenous proteases from degrading our protein and breaking
down the DNA, respectively. Lysis solution was then sonicated at 40 % amplitude for 2 min (2 s
pulse on, 2 s pulse off) and boiled at 70 C for 30 min. Samples were then spun down at 20,000
rpm for 45 min and the supernatant was flash frozen and stored at -80 C. Purity and presence of
protein was analyzed by SDS-PAGE, with each gel containing a re-suspension, pellet, and
supernatant sample.
Round 2 – The supernatant (~50 ml) was thawed and loaded onto a ~80-100 ml Q-650
column (anion exchange) pre-equilibrated with ~150 ml Lysis Buffer. Protein was run through
column using the Lysis Buffer at 1.5 ml/min. Red fractions (~ 30 ml) were collected and
concentrated to 2.5 ml. The protein was then run over a pre-packed PD10 column pre-
equilibrated with 25 ml Buffer B (50 mM HEPES, pH 6.5, 5% glycerol). After Tt H-NOX
protein was loaded, 3.5 ml Buffer B was added to make protein elute. Again, the red fractions
were collected. Then, the protein was loaded onto a ~ 80-100 ml CM-650 column (cation
exchange) pre-equilibrated with ~150 ml Buffer B and run through at 1.5 ml/min. All red colored
fractions were collected and analyzed with SDS-PAGE to inform which fractions should be
combined, concentrated, and ran over the S75 column. The CM-650 fractions that included Tt H-
NOX protein were combined (~25 ml) and concentrated down to ~ 4 ml. Protein was then
filtered through syringe filter, leaving 3 ml Tt H-NOX protein. Proteins was then loaded onto the
S75 column (size exclusion) pre-equilibrated with Buffer C (50 mM TEA, pH 7.5, 50 mM NaCl,
5% glycerol) and run at 0.20 ml/min. with the max pressure set at 0.27 MPa. Fractions near
peaks corresponding to the correct MW (~ 22 kDa) were analyzed by SDS-PAGE. Fractions
containing Tt H-NOX protein were combined and concentrated down to ~500 ul and
concentration was assessed by a Wave Scan.
RESULTS

6. 6
Addition of ALA aids expression of Tt H-NOX. Early expression attempts in auto-induction
media with both 1 and 2 resulted in low expression yields. Further, expression cultures lacked
the red color, indicative of heme-incorporation. Thus, heme precursor, 5-aminolevulinic acid
(ALA), was added to the expression cultures, resulting in redder cultures and increased levels of
expression (Figure 4).
Steric limitations involved in the heme pocket of Tt H-NOX. Despite the addition of ALA
aiding the expression of Tt H-NOX, consistent expression with 1 and 2 was not observed. This
led us to question the expression protocol. Thus, 5 ml test expressions in auto-induction media
with Wt Tt H-NOX_His6 and Tt H-NOX-Y140TAG_His6 with 1-6 were completed in order to
tease out whether the problems encountered were a result of the expression protocol or simply
the UAA incorporation. In the event that future purification became necessary and due to their
simplified purification protocol, the His6 constructs were used. Interestingly, there was sufficient
expression of both the Wt Tt H-NOX_His6 and Tt H-NOX_Y140_His6 with 4-6, suggesting that
neither our expression protocol or our method of incorporating the UAA was flawed, but rather
the UAA itself was the problem (Figure 5). Further, it appears as though 6 expressed more than
5, which expressed more than 4, which expressed more than 1-3, which, when considering the
van der Waal radii of these para-constituents (Cl: 1.77, Br: 1.92, I: 2.06, CN: 2.19)31, suggests
sterics (Figure 5). In sum, these data suggest that there is a steric limitation to what UAAs can be
incorporated into the heme pocket of Tt H-NOX.
Figure 4. Impact of addition of ALA on expression of Tt H-NOX-Y140TAG with 1. (A) Expression
cultures after 30-36 hr growth period. (B) Pellet following growth period. (C) Purification supernatant.
(D) Purification pellet. (E) SDS-PAGE gel of Tt H-NOX-Y140TAG with 1 following first steps of
purification with (lanes 3-5) and without (lanes 6-8) addition of ALA.

