1. INFECTION AND IMMUNITY,
0019-9567/00/$04.00ϩ0
Mar. 2000, p. 1116–1124 Vol. 68, No. 3
Copyright © 2000, American Society for Microbiology. All Rights Reserved.
Distribution of Core Oligosaccharide Types in
Lipopolysaccharides from Escherichia coli
KAREN AMOR,1
DAVID E. HEINRICHS,1
† EMILISA FRIRDICH,1
KIM ZIEBELL,2
ROGER P. JOHNSON,2
AND CHRIS WHITFIELD1
*
Department of Microbiology, University of Guelph, Guelph, Ontario N1G 2W1,1
and
Guelph Laboratory, Health Canada, Guelph, Ontario N1G 3W4,2
Canada
Received 29 July 1999/Returned for modification 21 September 1999/Accepted 29 November 1999
In the lipopolysaccharides of Escherichia coli there are five distinct core oligosaccharide (core OS) struc-
tures, designated K-12 and R1 to R4. The objective of this work was to determine the prevalences of these core
OS types within the species. Unique sequences in the waa (core OS biosynthesis) gene operon were used to
develop a PCR-based system that facilitated unequivocal determination of the core OS types in isolates of
E. coli. This system was applied to the 72 isolates in the E. coli ECOR collection, a compilation of isolates that
is considered to be broadly representative of the genetic diversity of the species. Fifty (69.4%) of the ECOR
isolates contained the R1 core OS, 8 (11.1%) were representatives of R2, 8 (11.1%) were R3, 2 (2.8%) were R4,
and only 4 (5.6%) were K-12. R1 is the only core OS type found in all four major phylogenetic groups (A, B1,
B2, and D) in the ECOR collection. Virulent extraintestinal pathogenic E. coli isolates tend to be closely related
to group B2 and, to a lesser extent, group D isolates. All of the ECOR representatives from the B2 and D groups
had the R1 core OS. In contrast, commensal E. coli isolates are more closely related to group A, which contains
isolates representing each of the five core OS structures. R3 was the only core OS type found in 38 verotoxigenic
E. coli (VTEC) isolates from humans and cattle belonging to the common enterohemorrhagic E. coli serogroups
O157, O111, and O26. Although isolates from other VTEC serogroups showed more core OS diversity, the R3
type (83.1% of all VTEC isolates) was still predominant. When non-VTEC commensal isolates from cattle were
analyzed, it was found that most possessed the R1 core OS type.
The lipopolysaccharides (LPSs) of Escherichia coli consist of
(i) a hydrophobic lipid A component that forms the outer
leaflet of the outer membrane, (ii) a phosphorylated, nonre-
petitive hetero-oligosaccharide known as the core oligosaccha-
ride (core OS), and (iii) a polysaccharide (O-PS) that extends
from the cell surface and that forms the O antigen detected in
serotyping (37). The smooth LPS (S-LPS) molecules found in
most clinical isolates of E. coli are composed of this three-part
structure, whereas rough LPS (R-LPS) lacks the O antigen and
can have a truncated core OS. The extent of structural diversity
in E. coli LPS molecules ranges from the highly conserved lipid
A to the extreme variations reflected in more than 170 known
O antigens (19). The core OS is conceptually divided into inner
and outer core regions. The inner core is composed primar-
ily of L-glycero-D-manno-heptose (heptose) and 3-deoxy-D-
manno-oct-2-ulosonic acid (Kdo) residues, and this part of the
core OS is phosphorylated in E. coli. The principal features of
the inner core OS structure are conserved among members of
the Enterobacteriaceae, presumably reflecting its essential role
in outer-membrane stability (16). The inner core OS structure
carries additional (often nonstoichiometric) glycosyl substitu-
ents, but these vary according to core OS type (16, 18). The
outer region of the core OS displays more variation, and dif-
ferences in this region distinguish the five core OS types in
E. coli: R1, R2, R3, R4, and K-12. While all of the outer core
OSs share a structural theme, with a (hexose)3 carbohydrate
backbone and two side chain residues, the order of hexoses in
the backbone and the nature, position, and linkage of the side
chain residues can all vary (Fig. 1). The structures for the R1
and R4 outer core OSs are highly similar, differing in only a
single ␤-linked residue. Members of the genus Shigella are
often proposed to be members of E. coli, and the R1 core OS
has been found in the LPSs of Shigella sonnei and in some
isolates of Shigella flexneri (9, 22, 25). The terminal part of the
R2 core OS resembles the corresponding region from Salmo-
nella enterica serovar Typhimurium in both structure and func-
tion, whereas the outer core backbone and substitution of GlcI
are identical to corresponding features of the K-12 core struc-
ture (14). There are also structural similarities between the
core OS terminus in the R3 type and that in a recently reported
second core type in the genus Salmonella (31).
Comparative sequence analyses have been performed for
the chromosomal waa (formerly rfa) loci responsible for core
OS biosynthesis in isolates representing the five known E. coli
core OS types (reviewed in reference 16). These data, together
with structural determinations of core OSs from defined mu-
tants, have helped resolve the functions of many of the outer
core OS biosynthesis gene products and specifically those in-
volved in the determination of the core OS type. Core OS
distributions in commensal E. coli (fecal) isolates and in iso-
lates from septicemia and urinary tract infections (UTIs) have
been examined by serological methods (2, 10). Although the
R1 core OS type predominates in these analyses, it is not clear
that these results are reflective of the broader species, and the
objective of our study was to address this issue. Using charac-
teristic waa sequences unique to each core OS type, we devel-
oped a PCR-based LPS core typing system for E. coli isolates.
The application of this system is described here.
(This study was presented in part at the 5th meeting of the
International Endotoxin Society, Santa Fe, N. Mex., Septem-
ber 1998 [abstr. 128], and at the 100th annual meeting of the
* Corresponding author. Mailing address: Department of Microbi-
ology, University of Guelph, Guelph, Ontario N1G 2W1, Canada.
Phone: (519) 824-4120, ext. 3478. Fax: (519) 837-1802. E-mail: cwhitfie
@uoguelph.ca.
† Present address: Department of Microbiology and Immunology,
University of Western Ontario, London, Ontario N6A 5C1, Canada.
1116

2. American Society for Microbiology, Chicago, Ill., June 1999
[abstr. B/D41]).
MATERIALS AND METHODS
Bacterial strains and growth conditions. The E. coli core OS prototypes used
in this study were (i) strain F470 (R1 core), an R-LPS derivative of O8:K27 (41);
(ii) F632 (R2), an R-LPS derivative of O100:K?(B):H2 (13); (iii) F653 (R3), an
R-LPS derivative of O111:K58Ϫ
(47); (iv) F2513 (R4), an R-LPS derivative of
O14:K7 (40); and (v) W3110 (CGSC4466), a representative isolate of E. coli
K-12. H. Brade (Forschungszentrum, Borstel, Germany) generously provided the
R1, R2, R3, and R4 strains. Strain 1502 is a prototype of the putative “R1R4
mixed core type” (2) (see below) and was kindly provided by B. J. Appelmelk.
