Bioengineering fluorescent tags from phytochromes found in Thermosynechococcus elongatus<br />Mills CBST Research Project ...
Mills College Center for Biophotonics, Science and Technology (CBST)<br />Bioengineer a fluorescent tag<br />Easy-to-detec...
Bioengineering A Fluorescent Tag<br />“DNA for fluorescent tag” can be bioengineered.<br /> In our work, we have engineere...
Introduce the Bioengineered Fluorescent Tagged protein into a living cell<br />Transfection<br />Plasmid with new DNA & ta...
Transfected Eukaryotic Cell Containing Bioengineered Plasmid with Fluorescent tag<br />Modified from: http://www.biology.d...
Our Research Goal<br />Bioengineer a small, red fluorescent tag from a cyanobacteriochrome found in Thermosynechococcus el...
Our Research Goal<br />Bioengineer a new red fluorescent tag<br />Red illumination of the <br />cytoskeleton<br />Images m...
Why make a red fluorescent tag?<br />
Introducing a New Fluorescent Tag<br />Market Fluorescent Tag:<br /><ul><li>Proteins from jellyfish
Limited Imaging
Subject to Photobleaching
Longer Amino Acid Sequence
Produce Reactive Oxygen molecule</li></li></ul><li>Introducing a New Fluorescent Tag<br />Market Fluorescent Tag:<br /><ul...
Limited Imaging
Subject to Photobleaching
Longer Amino Acid Sequence
Produce Reactive Oxygen Molecule</li></ul>Our New Fluorescent Tag<br /><ul><li>Proteins from cyanobacteria
Brighter red, better imaging
Not subject to photobleaching
Shorter amino acid sequence</li></li></ul><li>New fluorescent tag from T. elongatus<br /><ul><li>Thermophiliccyanobacteria...
Cyanobacteriochromes
Homologous genes to classical plant phytochromes
Photoreverse
Absorb light energy  Active or Non-active state
Phytochromes: Red  Far-red
Cyanobacteriochromes: BlueGreen
Mutated GAF: red fluorescent  </li></li></ul><li>Genes from cyanobacteriochromes  T. elongatus<br />
GAF Domain Phylogenetic Tree<br />
Schematic model of the GAF domain and its associated chromophore<br />Chromophore in the GAF binding pocket of protein<br />
Procedure<br />PCR <br />      genomic DNA<br />Restriction enzyme and Ligation<br />Site-Directed Mutagenesis<br />Protei...
PCR genomic DNA: <br />Genomic DNA from T. elongatusand primers are used in PCR to capture GAF domain only, with the appro...
Restriction Enzyme and Ligation<br />After we obtain the GAF domain with recognition sites at each end from PCR,  it is di...
Rolling Circle Site-Directed Mutagenesis: <br />Mutating Cysteine Aspartate<br />Absorb light in the red region<br />Prev...
Mutation of Cysteine (C) in the GAF domain of 569T<br />TGTGAT <br />GGGTTGGCCACAAGCTCGAGATCAGGTAATTGATTGAGCAGGCAGCC<br /...
Site-Directed Mutagenesis: Example<br />Absorbing in the red region makes the protein look blue!<br />Protein Peak <br />6...
Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html<br />Transformation of E. coli with pBAD + 569TM...
E.Coli with pPL plasmid<br />pPL plasmid<br />Contains genetic information to make PCB<br />Hemoxygenase (Ho1)<br />Reduct...
Plasmids used to express the cyanobacteriochrome 569TM<br />pBAD plasmid + 569TM insert<br />pPL plasmid <br />Produce:   ...
Protein Expression<br />Grow E. coli with pPL + pBAD plasmid in batches in culture medium<br />Add IPTG<br />Add L-arabino...
Protein Expression<br />Centrifugation results E. coli cells are colored<br />
Protein Purification<br />Mechanical Cell Lysis<br />Extract crude protein from cells<br />Centrifuge to separate soluble ...
Upcoming SlideShare
Loading in …5
×