7. 7
Because expression volumes were very small and consistent results with the auto-
induction media were elusory, definitive conclusions were yet to be made. Thus, the expression
of Tt H-NOX-Y140TAG with 4-6 in a new expression media (yeast extract) was repeated (1 L
per construct). The same trend – the larger the size of the halogen constituent at the para-position
of the phenylalanine ring, the smaller the level of expression – was observed (Figure 6). Further,
proof that these constructs could be expressed in a larger scale was achieved (Figure 6).
kDa (+) P S P S P S P S P S P S P S
50
25
20
pNH2 mNO2Y WT_H6 pCNF pClF pBrF pIF
15
20
25
37
Wt Tt pClF pBrF pIF
kDa P S P S P S P S(+)
Figure 5. SDS-PAGE gel of Wt Tt H-NOX_His6 and Tt H-NOX-Y140TAG_His6 with 1-6 following
first steps of purification. As indicated by lane 2, Tt H-NOX protein should appear ~ 22 kDa. Other
than the WT His6 construct (lanes 7, 8), only constructs containing 4-6 expressed well (lanes 11-16).
Further, expression levels decreased as the size of the halogen constituent increased.
Figure 6. SDS-PAGE gel of Wt Tt H-NOX_His6 and Tt H-NOX-Y140TAG_His6 with 4-6
following first steps of purification. As indicated by lane 2, Tt H-NOX protein should appear ~
22 kDa. Successful expression of all constructs was observed, again with expression levels
decreasing as the size of the halogen constituent increases

8. 8
Toward confirming the steric hypothesis of UAA incorporation into the heme pocket of Tt H-
NOX. Repeated observations that 4-6 could be incorporated into Tt H-NOX-Y140TAG, while 1-
3 could not, suggested a steric hypothesis for UAA incorporation into the heme pocket of Tt H-
NOX. A deeper look into this pocket sheds light on how this steric issue should be approached.
Figure 7 shows the proximity of one of residue Y140’s nearby neighbors, residue F78. The left
panel, with each residue’s atoms shown in spheres, emphasizes the steric bulk imposed on Y140
by F78 (Figure 7). Thus, it stands to reason that by removing this bulk, for example by mutating
F78 to A78 as shown in the right panel, larger UAAs can be incorporated into Tt H-NOX-
Y140TAG.
To test the efficacy of this mutation (F78A) to permit incorporation of larger UAAs,
particularly 1 and 2, the expression profile shown in Figure 5 was repeated. These expressions
were only 100 ml, and were used primarily for proof of the F78A construct’s efficacy in
incorporating 1 and 2 via SDS-PAGE analysis. Successful incorporation of 1-6 was observed in
Tt H-NOX-Y140TAG (Figure 8). However, this SDS-PAGE gel is far from conclusive, but is a
step in the right direction. This preliminary data needs to be followed up with mass spectrometry
analysis in order to fully confirm whether we are indeed capable of incorporating 1-6 into Tt H-
NOX-Y140TAG with the F78A construct. Ultimately, the conclusion of this work will permit
the question of whether O2 affinity in Tt H-NOX can be modulated via incorporation of UAAs to
be addressed.
Y140
F78
Y140
A78
Figure 7. Heme pocket of Tt H-NOX (PDB ID: 1U55). Protein shown in surface representation
with van der Waal radii of the atoms in Y140 and F78 shown. Left image shows F78 modeled in
whereas the right image shows the proposed F78A mutant modeled in.