The following isolates belonging to the O16 serogroup were obtained from F.
Scheutz (Statens Seruminstitut, Copenhagen, Denmark): C462-74 (O16:K1:
H48), C233-87 (O16:K2:H6), C523-76 (O16:K38:H20), C301-86 (O16:K100),
C1812-80 (O16:K1:H4), C945-96 (O16:K1:HϪ
), and C451-93 (O16:K1:H6). The
72 E. coli isolates that constitute the ECOR collection were generously provided
by H. Ochman (University of Rochester). To examine the relationship between
core OS type and verotoxigenic (VT-positive) phenotype, 85 E. coli isolates from
the collection held at the Health Canada Guelph Laboratory were investigated.
Fifty-six were human and animal verotoxigenic E. coli (VTEC) isolates repre-
senting the predominant enterohemorrhagic E. coli (EHEC) serogroups O26,
O111, and O157 (23). To examine the broader relationships, several VTEC
isolates from five other serogroups associated with bloody diarrhea (i.e., O55,
O91, O103, O113, and O145 [11, 20, 35]) and from serotypes rarely (or never)
identified among human VTEC were examined (1, 11). To determine whether
the core OS distribution differed among VTEC isolates and VT-negative com-
mensal E. coli isolates of the same serotypes, 20 isolates from cattle or meats
were tested. These included 11 isolates of E. coli O157 of various H types and 9
isolates belonging to other known VTEC serogroups. The VT status of the field
isolates and the presence of genes encoding the EHEC hemolysin and intimin in
non-VTEC isolates were established by published PCR-based protocols (33, 38).
The serotypes of E. coli isolates were established by standard serological meth-
ods (8) at the Health Canada Guelph Laboratory. Bacteria were grown on
Luria-Bertani agar incubated at 37°C.
PCR amplification of core type-specific fragments from the chromosomal waa
loci. Oligonucleotide primers for sequencing and for PCR amplification of DNA
products characteristic of R1, R2, R3, R4, and K-12 core OS types were designed
from the nucleotide sequences of genes in the chromosomal waa region from
strains F470, F632, F653, and F2513 and from E. coli K-12, respectively (Table
1). Primers were synthesized using a Perkin-Elmer 394 DNA synthesizer at the
Guelph Molecular Supercentre (University of Guelph). A mixture of all 10
primers was used in each PCR amplification. Chromosomal DNA PCR tem-
plates were purified from fresh overnight bacterial cultures by using InstaGene
matrix (Bio-Rad). Amplification reactions were performed by using a Perkin-
Elmer Gene Amp PCR system 2400 thermocycler. PCR conditions included an
initial denaturation step at 94°C for 1 min; each cycle after this step had a
denaturing step at 94°C for 20 s, an annealing step at 50°C for 30 s, and a
polymerization step at 72°C for 2 min 15 s. After 35 amplification cycles, a final
polymerization step was performed at 72°C for 2 min. Amplification was carried
out using Taq polymerase from Roche Diagnostics. PCR amplification products
were separated by electrophoresis on 0.8% agarose gels and visualized with
ethidium bromide. PCR amplification products were prepared for sequencing by
using QIAquick PCR purification columns (Qiagen). Automated sequencing of
PCR products was carried out at the Guelph Molecular Supercentre using a
Perkin-Elmer ABI 377 DNA sequencing system. DNA sequencing was used to
confirm the identities of the fragments from core OS prototype strains and from
FIG. 1. Structures of the five known outer core OSs from the LPSs of E. coli and genetic organization of the central waaQ operon from each of the waa (core OS
biosynthesis) loci. HepII is the last residue of the inner core OS. The asterisks indicate the points of attachment of O antigen, but this has only been determined
experimentally for the R1 and R2 core OSs. The gene products responsible for each residue of the core OS are indicated. Details can be found elsewhere (16). PCR
products diagnostic for each core OS type are shown below the relevant physical maps. The primer sequences are given in Table 1.
VOL. 68, 2000 LPS CORE OLIGOSACCHARIDE TYPES IN E. COLI 1117

3. random isolates of previously undetermined core types. Random strains were
also examined by hybridization using waa-specific gene probes to ensure the
validity of the PCR data.
RESULTS
Diagnostic PCR for determination of the known E. coli LPS
core types. Each of the E. coli core OSs shows unique struc-
tural features in its outer core regions, and the genes deter-
mining these features have been established (Fig. 1) (reviewed
in reference 16). These analyses provided unique DNA se-
quences that could be exploited for core OS diagnostics. The
R1 and R4 core OS structures are very similar, and the ma-
jority of the corresponding waa locus sequences are essentially
identical (15). However, the structures differ in the nature and
linkage of the ␤-linked hexose residue attached to GlcII, re-
flecting differences in the activities of the waaV (R1) and waaX
(R4) gene products. Although the waaL gene encodes an O-
antigen ligase required for addition of O-PS to the completed
R1 or R4 core OSs, the nature of the linkage site varies, and
this is reflected in the different primary sequences of the waaL
gene products (15). The R1 primer set is dependent on the
waaV gene encoding the unique glycosyltransferase for the
branch ␤-(132)-linked Glc residue that forms the attachment
site for O-PS in this core type and sequences in the R1-specific
waaL. For the R4 core type, one primer is based on sequences
for waaW, a gene encoding the transferase for the terminal
␣-(132)-linked Gal residue that is conserved in core types R1
and R4. Specificity of the R4 primer set is conferred by using
a second primer based on sequences from waaX, the gene
encoding the unique ␤-(134)-linked Gal transferase, which
generates the only structural difference between the outer core
OSs of types R1 and R4 (15). Detection of the R2 core type
uses one primer based on sequences in the gene encoding the
transferase for the ␣-(136)-linked side chain Gal residue
(waaB). The second primer site is located within wabA (for-
merly called waaS). The role of the wabA gene product is not
resolved, but it is thought to be involved in an R2 type-specific
modification of the inner core region (14, 16). The R3 core
type is detected by primers located in the R3-specific waaL
gene and a unique gene, waaD, whose precise role in outer
core OS biosynthesis is not yet established (16). The primer set
for the K-12 core type is based on sequences for the K-12-
specific ligase gene (waaL) and the waaU gene that is thought
to encode the transferase that adds the ␣-(136)-linked Hep
residue in the outer core (14). Oligonucleotide primer pairs
were designed such that easily resolved amplification products,
with sizes ranging from 550 bp to 1.7 kbp, identify each core
OS type (Fig. 2).