9. 9
Incorporation of UAAs in other sites on Tt H-NOX. A separate aim of the present study
involves probing the local protein environment in Tt H-NOX, using 3 as a spectroscopic probe.
This requires sites of different protein environments (fully buried, partially-buried, solvent
exposed) to be chosen, the appropriate TAG mutants created, and expressions those TAG
mutants with 3 to be completed. Because we are using 3 as a probe, only native tyrosine and
phenylalanine residues were considered, so as to ensure a most conservative mutation.
GETAREA software was used to generate the solvent accessibility data, and the following
mutants were chosen because they represented the necessary range of protein environments –
F52, F78, Y85 (fully buried), F151, F169, F183 (partially buried), and Y185 (solvent accessible)
(Figure 9, Appendix F).
20
25
50
kDa (+) P S P S P S
Wt_H6 pNH2F mNO2Y
P S P S P S
pCNF pIF pBrF
P S
pClF
Figure 9. Tt H-NOX showed in cartoon representation (PDB ID: IU55) with select tyrosine and
phenylalanine residues shown in yellow sticks and colored by atom.
Figure 8. SDS-PAGE gel of Wt Tt H-NOX_His6 and Tt H-NOX-Y140TAG-F78A with 1-6
following first steps of purification. As indicated by lane 2, Tt H-NOX protein should appear ~
22 kDa. Successful expression of all constructs was observed.

10. 10
Further, all the chosen sites were successfully cloned and expressed with 3 (Figure 10).
Much like the F78A expressions, these expressions were only 100 ml, and were used primarily
for proof of principle that 3 can incorporated into Tt H-NOX in the necessary sites so that it can
serve as a successful spectroscopic probe. It is important to note that the reason the F169
construct showed no expression was not its failure to incorporate 3, but rather its conical tube
spilt in the centrifuge during purification (Figure 10). These data bring the present study one step
closer towards probing the local protein environment in Tt H-NOX.
DISCUSSION
The initial focus of the present study was to tune the gas ligand affinity of Tt H-NOX by
incorporating UAAs at the 140 site. This was motivated by the many findings highlighting the
importance of a distal pocket tyrosine. Specifically, we sought to incorporate unnatural tyrosine
analogs with either withdrawing groups (EWG) or electron donating groups (EDG) at the para-
position on the phenyl ring to either make the 140 site a better or poorer hydrogen bond donor
and thus a stronger or weaker O2 binder, respectively (Figure 3). To familiarize ourselves with
the system of interest, we began by incorporating a variety commercially available UAAs 1-6.
These efforts proved more difficult than anticipated, as early expressions were only successful in
incorporating 4-6 (Figure 5, 6). These observations fueled the steric hypothesis for incorporating
UAAs into the heme pocket of Tt H-NOX. Further, molecular analysis revealed F78 to be
imposing tremendous steric bulk on Y140 (Figure 7). Thus, we thought a mutation that removed
this bulk would provide more room in the heme pocket, allowing better UAA incorporation. To
test the efficacy of this mutation (F78A) to permit incorporation of larger UAAs, particularly 1
and 2, the expression profile shown in Figure 5 was repeated. Although SDS-PAGE analysis
revealed expression of the Tt H-NOX constructs containing 1-6, further confirmation is required
to support our steric hypothesis (Figure 8).
kDa (+) P S P S P S P S P S P S P S
F52 F78 Y85 F151 F169 F183 Y185
50
25
20
Figure 10. SDS-PAGE gel of Tt H-NOX TAG mutants + pCNF following first steps of
purification. As indicated by lane 2, Tt H-NOX protein should appear ~ 22 kDa. Successful
pCNF incorporation was seen at all of the sites (lanes 3-10, 13-16) except the F169 site
(lanes 11, 12).

11. 11
Thus, the most immediate future directions for this project include repeated the
expression of Tt H-NOX-Y140TAG-F78A with 1-6 at a larger scale (1 L per construct). If SDS-
PAGE analysis reveals a similar trend as Figure 8, then incorporation of 1-6 will be confirmed
via mass spectrometry analysis. Obviously, there were plenty of things preventing the initial
focus – tuning the gas ligand affinity of Tt H-NOX via UAA incorporation UAAs at the 140 site
– from being fully investigated. However, the present work provides the proper basis for this
focus to be revisited with the proper detail.
The present study also sought to tackle a new aim – probing local protein environment in
Tt H-NOX using 3 as a spectroscopic probe. As outlined in the previous section, much of the
preliminary work has been accomplished. Namely, sites of different protein environments (fully
buried, partially-buried, solvent exposed) have been chosen, the TAG mutants created, and
incorporation of 3 at these sites proven (Figure 9, 10). In order to properly advance this aim, two
things must be accomplished. First, we need to find another solvent exposed residue and create
its TAG mutant. As described in the methods section, efforts to create a TAG mutant for Y185
have been unsuccessful. Thus, in order to obtain the crucial solvent exposed residue either the
SDM for the Y185TAG needs to be repeated or a new site needs to be chosen. Based on the
GETAREA output in Appendix F, this site will not be a native tyrosine or phenylalanine reside,
which creates a less conservative mutation. Second, we need to prove that 3 can be incorporated
into the His6_TAG. Because this aim involves protein IR, as opposed to crystallography, we are
not forced to use non-His6 constructs. Thus, we will use the His6-TAG constructs, which is
further benefited by their simplified purification protocol.
In sum, tremendous progress has been reached with both these aims to the point where
each aim can now be thoroughly and directly investigated.

12. 12
REFERENCES
(1) Seyedsayamdost, M. R., Yee, C. S., and Stubbe, J. (2007) Site-specific incorporation of
fluorotyrosines into the R2 subunit of E. coli ribonucleotide reductase by expressed protein
ligation. Nat Protoc 2, 1225–1235.
(2) Wang, L., Xie, J., Deniz, A. A., and Schultz, P. G. (2003) Unnatural amino acid mutagenesis
of green fluorescent protein. J. Org. Chem. 68, 174–176.
(3) Groff, D., Wang, F., Jockusch, S., Turro, N. J., and Schultz, P. G. (2010) A New Strategy to
Photoactivate Green Fluorescent Protein. Angew. Chem. Int. Ed. 49, 7677–7679.
(4) Miyake-Stoner, S. J., Miller, A. M., Hammill, J. T., Peeler, J. C., Hess, K. R., Mehl, R. A.,
and Brewer, S. H. (2009) Probing protein folding using site-specifically encoded unnatural
amino acids as FRET donors with tryptophan. Biochemistry 48, 5953–5962.
(5) Bazewicz, C. G., Lipkin, J. S., Smith, E. E., Liskov, M. T., and Brewer, S. H. (2012)
Expanding the utility of 4-cyano-L-phenylalanine as a vibrational reporter of protein
environments. J Phys Chem B 116, 10824–10831.
(6) Bazewicz, C. G., Liskov, M. T., Hines, K. J., and Brewer, S. H. (2013) Sensitive, site-
specific, and stable vibrational probe of local protein environments: 4-azidomethyl-L-
phenylalanine. J Phys Chem B 117, 8987–8993.
(7) Pavic, K., Rios, P., Dzeyk, K., Koehler, C., Lemke, E. A., and Köhn, M. (2014) Unnatural
Amino Acid Mutagenesis Reveals Dimerization As a Negative Regulatory Mechanism of VHR's
Phosphatase Activity. ACS Chem. Biol.
(8) Jackson, J. C., Duffy, S. P., Hess, K. R., and Mehl, R. A. (2006) Improving nature's enzyme
active site with genetically encoded unnatural amino acids. J. Am. Chem. Soc. 128, 11124–
11127.
(9) Taskent-Sezgin, H., Chung, J., Patsalo, V., Miyake-Stoner, S. J., Miller, A. M., Brewer, S.
H., Mehl, R. A., Green, D. F., Raleigh, D. P., and Carrico, I. (2009) Interpretation of p-
cyanophenylalanine fluorescence in proteins in terms of solvent exposure and contribution of
side-chain quenchers: a combined fluorescence, IR and molecular dynamics study. Biochemistry
48, 9040–9046.
(10) Smith, E. E., Linderman, B. Y., Luskin, A. C., and Brewer, S. H. (2011) Probing local
environments with the infrared probe: L-4-nitrophenylalanine. J Phys Chem B 115, 2380–2385.
(11) Pellicena, P., Karow, D. S., Boon, E. M., Marletta, M. A., and Kuriyan, J. (2004) Crystal
structure of an oxygen-binding heme domain related to soluble guanylate cyclases. Proc. Natl.
Acad. Sci. 101, 12854-12859.
(12) Gilles-Gonzalez, M. A., and Gonzalez, G. (2005) Heme-based sensors: defining
characteristics, recent developments, and regulatory hypotheses. J. Inorg. Biochem. 99, 1-22.
(13) Karow, D. S., Pan, D., Tran, R., Pellicena, P., Presley, A., Mathies, R. A., and Marletta,
M.A. (2004) Spectroscopic characterization of the soluble guanylate cyclase-like heme domains
from Vibrio cholera and Thermoanaerobacter tengcongensis. Biochemistry. 43, 10203-10211.
(14) Denninger, J. W. and Marletta, M. A. (1999) Guanylate cyclase and the NO/cGMP
signaling pathway. Biochim. Biophy. Acta. 1411, 334-350.
(15) Schmidt, P. M., Schramm, M., Schröder, H., Wunder, F., and Stasch, J. P. (2004)
Identification of residues crucially involved in the binding of heme moiety of soluble guanylate
cyclase. J. Biol. Chem. 279, 3025-3032.