Although structural analyses have identified only five dis-
tinct core types in the LPSs of E. coli, the existence of an
additional core type was proposed following a survey of core
OS type distribution using type-specific polyclonal rabbit anti-
sera (2). Appelmelk et al. found that some bacteremic isolates
(13 isolates or 9.4% of the tested isolates) reacted with both R1
and R4 sera, suggesting an R1R4 mixed core type (2). DNA
from a prototype R1R4 mixed core type (strain 1502) was
examined by PCR. Diagnostic fragments for the R1 type were
obtained, with no evidence of R4-specific amplification prod-
ucts. To confirm this result, additional R4-specific primer sets
were tested, and again no amplification products were ob-
tained (E. Frirdich, K. Amor, and C. Whitfield, unpublished
data). Thus, the waa locus from strain 1502 is apparently sim-
ilar to R1 and lacks the sequences and genetic organization
that define the R4 core type. To test the possibility that R4-
specific genes might be located at an additional unlinked locus
in a standard R1 genetic background, chromosomal DNA was
digested with restriction enzymes and examined by Southern
hybridization using an internal probe from the waaX gene of
R4 (i.e., the gene whose product defines the R4 core OS type).
A positive reaction was obtained with DNA from the R4 pro-
totype (strain F2513), but none was detected at either high or
low stringency with strain 1502 (Frirdich et al., unpublished
data). We conclude that the R1R4 mixed core type isolate is
actually an R1 core type isolate.
Distribution of core types in the ECOR collection. Previous
studies involving serological examination of core types have
focused on isolates from (i) blood cultures (2); (ii) a collection
including isolates from bacteremia or UTIs, together with fecal
isolates from asymptomatic individuals (10); and (iii) VTEC
isolates (6). However, such isolates would not necessarily pro-
vide an unbiased evaluation of core types in natural popula-
tions since these isolates come from niches where they would
require specific virulence determinants. Furthermore, E. coli is
a highly clonal species (50), and the phylogenetic relationships
among the various isolates examined with respect to core OS
type were not determined.
The 72 isolates of the ECOR collection originate from di-
verse geographic locations, and they differ in their character-
istic patterns in multilocus enzyme electrophoresis (MLEE)
FIG. 2. Agarose gel showing the electrophoretic mobilities of PCR products
obtained from the prototype strains representing each core OS type.
TABLE 1. Oligonucleotide primers used in this study
Primer Sequencea
(5Ј–3Ј) GenBank accession no.b
R1C3 GGGATGCGAACAGAATTAGT AF019746
R1K15 TTCCTGGCAAGAGAGATAAG AF019746
R2C4 GATCGACGCCGGAATTTTTT AF019375
R2K9 AGCTCCATCATCAAGTGAGA AF019375
R3C2 GGCCAAAACACTATCTCTCA AF019745
R3K13 GTGCCTAGTTTATACTTGAA AF019745
R4C4 TGCCATACTTTATTCATCA AF019747
R4K14 TGGAATGATGTGGCGTTTAT AF019747
K12-1 TTCGCCATTTCGTGCTACTT X62530, M80599, M86935,
AE000440, U00096, M86305,
U00039, M95398
K12-2a TAATGATAATTGGAATGCTGC X62530, M80599, M86935,
AE000440, U00096, M86305,
U00039, M95398
a
The locations of the primer sequences and the amplified fragments are
shown in Fig. 1.
b
GenBank accession numbers are for the complete waa loci.
1118 AMOR ET AL. INFECT. IMMUN.

4. analysis of 38 “housekeeping” enzymes (30). The ECOR col-
lection of isolates is considered to be broadly representative of
the genetic diversity within the E. coli species, and these iso-
lates are therefore often used as a framework for describing
clonal relationships in E. coli. We examined the ECOR collec-
tion to obtain a better view of the distribution of core OS types.
The O serotype of each isolate in the ECOR collection was
determined, and their core OS types were unequivocally as-
signed by PCR analysis. Fifty of the 72 isolates (69.4%) had the
R1 core OS. Of the remainder, 8 (11.1%), 8 (11.1%), 2 (2.8%),
and 4 (5.6%) isolates represented core OS types R2, R3, R4,
and K-12, respectively. The results are shown in the context of
the phylogenetic tree in Fig. 3.
Four major phylogenetic groups (A, B1, B2, and D) were
identified in the ECOR phylogenetic tree by neighbor-joining
analysis of MLEE using 38 loci (17) (Fig. 3). Four additional
isolates (ECOR31, -43, -37, and -42) form a minor group
(sometimes termed group E). Group A isolates (ECOR1 to
-25) are thought to represent a distinct lineage comprising
E. coli K-12 and isolates related to it (17). All five core OS
types occur within group A, and the limited number of ECOR
isolates with the K-12 core OS are confined to this group. The
minor group (group E) also shows diversity in core OS type,
with single isolates representing types R1, R2, R3, and R4. In
contrast, the remaining groups show much less core OS diver-
sity. Group B1 isolates contain primarily R1 (11 of 16; 68.8%)
and R3 (5 of 16; 31.2%) core OSs. All of the isolates repre-
senting groups B2 and D have type R1 core OSs.
Distribution of the K-12 core OS type. E. coli isolates with
the K-12 core type occur relatively infrequently among natural
populations of E. coli. The K-12 core OS type is confined to
group A and is found in a total of four isolates (ECOR2, -3,
-13, and -14) possessing serotypes O48, O1, OR, and O71,
respectively. Common laboratory E. coli K-12 derivatives have
R-LPS with the K-12 core OS, but analysis of the rfb (O-anti-
gen biosynthesis) locus has shown that the original serotype of
the K-12 lineage was O16 (24, 45). No members of the O16
serogroup were identified in the ECOR collection by sero-
typing (Fig. 3) so, to determine whether there was any corre-
lation between the O16 antigen and the K-12 core OS, we
examined several serogroup O16 isolates by PCR. Within this
limited number of isolates, only one (serotype O16:K1:H4,
strain C1812-80) with the K-12 core OS type was identified; the
remaining five strains possessed R1 core OSs. As seen with
some serotypes examined in the study by Gibb et al. (10), the
same O antigen can occur in strains with different core OS
types.
Prevalence of the R3 core type among VTEC isolates. Many
studies on the development of cross-reactive and cross-protec-
tive antibodies against E. coli core OSs have utilized LPS from
strain J5 as an immunogen. The J5 strain is an R-LPS mutant
that contains a truncated R3 core OS structure (12, 28). The
parent of strain J5 belonged to serogroup O111, a common
VT-positive serogroup of EHEC. To examine a possible cor-
relation between the R3 core and O111 antigen, the core OS
type of 15 field isolates of serogroup O111 was investigated.