13. 13
(16) Winger, J. A., Derbyshire, E. R., and Marletta, M. A. (2007) Dissociation of nitric oxide
from soluble guanylate cyclase and heme-nitric oxide/oxygen binding domain constructs. J. Biol.
Chem. 282, 897-907.
(17) 12. Boon, E. M., Davis, J. H., Karow, D .S., Huang, S. H., Tran, R., Miazgowicz, M. M.,
Mathies, R., and Marletta, M. A. (2006) Nitric oxide binding to prokaryotic homologs of the
soluble guanylate cyclase b1 H-NOX domain. J. Biol. Chem. 281, 21892-902.
(18) Boon, E. M., Huang, S. H., and Marletta, M. A. (2005) A molecular basis for NO selectivity
in soluble guanylate cyclases. Nat. Chem. Biol. 1, 53-59.
(19) Olea, C., Boon, E. M., Pellicena, P., Kuriyan, J., and Marletta, M. A. (2008) Probing the
function of heme distortion in the H-NOX family. ACS Chem. Biol. 3, 703-710.
(20) Weinert, E. E., Plate, L., Whited, C. A., Olea, C. Jr., and Marletta, M. A. (2010)
Determinants of ligand affinity and heme reactivity in H-NOX domains. Angew. Chem., Int. Ed.
49, 720-723.
(21) Martin, E., Berka, V., Bogatenkova, E., Murad, F., and Tsai, A. (2006) Ligand selectivity of
guanylyl cyclase: effect of the hydrogen-binding tyrosine in the distal heme pocket on binding of
oxygen, nitric oxide, and carbon monoxide. J. Biol. Chem. 281, 27836-27845.
(22) Weinert, E. E., Phillips-Piro, C. M., Tran, R., Mathies, R. A., and Marletta, M. A. (2011)
Controlling conformational flexibility of an O2-binding H-NOX domain. Biochemistry. 50, 6832-
6840.
(23) Weinert, E. E., Phillips-Piro, C. M., and Marletta, M. A. (2013) Porphyrin π-stacking in a
heme protein scaffold tunes gas ligand affinity. J. Inorg. Biochem. 127, 7–12.
(24) Olea, C., Jr., Kuriyan, J., and Marletta, M. A. (2010) Modulating Heme Redox Potential
through Protein-Induced Porphyrin Distortion. J. Am. Chem. Soc. 132, 12794–12795.
(25) Olea, C., Boon, E. M., Pellicena, P., Kuriyan, J., and Marletta, M. A. (2008) Probing the
Function of Heme Distortion in the H-NOX Family. ACS Chem. Biol. 3, 703–710.
(26) Olea, C., Jr., Herzik, M. A., Jr., Kuriyan, J., and Marletta, M. A. (2010) Structural insights
into the molecular mechanism of H-NOX activation. Protein Science 19, 881–887.
(27) Derbyshire E. R., Deng S., and Marletta M. A. (2010) Incorporation of tyrosine and
glutamine residues into the soluble guanylate cyclase heme distal pocket alters NO and O2
binding. J Biol Chem. 285, 17471-8.
(28) Tran R., Boon E. M., Marletta M. A., and Mathies R. A. (2009) Resonance raman spectra of
an O2-binding H-NOX domain reveal heme relaxation upon mutation. Biochemistry. 48, 8568-
77.
(29) Kosowicz, J. G. and Boon, E. M. (2013) Insights into the distal pocket of H-NOX using
fluoride as a probe for H-bonding interactions. J Inorg. Biochem. 126, 91-5.
(30) Dai, Z. and Boon, E. M. (2011) Probing the local electronic and geometric properties of the
heme iron center in an O2-binding Heme-Nitric oxide and/or Oxygen binding domain. J Inorg.
Biochem. 105, 784-792.
(31) Bondi, A. (1964) van der Waals Volumes and Radii. J. Phys. Chem. 68, 441