These isolates represent two different serotypes based on H
antigens (O111:H8 and O111:HϪ
). All proved to be type R3
(Table 2). To investigate any association between the R3 core
OS type and the VT-positive genotype, the analysis was ex-
panded to include further VTEC isolates representing other
serogroups. Overall, 54 of 65 (83.1%) VTEC isolates had the
R3 core OS type. All 48 VT-positive human and animal iso-
lates representing EHEC serogroups O26, O55, O91, O103,
and O157 were core type R3 (Table 2). Furthermore, the R3
core OS was the most frequent among the selected animal
VTEC isolates belonging to serotypes rarely associated with
human illness (66.7%) (Table 2). Of the four other core OS
types, R1 was the most common among the VTEC isolates
tested (8 of 65; 12.3%) and R1 predominated in serogroups
O113 and O145. The frequencies of core types R2, R4, and
K-12 were 0 (0%), 1 (1.5%), and 2 of 65 (3.1%), respectively.
Also included in our survey were a variety of non-VTEC
commensal isolates from cattle and meats belonging to known
VTEC serogroups. These were examined to determine wheth-
FIG. 3. Phylogenetic tree of the ECOR isolates (17) showing the distribution
of the five core OS types. The number of the ECOR isolate is given in boldface
italics. For each isolate the determined O:H serotype and core OS type are listed.
OR, R-LPS; ?, antigen not determined. The serotyping results reported here
showed some differences to those reported elsewhere (T. S. Whittam, http:
//www.bio.psu.edu/People/Faculty/Whittam/Lab). In many cases the discrepan-
cies reflect a nontypeable reaction in one set of data or the other and may reflect
subtle differences in growth conditions, protocol, or antisera. In the analysis
reported here, there were significantly less nontypeable antigens. In some cases,
the serotypes varied between the two studies. To verify the data reported here,
two independently held ECOR collections were examined and each of the
isolates giving different serotypes was retested.
VOL. 68, 2000 LPS CORE OLIGOSACCHARIDE TYPES IN E. COLI 1119

5. er the R3 core type was favored in commensal bovine E. coli
having the same O antigens as known human and/or bovine
VTEC. Of 20 isolates, 10 (50%) were type R1, 2 (10%) were
R2, and 8 (40%) were R3 (Table 3). Five of the eight isolates
with the R3 core type belonged to recognized EHEC serotypes
(O157:H7, O157:HϪ
) or to O156:H25, another virulent VTEC
serotype. Since VTEC isolates may readily lose their VT genes
(21), these and the 15 other non-VTEC isolates were tested by
multiplex PCR for genes encoding two other virulence factors
of EHEC, the EHEC hemolysin and intimin (33). Two VT-
negative isolates of E. coli O157:H7 and one VT-negative iso-
late of E. coli O156:H25 carried genes for both factors (K.
Ziebell, R. P. Johnson, and C. Whitfield, unpublished data).
The presence of both virulence factors in isolates of well-
recognized virulent VTEC serotypes strongly suggests that
they were originally VT positive but had lost their VT genes.
Therefore, they should be excluded from the non-VTEC group.
In this case, the frequency of the R3 core type in non-VTEC
bovine isolates would be reduced to 5 of 17 (29.4%) and the R1
core type would be more prevalent (10 of 17; 58.8%). Hence,
the predominance of the R1 core type appears to be restored
in VT-negative bovine E. coli.
DISCUSSION
There has been a long-standing interest in immune re-
sponses against LPS from the perspective of immunotherapeu-
tic approaches to neutralizing endotoxin activity and vaccine
development. Clearly, a detailed understanding of the preva-
lence of core OS types is a prerequisite for such approaches,
and this has driven previous studies. Core OS distributions in
commensal E. coli (fecal) isolates and in isolates from septice-
mia and UTIs have been assessed (2, 10). Although the R1
core OS type predominated in these analyses (Table 3), it was
TABLE 2. Core OS types in VTEC and non-VTEC isolates
Group Serotype
No. of isolates tested with core type:
R1 R2 R3 R4 K-12 Total no.
VTEC associated with human disease
(human and animal isolates)
O26:H11 5 5
O55:H7 1 1
O91:H21 4 4
O103:H2 4 4
O111:HϪ
12 12
O111:H8 3 3
O113:H4 1 1
O113:H21 3 3
O145:HϪ
3 1 4
O145:H8 1 1
O157:H7 14 14
O157:HϪ
4 4
Total (%) 7 (12.5) 0 (0) 48 (85.7) 0 (0) 1 (1.8) 56 (100)
VTEC not associated with human disease
(animal isolates)
O6:H34 1 1
O40:H8 1 1
O49:HϪ
1 1
O74:H52 1 1
O82:H8 1 1
O85:HϪ
1 1
O112:H2 1 1
O171:H2 1 1
O172:HϪ
1 1
Total (%) 1 (11.1) 0 (0) 6 (66.7) 1 (11.1) 1 (11.1) 9 (100)
All VTEC Total (%) 8 (12.3) 0 (0) 54 (83.1) 1 (1.5) 2 (3.1) 65 (100)
Non-VTEC of VTEC serogroups isolated from
animals and meats
O2:H5 1 1
O2:H10 1 1
O6:H4 1 1
O8:H21 1 1
O15:H45 1 1
O64:H7 1 1
O112:H8 1 1
O117:H9 1 1
O156:H25a
1 1
O157:H7a
2 2
O157:H12 1 1
O157:H16 1 1
O157:H19 1 1
O157:H25 1 1
O157:H38 1 1
O157:H45 1 1
O157:HϪ
1 2 3
Total (%) 10 (50.0) 2 (10.0) 8 (40.0) 20 (100.0)
a
Isolates of O156:H25 and O157:H7 were probably VTEC isolates that had lost their toxin genes.
1120 AMOR ET AL. INFECT. IMMUN.

6. not clear that these results were reflective of the broader spe-
cies, and the objective of our study was to address this issue.
Our PCR data indicate the prevalence of the R1 core OS in
natural populations of E. coli and provide a phylogenetic basis
for its distribution in specific groups of clinical isolates.
The number of E. coli isolates for which the core OS types
have been definitively shown by structural determination is
limited (reviewed in reference 18). Therefore the PCR-based
core OS typing system reported here was validated using the
same collection of prototype strains used to establish previous
serological tests (2, 10). With the exception of core OS type
R2, the sequences used for the PCR primers focused on genes
essential for characteristic structures that complete the core
OS and that are essential for addition of O antigen (16). The
majority of the isolates produced an O antigen, providing in-
dependent evidence that the PCR test is based on genes that
are expressed. The PCR-based system gave an unequivocal
result for the core OS types of all tested isolates. In contrast,
studies with core-specific monoclonal antibodies (MAbs) yield-
ed a significant number of isolates for which core OS types
could not be determined. These nontypeable strains are po-
tentially all representatives of core OS type R4 or K-12, as
there were no MAbs that specifically recognized these core OS
types available (10). Furthermore, the precise LPS epitopes
recognized by the MAbs are unknown, so the molecular basis
for their core OS type determination is unclear.
The basis of the core OS specificity for a set of polyclonal
antisera is also unknown although these reagents could identify
representatives of each of the five E. coli core OS types (2).
Using these polyclonal sera, Appelmelk et al. found that some
bacteremic isolates (13 isolates or 9.4% of the tested isolates)
reacted with both R1 and R4 sera, suggesting an R1R4 mixed
core type (2). Several possible explanations for this result were
proposed. These isolates either (i) express both R1 and R4
LPS molecules, (ii) have a single LPS molecule containing both
R1 and R4 epitopes, or (iii) produce a novel core type that is
chemically distinct from both R1 and R4 but that contains
cross-reactive epitopes. These possibilities can be addressed in
the light of more recent data describing the molecular basis for
the various core types. Structural differences in the outer core
OS from the R1 and R4 core OSs reside in unique ␤-linked
side branches (Fig. 1). These require type-specific glycosyl-
transferases WaaV (R1) and WaaX (R4) (15). However, an
R1R4 mixed core type could not result simply from coexpres-
sion of the waaX and waaV genes because the WaaV enzyme
adds the glycosyl residue that defines the linkage site for O-PS
in the R1 core OS. It is assumed by analogy that the corre-
sponding ␤-linked (Gal) residue in the R4 core OS added by
WaaX also forms its O-PS ligation site, although this has not
been confirmed by experimentation. As the ligation sites differ,
an R1R4 mixed core type would require coexpression of the
R1- and R4-specific ligase gene (waaL) products, as well as
both waaV and waaX. In the PCR-based analysis presented
here, a prototype R1R4 isolate (strain 1502) was found to have
the waa locus of the R1 core OS type and the waa genes
essential for formation of the R4 core OS type were not de-
tected. The reaction of strain 1502 (and others) with both R1
and R4 antisera could reflect a cross-reactive epitope in the
inner core region of the LPS. Inner-core modifications are
often nonstoichiometric, and some vary from isolate to isolate
(18).
Despite the overall similarity in the prevalences of core OS
types in the ECOR collection and previously studied patho-
genic isolates (2, 10) (Table 3), several reasons make it difficult
to directly compare the numerical values. For example, the
Applemelk et al. study (2) likely underreports R1 due to the
R1R4 mixed core type (see above). In the Gibb et al. study
(10), no core determination could be made for 14% of the
isolates due to the lack of MAbs for these core OS types, as
indicated above.
E. coli is considered to be a highly clonal species (50). How-
ever, the extent of genetic variation within any group of E. coli
isolates depends on their sources. For example, whereas the
commensal microflora is multiclonal (49), specific clones (or
groups of clones) are reflected in isolates from intestinal
infections such as those with EHEC (26, 51) and entero-
pathogenic E. coli (EPEC) (32), as well as in isolates from
extraintestinal infections such as septicemia (27, 43). This is
presumably due the requirements for specific sets of virulence
determinants. In studies of enteroaggregative E. coli isolates
(7), chromosomal markers and some plasmid-encoded genes
were found to have a heterogeneous clonal distribution. How-
ever, all isolates shared a horizontally disseminated member of
a conserved family of virulence plasmids that may confer the
characteristic aggregative adherence phenotype. In a recent
analysis, UTI EPEC, EHEC, enteroinvasive E. coli, and ente-
rotoxigenic E. coli isolates were examined by MLEE and their
phylogeny was compared to the phylogeny of the ECOR col-
TABLE 3. Comparison of results from core OS typing studies
Collection Reference
No. (%) of isolates with core type:
Total no.
R1 R2 R3 R4 K-12
ECOR, all isolates This study 50 (69.4) 8 (11.1) 8 (11.1) 2 (2.8) 4 (5.6) 72
ECOR group A This study 11 (44) 7 (28) 2 (8) 1 (4) 4 (16) 25
ECOR group B1 This study 11 (68.8) 5 (31.2) 16
ECOR group B2 This study 15 (100) 15
ECOR group D This study 12 (100) 12
ECOR minor group (group E) This study 1 (25) 1 (25) 1 (25) 1 (25) 4
VTEC This study 8 (12.3) 54 (83.1) 1 (1.5) 2 (3.1) 65
VTEC 6 28 (100) 28
Non-VTEC commensals from
cattle and meats
This studya
10 (50.0) 2 (10.0) 8 (40.0) 20
This study, adjustedb
10 (58.8) 2 (11.8) 5 (29.4) 17
Human fecal isolates 10 11 (52.4) 4 (19) 2 (9.5) 21
Bacteremic isolates 1 94 (68) 9 (6.5) 12 (8.7) 7 (5.1) 3 (2.2) 138
Septicemic isolates 10 48 (60.8) 6 (7.6) 12 (15.2) 79
UTI isolates 10 64 (80) 4 (5) 4 (5) 80
Gibb et al. study, total 10 123 (68.3) 14 (7.8) 18 (10) 180
a
Includes three isolates that are probably VTEC isolates that have lost the VT genes.
b
Excludes three isolates that probably have lost their VT genes.
VOL. 68, 2000 LPS CORE OLIGOSACCHARIDE TYPES IN E. COLI 1121

7. lection (36). Clusters containing one or more of the pathogenic
derivatives were distributed among the four major established
phylogenetic groups in the ECOR collection.
Genome sizes in E. coli range from 4.6 to 5.5 Mb (3, 4).
E. coli isolates showing the largest genomes are found in phy-
logenetic groups B2 and D, while those from isolates in group
A (including E. coli K-12; 4.639 Mb) are relatively smaller (3,
4). Specific virulence genes are known to be associated with
extraintestinal infections, and DNA insertions carrying viru-
lence genes are distributed throughout the larger genomes of
isolates from sepsis and UTI (39). In surveys of the distribution
of known virulence genes and loci from extraintestinal patho-
gens, including the kps (group 2 capsule synthesis), pap (P-
pilus biogenesis), sfa (S-pilus biogenesis), and hly (␣-hemolysin
formation) loci, the highest concentration of these virulence
determinants occurred in group B2 (5, 34). Most group B2
isolates in the ECOR collection are primarily from humans
and other primates (42), and, as might be expected, group B2
isolates were found to be the most virulent in a mouse lethality
model (34). Smaller numbers of virulent isolates are found in
groups A, B1, and D, where distribution of the examined
virulence markers is limited. Commensals were mainly found
in groups A and B1. The broad distribution of the R1 core type
in the ECOR collection and its particular prevalence in phy-
logenetic groups B2 and D therefore provide an explanation
for its high incidence in bacteremic and UTI isolates (Table 3).