14. 14
APPENDIX
A. Cloning Tt H-NOX out of pCW
NcoI – GAG – residue 3 – F
5’ – GC CC ATG GAG GGG ACA ATC GTC GGG ACA TGG ATA AAG ACC C – 3’
Tt H-NOX – STOP – XhoI - R
5’ – CG CTCGAG TTA ATT TTT CTT ATA CTC AAA AAC GGG G – 3’
Cloning Reaction
Volume (ul)
Tt H-NOX in pCW (25 ng) 0.425
Primer – F (10 uM) 2
Primer – R (10 uM) 2
10 X Buffer 5
ddH2O 38.35
dNTP mix (10 mM) 1.25
Pfu II Turbo Polymerase 1
50 ul Total Reaction
Ran PCR program “PIRO PCR” (subdirectory 1, program 1)
1. 95 C for 6 min.
2. 95 C for 30 s.
3. 55 C for 30 s.
4. 72 C for 2 min, 30 s.
5. Repeat steps 2-4 (34x)
6. 72 C for 10 min.
7. 4 C for 10 min.
8. 10 C forever
B. Digestion and Ligation Protocols
Single Digestion Reaction
Volume (ul)
XhoI/NcoI 1
pBAD-GFP (1 ug) 6
10 X Cutsmart Buffer 5
ddH2O 38
50 ul Total Reaction

15. 15
Double Digestion Reaction
Volume (ul)
XhoI
NcoI
1
1
pBAD-GFP (1 ug) 6
10 X Cutsmart Buffer 5
ddH2O 37
50 ul Total Reaction
Ligation Reactions
1:1 Reaction (ul) 2:1 Reaction (ul) 1:2 Reaction (ul)
10 X DNA Ligase Buffer 2 2 2
pBAD + NcoI + XhoI 2 4 2
Tt H-NOX_Y140 insert 2 2 4
Nuclease free water 13 11 11
T4 DNA Ligase 1 1 1
20 ul Total 20 ul Total 20 ul Total
Sequencing results of Tt H-NOX_Y140 in pBAD
Y140 construct exhibits incorrect second residue and nonsense codon at position Y140,
indicative of successful entry into pBAD