Small numbers of septicemic and UTI isolates of E. coli were
found by serological studies to contain the K-12 and R4 core
OS types (2, 10), and these isolates are likely to be related to
isolates in either group A or the minor group. Within the
ECOR collection are several isolates originally isolated from
UTI patients (ECOR11, -14, -40, -50, -56, -60, -62, and -64
[36]). Six of these isolates are members of phylogenetic groups
B2 and D and are now known to contain the R1 core OS type.
The remaining two isolates, ECOR11 (core type R2) and
ECOR14 (K-12), belong to group A. Herzer et al. found seven
isolates from UTIs or septicemia that were related to ECOR
isolates in groups B1 and D (17). The R1 type would be
expected to predominate among these isolates.
It remains to be established whether the structural organi-
zation of LPS containing the R1 core type confers some selec-
tive advantage, either in the virulence of extraintestinal patho-
genic E. coli or in facilitating the acquisition of virulence genes
by such isolates through horizontal gene transfer. The attach-
ment site for O-PS on the ␤-linked Glc side branch on GlcII
gives a structural arrangement in the R1 core OS (Fig. 1)
rather different from that in the R2 core OS and the classical
example of the S. enterica serovar Typhimurium core OS (16).
While this paper was in the final stages of preparation for
submission, another group reported a correlation between the
presence of the R3 core type and VT production in isolates of
E. coli representing serotypes O157, O111, O86, and O26,
based on reactivity with an R3 MAb (6). Our results with
VTEC isolates both confirm and extend their observations.
The finding of a single core OS type (R3) in VTEC isolates of
serogroups O157 and O55 and in “traditional” EPEC sero-
groups such as O111 is explained by the phylogenetic relation-
ships among these isolates. EHEC (36, 51) and EPEC (32, 36)
isolates reflect relatively homogeneous groups of organisms.
They are only distantly related to extraintestinal pathogenic E.
coli isolates. The occurrence of a single core OS type (R3)
among VTEC O157:H7 and O55:H7 isolates is consistent with
the observation that they form a closely related and recently
emergent clone and with the proposal that O157:H7 arose
from an O55:H7 progenitor (53). In one MLEE study, O157:
H7 isolates were found to cluster with ECOR37 and ECOR42
(36). ECOR37 has an R3 core OS (Fig. 3). On reexamination
of ECOR37 isolate, we found it was a representative of sero-
group O55:H7 but was VT negative (Ziebell et al., unpublished
data). The ECOR42 strain was serotyped as O87:H26.
VTEC O157:H7 isolates are only distantly related to other
VT-positive serogroups (51), but we found that the R3 core
type was distributed in VT-positive isolates representing a va-
riety of different serogroups (Table 2). Currie and Poxton (6)
speculated that the correlation between the R3 core OS and
VTEC isolates might reflect a role for the R3 core as a recep-
tor for lysogenic phages carrying the VT genes. However, the
R3 core OS alone is unlikely to form the VT phage receptor
since E. coli C600 (a K-12 strain) has been used as a recipient
for such phages (29, 44, 46, 48). Also, receptor data for two
Shiga toxin 2 (VT) phages clearly implicate outer membrane
proteins FadL and LamB as phage receptors (48). It has been
reported that isolates with R-LPS are easier to lysogenize with
VT phages (44), and it is certainly possible that lysogenization
is eased by some characteristic of S-LPS-containing R3-type
cores (e.g., reduced O-antigen capping), as has been suggest-
ed previously (6). In a broader analysis of VTEC isolates, we
detected the R1 core in isolates of O113:H21 (three isolates),
O145:H8 (one isolate), O145:HϪ
(three isolates), and O6:H34
(one isolate); the R4 core type in an O112:H2 isolate; and the
K-12 core in single isolates of O85:HϪ
and O145:HϪ
(Table 2).
It is conceivable that processes other than lysogenization me-
diate the spread of VT genes to the isolates with other core
OSs. Indeed, conjugation is reported to be an alternative
method for transfer of VT genes (44).
In contrast to the high frequency of the R3 core type in
VTEC isolates, the R1 core type predominated in the 20 VT-
negative isolates included in the study. The overall represen-
tation of R1 in VT-negative isolates was lower than that seen
among the septicemic and UTI isolates and more in line with
values determined for multiclonal human commensals (10)
and for phylogenetic group A (Table 3). Core-type analysis
also revealed diversity within the O157 serogroup, with R1, R2,
and R3 core OSs represented in VT-negative isolates belong-
ing to serotype E. coli O157:HϪ
and in O157 isolates with
flagellar antigens other than H7. Testing for EHEC virulence
factors suggested that the two VT-negative O157:H7 isolates
were VTEC isolates that had lost their toxin genes (21). Their
R3 core OS type is therefore understandable. Overall, our
findings for the O157 serogroup correlate well with results of
MLEE studies (53), which indicate that members of serogroup
O157 are genetically diverse with no strong linkage between
O157:H7 and other members of the O157 serogroup.
Data from this and other studies indicate that there is no
formal link between core OS type and O serotypes. It has been
established that the O serotype does not provide a reliable
assessment of clonal structure in most clinical isolates due to
horizontal transfer and genetic recombination (42). As a result,
isolates from a given serotype can be distributed in distinct and
sometimes distantly related clones. The LPS core OS is a much
more conserved structure, and, based on the results for groups
B1, B2, and D and for the most common EHEC serogroups, it
appears to be a more stable genetic character.
ACKNOWLEDGMENTS
This work was supported by a funding from the Canadian Bacterial
Diseases Network (NCE program) awarded to C.W. and by Health
Canada. E.F. was supported by a Natural Sciences and Engineering
Research Council postgraduate scholarship, and D.E.H. was the re-
cipient of a postdoctoral fellowship from the Medical Research Coun-
cil.
We thank B. Allen, B. J. Appelmelk, H. Brade, H. Ochman, and F.
1122 AMOR ET AL. INFECT. IMMUN.

8. Scheutz for generously supplying bacterial isolates and Irene Yong for
assistance in serotyping.
REFERENCES
1. Aleksic, S. 1995. WHO report on Shiga-like toxin producing Escherichia coli
(SLTEC), with emphasis on zoonotic aspects. World Health Organization,
Geneva, Switzerland.
2. Appelmelk, B. J., Y.-Q. An, T. A. M. Hekker, L. G. Thijs, D. M. MacLaren,
and J. deGraaf. 1994. Frequencies of lipopolysaccharide core types in Esch-
erichia coli strains from bacteraemic patients. Microbiology 140:1119–1124.
3. Bergthorsson, U., and H. Ochman. 1998. Distribution of chromosome length
variation in natural isolates of Escherichia coli. Mol. Biol. Evol. 15:6–16.
4. Bergthorsson, U., and H. Ochman. 1995. Heterogeneity of genome sizes
among natural isolates of Escherichia coli. J. Bacteriol. 177:5784–5789.
5. Boyd, E. F., and D. L. Hartl. 1998. Chromosomal regions specific to patho-
genic isolates of Escherichia coli have a phylogenetically clustered distribu-
tion. J. Bacteriol. 180:1159–1165.
6. Currie, C. G., and I. R. Poxton. 1999. The lipopolysaccharide core type of
Escherichia coli O157:H7 and other non-O157 verotoxin-producing E. coli.
FEMS Immunol. Med. Microbiol. 24:57–62.
7. Czeczulin, J. R., T. S. Whittam, I. R. Henderson, F. Navarro-Garcia, and
J. P. Nataro. 1999. Phylogenetic analysis of enteroaggregative and diffusely
adherent Escherichia coli. Infect. Immun. 67:2692–2699.
8. Ewing, W. H. 1996. Edwards and Ewing’s identification of Enterobacteri-
aceae, 4th ed. Elsevier Science Publishing, Inc., New York, N.Y.
9. Gamian, A., and E. Romanowska. 1982. The core structure of Shigella sonnei
lipopolysaccharide and the linkage between O-specific polysaccharide and
the core region. Eur. J. Biochem. 129:105–109.
10. Gibb, A. R., G. R. Barclay, I. R. Poxton, and F. di Padova. 1992. Frequencies
of lipopolysaccharide core types among clinical isolates of Escherichia coli
defined with monoclonal antibodies. J. Infect. Dis. 166:1051–1057.
11. Gyles, C., R. Johnson, A. Gao, K. Ziebell, D. Pierard, S. Aleksic, and P.
Boerlin. 1998. Association of enterohemorrhagic Escherichia coli hemolysin
with serotypes of Shiga-like toxin-producing Escherichia coli of human and
bovine origins. Appl. Environ. Microbiol. 64:4134–4141.
12. Haishima, Y., O. Holst, and H. Brade. 1992. Structural investigation of the
lipopolysaccharide of Escherichia coli rough mutant F653 representing the
R3 core type. Eur. J. Biochem. 203:127–134.
13. Hammerling, G., O. Luderitz, O. Westphal, and P. H. Makela. 1971. Struc-
tural investigations on the core polysaccharide of Escherichia coli O100. Eur.
J. Biochem. 22:331–344.
14. Heinrichs, D. E., M. A. Monteiro, M. B. Perry, and C. Whitfield. 1998. The
assembly system for the lipopolysaccharide R2 core-type of Escherichia coli
is a hybrid of those found in Escherichia coli K-12 and Salmonella enterica.
Structure and function of the R2 WaaK and WaaL homologs. J. Biol. Chem.
273:8849–8859.
15. Heinrichs, D. E., J. A. Yethon, P. A. Amor, and C. Whitfield. 1998. The
assembly system for the outer core portion of R1 and R4-type lipopolysac-
charides of Escherichia coli. The R1 core-specific ␤-glucosyltransferase pro-
vides a novel attachment site for O polysaccharides. J. Biol. Chem. 273:
29497–29505.
16. Heinrichs, D. E., J. A. Yethon, and C. Whitfield. 1998. Molecular basis for
structural diversity in the core regions of the lipopolysaccharides of Esche-
richia coli and Salmonella enterica. Mol. Microbiol. 30:221–232.
17. Herzer, P. J., S. Inouye, M. Inouye, and T. S. Whittam. 1990. Phylogenetic
distribution of branched RNA-linked multicopy single-stranded DNA
among natural isolates of Escherichia coli. J. Bacteriol. 172:6175–6181.
18. Holst, O. 1999. Chemical structure of the core region of lipopolysaccharides,
p. 305–330. In H. Brade, S. M. Opal, S. N. Vogel, and D. C. Morrison (ed.),
Endotoxin in health and disease. Marcel Dekker Inc., New York, N.Y.
19. Hull, S. 1997. Escherichia coli lipopolysaccharide in pathogenesis and viru-
lence, p. 145–167. In M. Sussman (ed.), Escherichia coli: mechanisms of
virulence. Cambridge University Press, Cambridge, United Kingdom.
20. Johnson, R. P., R. C. Clarke, J. B. Wilson, S. C. Read, K. Rahn, S. A.
Renwick, K. A. Sandhu, D. Alves, M. A. Karmali, H. Lior, S. A. McEwen, J.
Spika, and C. L. Gyles. 1996. Growing concerns and recent outbreaks in-
volving non-O157 serotypes of verotoxigenic Escherichia coli. J. Food Pro-
tect. 59:1112–1122.
21. Karch, H., T. Meyer, H. Russmann, and J. Heesemann. 1992. Frequent loss
of Shiga-like toxin genes in clinical isolates of Escherichia coli upon subcul-
tivation. Infect. Immun. 60:3464–3467.
22. Katzenellenbogen, E., and E. Romanowska. 1980. Structural studies on Shi-
gella flexneri serotype 6 core region. Eur. J. Biochem. 113:205–211.
23. Levine, M. M. 1987. Escherichia coli that cause diarrhea: enterotoxigenic,
enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent.
J. Infect. Dis. 155:377–389.
24. Liu, D., and P. R. Reeves. 1994. Escherichia coli K12 regains its O antigen.
Microbiology 140:49–57.
25. Lugowski, C., M. Kulakowska, and E. Romanowska. 1986. Characterization
and diagnostic application of a lipopolysaccharide core oligosaccharide-pro-
tein conjugate. J. Immunol. Methods 95:187–194.
26. Mariani-Kurkdjian, P., E. Denamur, A. Milon, B. Picard, H. Cave, N. Lam-
bert-Zechovsky, C. Loirat, P. Goullet, P. J. Sansonetti, and J. Elion. 1993.
Identification of a clone of Escherichia coli O103:H2 as a potential agent of
hemolytic-uremic syndrome in France. J. Clin. Microbiol. 31:296–301.
27. Maslow, J. N., T. S. Whittam, C. F. Gilks, R. A. Wilson, M. E. Mulligan, K. S.
Adams, and R. D. Arbeit. 1995. Clonal relationships among bloodstream
isolates of Escherichia coli. Infect. Immun. 63:2409–2417.
28. Mu¨ller-Loennies, S., O. Holst, and H. Brade. 1994. Chemical structure of the
core region of Escherichia coli J-5 lipopolysaccharide. Eur. J. Biochem. 224:
751–760.