16. 16
C. SDM to create appropriate expression constructs
Construct Forward primer (5’-3’) Reverse Primer (5’-3’)
Tt H-NOX-Y140-E2K GGGCTAACAGGAGGAATTAACCAT
GAAGGGGACAATCGTCGGGACATG
GATAAAGACCC
GGGTCTTTATCCATGTCCCGACGAT
TGTCCCCTTCATGGTTAATTCCTCC
TGTTAGCCC
Tt H-NOX-F52TAG GAGGTTAGGAGAATTTAGGCTAAG
GTGAGTGAAAAAACT
AGTTTTTTCACTCACCTTAGCCTAA
ATTCTCCTAACCTC
Tt H-NOX_F78TAG GGCAGAACATAAAAACTTAGAGCG
AATGGTTTCCCTCC
GGAGGGAAACCATTCGCTCTAAGTT
TTTATGTTCTGCC
Tt H-NOX-Y140TAG-
F78A
GGCAGAACATAAAAACTGCCAGCG
AATGGTTTCCCTCC
GGAGGGAAACCATTCGCTGGCAGTT
TTTATGTTCTGCC
Tt H-NOX-Y85TAG CGAATGGTTTCCCTCCTAGTTTGC
AGGGAGAAGGCTAGTG
CACTAGCCTTCTCCCTGCAAACTAG
GAGGGAAACCATTCG
Tt H-NOX-F151TAG ATAGAGGGTAGTTCTAAATAGTTC
AAGGAAGAAATTTCAG
CTGAAATTTCTTCCTTGAACTATTT
AGAACTACCCTCTAT
Tt H-NOX-F169TAG CGAAAGAGGCGAAAAAGATGGCTA
GTCAAGGCTAAAAGTC
GACTTTTAGCCTTGACTAGCCATCT
TTTTCGCCTCTTTCG
Tt H-NOX-F183TAG AAATTTAAAAACCCCGTTTAGGAG
TATAAGAAAAATTAAC
GTTAATTTTTCTTATACTCCTAAAC
GGGGTTTTTAAATTT
Tt H-NOX-Y185TAG CCCCGTTTTTGAGTAGAAGAAAAA
TTAACTCGAGATCTGC
GCAGATCTCGAGTTAATTTTTCTTC
TACTCAAAAACGGGG
QuikChange® SDM Protocol
10 ng plasmid reaction (ul) 50 ng plasmid reaction (ul)
E2K-primer-F (1 uM) 6.8 6.8
E2K-primer-R (1 uM) 6.96 6.96
pBAD_Tt H-NOXY140 0.648 3.24
Pfu Ultra II 10 X Buffer 5 5
dNTPs (10 mM) 1 1
ddH2O 28.6 (29.6 for control) 26 (27 for control)
Pfu Ultra II Polymerase 1 (0 for control) 1 (0 for control)
50 ul Total Reaction 50 ul Total Reaction
Ran PCR program “PIRO-SDM” (subdirectory 1, program 3)
1. 95 C for 30 s.
2. 95 C for 30 s.
3. 55 C for 30 s.
4. 68 C for 4 min, 30 s.
5. Repeat steps 2-4 (18x)
6. 10 C forever
Following PCR - Add 1 ul DpnI and incubate (37 C) for 1 hr and then transform SDM product

17. 17
Sequencing results following SDM reactions
Tt H-NOX-Y140-E2K
Tt H-NOX-F52TAG
6

18. 18
Tt H-NOX-F52TAG_His6
Tt H-NOX-F78TAG_His6

19. 19
Tt H-NOX-Y140TAG-F78A
Tt H-NOX-Y140TAG-F78A_His6

20. 20
Tt H-NOX-Y85TAG
Tt H-NOX Y85TAG_His6

21. 21
Tt H-NOX-F151TAG
Tt H-NOX-F151TAG_His6
** SDM was successful however TAG codon is at 169 site rather
than the 151 site, so I assume they just misread the labeled
tubes **

22. 22
Tt H-NOX-F169TAG
Tt H-NOX-F169TAG_His6
** SDM was successful however TAG codon is at 151 site rather
than the 169 site, so I assume they just misread the labeled
tubes. **

23. 23
Tt H-NOX-F183TAG
Tt H-NOX-F183TAG_His6

24. 24
Tt H-NOX-Y185Amb
D. Dual-transformation of pBAD and pDule constructs
Dual-transformation
1. Thaw chemically competent DH10B E. coli cells on ice
2. Pipet 50 ul DH10B cells into 15 ml culture tube
3. 1 ul pBAD_TtY140 and 1 ul pDULE construct pipetted into cells
4. Allow cells to incubate on ice for 20 min.
5. Heat shock cells in water bath (42 C) for 45 s.
6. Put cells back on ice
7. Rescue cells by adding 200 ul SOC media
8. Place 15 ml culture tubes in incubator (37 C, 250 rpm) for 1 hr.
9. While cells are incubating warm up LB/Amp/Tet plates
a. Place plates right-side up with lid cock-eyed for 5-10 min.
b. Put lid on and turn plates over for remainder of incubation.
10. Plate 50 ul of cells and place in 37 C bench-top incubator
a. Place plates right-side up with lid cock-eyed for 5-10 min.
b. Put lid on and turn plates over and leave overnight
11. Next morning take plates out of incubator, parafilm, and store in 4 C refrigerator
(Perform under sterile conditions)