29. O’Brien, A. D., J. W. Newland, S. F. Miller, R. K. Holmes, H. W. Smith, and
S. B. Formal. 1984. Shiga-like toxin-converting phages from Escherichia coli
strains that cause hemorrhagic colitis or infantile diarrhea. Science 226:694–
696.
30. Ochman, H., and R. K. Selander. 1984. Standard reference strains of Esch-
erichia coli from natural populations. J. Bacteriol. 157:690–693.
31. Olsthoorn, M. M., B. O. Petersen, S. Schlecht, J. Haverkamp, K. Bock, J. E.
Thomas-Oates, and O. Holst. 1998. Identification of a novel core type in
Salmonella lipopolysaccharide. Complete structural analysis of the core re-
gion of the lipopolysaccharide from Salmonella enterica sv. Arizonae O62.
J. Biol. Chem. 273:3817–3829.
32. Ørskov, F., T. S. Whittam, A. Cravioto, and I. Ørskov. 1990. Clonal rela-
tionships among classic enteropathogenic Escherichia coli (EPEC) belong to
different O groups. J. Infect. Dis. 162:76–81.
33. Paton, A. W., and J. C. Paton. 1998. Detection and characterization of Shiga
toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA,
enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 36:
598–602.
34. Picard, B., J. S. Garcia, S. Gouriou, P. Duriez, N. Brahimi, E. Bingen, J.
Elion, and E. Denamur. 1999. The link between phylogeny and virulence in
Escherichia coli extraintestinal infection. Infect. Immun. 67:546–553.
35. Pierard, D., D. Stevens, L. Moriau, H. Lior, and S. Lauwers. 1997. Isolation
and virulence factors of verocytotoxin-producing Escherichia coli in human
stool samples. Clin. Microb. Infect. 3:531–540.
36. Pupo, G. M., D. K. Karaolis, R. Lan, and P. R. Reeves. 1997. Evolutionary
relationships among pathogenic and nonpathogenic Escherichia coli strains
inferred from multilocus enzyme electrophoresis and mdh sequence studies.
Infect. Immun. 65:2685–2692.
37. Raetz, C. R. H. 1996. Bacterial lipopolysaccharides: a remarkable family of
bioactive macroamphiphiles, p. 1035–1063. In F. C. Niedhardt, R. Curtiss III,
J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M.
Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Sal-
monella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Wash-
ington, D.C.
38. Read, S. C., R. C. Clarke, A. Martin, S. A. De Grandis, J. Hii, S. A. McEwen,
and C. L. Gyles. 1992. Polymerase chain reaction for detection of verocyto-
toxigenic Escherichia coli isolated from animal and food sources. Mol. Cell.
Probes 6:153–161.
39. Rode, C. K., L. J. Melkerson-Watson, A. T. Johnson, and C. A. Bloch. 1999.
Type-specific contributions to chromosome size differences in Escherichia
coli. Infect. Immun. 67:230–236.
40. Schmidt, G., B. Jann, and K. Jann. 1974. Genetic and immunochemical
studies on Escherichia coli O14:K7:HϪ
. Eur. J. Biochem. 42:303–309.
41. Schmidt, G., B. Jann, and K. Jann. 1969. Immunochemistry of R lipopoly-
saccharides of Escherichia coli. Different core regions in the lipopolysaccha-
rides of O group 8. Eur. J. Biochem. 10:501–510.
42. Selander, R. K., D. A. Caugant, and T. S. Whittam. 1987. Genetic structure
and variation in natural populations of Escherichia coli, p. 1625–1648. In
F. C. Niedhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter,
and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium:
cellular and molecular biology. American Society for Microbiology, Wash-
ington, D.C.
43. Selander, R. K., T. K. Korhonen, V. Vaisanen-Rhen, P. H. Williams, P. E.
Pattison, and D. A. Caugant. 1986. Genetic relationships and clonal struc-
ture of strains of Escherichia coli causing neonatal septicemia and meningitis.
Infect. Immun. 52:213–222.
44. Smith, H. W., P. Green, and Z. Parsell. 1983. Vero cell toxins in Escherichia
coli and related bacteria: transfer by phage and conjugation and toxic action
in laboratory animals, chickens and pigs. J. Gen. Microbiol. 129:3121–3137.
45. Stevenson, G., B. Neal, D. Liu, M. Hobbs, N. H. Packer, M. Batley, J. W.
Redmond, L. Lindquist, and P. R. Reeves. 1994. Structure of the O antigen
of Escherichia coli K-12 and the sequence of its rfb cluster. J. Bacteriol.
176:4144–4156.
46. Strockbine, N. A., L. R. Marques, J. W. Newland, H. W. Smith, R. K. Holmes,
and A. D. O’Brien. 1986. Two toxin-converting phages from Escherichia coli
O157:H7 strain 933 encode antigenically distinct toxins with similar biologic
activities. Infect. Immun. 53:135–140.
47. Tsang, R. S., K. H. Chan, P. Y. Chau, K. C. Wan, M. H. Ng, and S. Schlecht.
1987. A murine monoclonal antibody specific for the outer core oligosac-
charide of Salmonella lipopolysaccharide. Infect. Immun. 55:211–216.
48. Watarai, M., T. Sato, M. Kobayashi, T. Shimizu, S. Yamasaki, T. Tobe, C.
Sasakawa, and Y. Takeda. 1998. Identification and characterization of a
VOL. 68, 2000 LPS CORE OLIGOSACCHARIDE TYPES IN E. COLI 1123

9. newly isolated Shiga toxin 2-converting phage from Shiga toxin-producing
Escherichia coli. Infect. Immun. 66:4100–4107.
49. Whittam, T. S. 1989. Clonal dynamics of Escherichia coli in its natural
habitat. Antonie Leeuwenhoek. 55:23–32.
50. Whittam, T. S. 1996. Genetic variation and evolutionary processes in natural
populations of Escherichia coli, p. 2708–2720. In F. C. Niedhardt, R. Curtiss
III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff,
M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and
Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
51. Whittam, T. S., I. K. Wachsmuth, and R. A. Wilson. 1988. Genetic evidence
of clonal descent of Escherichia coli O157:H7 associated with hemorrhagic
colitis and hemolytic uremic syndrome. J. Infect. Dis. 157:1124–1133.
52. Whittam, T. S., and R. A. Wilson. 1988. Genetic relationships among patho-
genic Escherichia coli of serogroup O157. Infect. Immun. 56:2467–2473.
53. Whittam, T. S., M. L. Wolfe, I. K. Wachsmuth, F. Ørskov, I. Ørskov, and
R. A. Wilson. 1993. Clonal relationships among Escherichia coli strains that
cause hemorrhagic colitis and infantile diarrhea. Infect. Immun. 61:1619–
1629.
Editor: R. N. Moore
1124 AMOR ET AL. INFECT. IMMUN.