25. 25
E. Auto-induction Expression Protocol
Non-inducing Media – 50 ml
5 % Aspartate (pH 7.5) 2.5 ml (autoclave)
25 X M salts 2 ml (autoclave)
18 AA mix (25 X, 4 C) 2 ml
40 % Glucose 625 ul (autoclave)
1 M MgSO4 100 ul (autoclave)
Trace metals (1000 X) 10 ul
Leucine (4 mg/ml, pH 7.5) 500 ul (autoclave)
Sterile ddH2O Dilute to 50 ml (autoclave)
(Prepare under sterile conditions)
Preparing starter cultures for pBAD/pDULE dual-constructs
1. Add to a 15 ml culture tube: 5 ml non-inducing media
5 ul ampicillin
5 ul tetracycline
2. With a P2 pipet - gently scoop up a single colony from transformation LB/Amp/Tet plate and
dispense into culture tube.
3. Incubate (37 C, 250 rpm) overnight
Auto-induction Media – 1 L
5 % Aspartate (pH 7.5) 50 ml (autoclave)
10 % Glycerol 50 ml (autoclave)
18 AA mix (25 X, 4 C) 40 ml
25 X M salts 40 ml (autoclave)
Leucine (4 mg/ml, pH 7.5) 10 ml (autoclave)
20 % Arabinose 2.5 ml (sterile-filtered)
1 M MgSO4 2 ml (autoclave)
40 % Glucose 1.25 ml (autoclave)
Trace metals (1000 X) 1 ml
Sterile ddH2O Dilute to 1 L (autoclave)
Expression protocol
1. Prepare necessary quantity of auto-induction media
2. Add necessary antibiotics (Amp/Tet) each with 1000 X final concentration
3. Aliquot 250 ml auto-induction media into 500 ml baffled flasks
4. Inoculate expression culture with 2.5 ml of non-inducing starter culture
5. Incubate (37 C, 250 rpm) for 30-36 hrs.
6. 1 hr after start of growth period, add both the UAA solution and ALA solution.
a. UAA solution is prepared as follows:
i. UAA will have 1 mM final concentration.
ii. Weigh out 1/4th of the MW of desired UAA in mgs.

26. 26
iii. Add 1 ml sterile ddH2O and 8 M NaOH (dropwise) to help solution
dissolve.
iv. Add entire solution to expression culture.
b. A 1 M ALA solution is made and then 2.5 ml are added to expression culture
7. Expression cultures continue to grow for remainder of 30-36 hrs.
F. UAA incorporation at other sites in Tt H-NOX
Residue Total Apolar Backbone Sidechain Ratio In/out
Y17 32.67 18.13 23.77 8.90 4.6 in
F52 1.34 1.34 0.00 1.34 0.7 in
F78 34.66 34.66 0.00 34.66 19.2 in
F82 6.52 6.52 1.34 5.17 2.9 in
Y85 27.54 25.75 0.38 27.16 14.1 in
F86 16.48 11.03 5.44 11.03 6.1 in
F94 7.55 7.55 0.00 7.55 4.2 in
Y131 7.31 6.38 0.00 7.31 3.8 in
Y138 19.25 18.28 0.55 18.70 9.7 in
Y140 19.42 19.18 0.00 19.42 10.1 in
F141 9.41 9.40 1.82 7.59 4.2 in
F151 81.78 71.86 18.02 63.76 35.4
F152 28.71 16.21 18.12 10.60 5.9 in
F169 84.71 84.64 0.14 84.58 47.0
F178 5.33 4.90 0.51 4.83 2.7 in
F183 54.81 50.40 12.52 42.29 23.5
Y185 184.83 133.69 26.98 157.84 81.7 out
Table I. Solvent accessibility data for all tyrosine and phenylalanine sites in Tt H-NOX from
GETAREA software. Sites to explore highlighted in yellow. Buried sites: Y52, Y85, Y140 (which we
already have); Partially buried sites: F151, F169, F183; Solvent exposed sites: Y185.