Congreso de Biotecnología Arequipa Perú June 2011

990 views

Published on

  • Be the first to comment

  • Be the first to like this

Congreso de Biotecnología Arequipa Perú June 2011

  1. 1. Bioengineering fluorescent tags from phytochromes found in Thermosynechococcus elongatus<br />Mills CBST Research Project 2011<br />Presented by Rosa Meza-Acevedo, Alexandria Magallan <br />Tianling Ou, <br />with support from Susan C. Spiller, PI <br />
  2. 2. Mills College Center for Biophotonics, Science and Technology (CBST)<br />Bioengineer a fluorescent tag<br />Easy-to-detect protein marker<br />Respond to different wavelengths of light<br />Reporter of protein expression <br />Photographs made at CBST – UC Davis<br />
  3. 3. Bioengineering A Fluorescent Tag<br />“DNA for fluorescent tag” can be bioengineered.<br /> In our work, we have engineered a nucleic acid sequence that will be translated into the fluorescent protein that we want.<br />Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html<br />
  4. 4. Introduce the Bioengineered Fluorescent Tagged protein into a living cell<br />Transfection<br />Plasmid with new DNA & tag<br />Nucleus<br />Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html<br />
  5. 5. Transfected Eukaryotic Cell Containing Bioengineered Plasmid with Fluorescent tag<br />Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html<br />
  6. 6. Our Research Goal<br />Bioengineer a small, red fluorescent tag from a cyanobacteriochrome found in Thermosynechococcus elongatus<br />Develop this tag to be useful in cellular imaging techniques in vitro and eventually in vivo<br />
  7. 7. Our Research Goal<br />Bioengineer a new red fluorescent tag<br />Red illumination of the <br />cytoskeleton<br />Images modified from: cbst.ucdavis.edu<br />
  8. 8. Why make a red fluorescent tag?<br />
  9. 9. Introducing a New Fluorescent Tag<br />Market Fluorescent Tag:<br /><ul><li>Proteins from jellyfish
  10. 10. Limited Imaging
  11. 11. Subject to Photobleaching
  12. 12. Longer Amino Acid Sequence
  13. 13. Produce Reactive Oxygen molecule</li></li></ul><li>Introducing a New Fluorescent Tag<br />Market Fluorescent Tag:<br /><ul><li>Proteins from jellyfish
  14. 14. Limited Imaging
  15. 15. Subject to Photobleaching
  16. 16. Longer Amino Acid Sequence
  17. 17. Produce Reactive Oxygen Molecule</li></ul>Our New Fluorescent Tag<br /><ul><li>Proteins from cyanobacteria
  18. 18. Brighter red, better imaging
  19. 19. Not subject to photobleaching
  20. 20. Shorter amino acid sequence</li></li></ul><li>New fluorescent tag from T. elongatus<br /><ul><li>Thermophiliccyanobacteriaisolated from hot springs in BeppuJapan
  21. 21. Cyanobacteriochromes
  22. 22. Homologous genes to classical plant phytochromes
  23. 23. Photoreverse
  24. 24. Absorb light energy  Active or Non-active state
  25. 25. Phytochromes: Red  Far-red
  26. 26. Cyanobacteriochromes: BlueGreen
  27. 27. Mutated GAF: red fluorescent </li></li></ul><li>Genes from cyanobacteriochromes T. elongatus<br />
  28. 28. GAF Domain Phylogenetic Tree<br />
  29. 29. Schematic model of the GAF domain and its associated chromophore<br />Chromophore in the GAF binding pocket of protein<br />
  30. 30. Procedure<br />PCR <br /> genomic DNA<br />Restriction enzyme and Ligation<br />Site-Directed Mutagenesis<br />Protein Purification<br />Transformation<br />Protein Expression<br /> Visualization!<br />SDS-PAGE gel and Transblot<br />Transfection<br />
  31. 31. PCR genomic DNA: <br />Genomic DNA from T. elongatusand primers are used in PCR to capture GAF domain only, with the appropriate restriction enzyme recognition sequences at each end.<br /> -- Genomic DNA gift from Dr. Ikeuchi, University of Tokyo, and Dr. J. Clark Lagarias, University of California, Davis<br />
  32. 32. Restriction Enzyme and Ligation<br />After we obtain the GAF domain with recognition sites at each end from PCR, it is digested with the restriction enzymes, and then ligated by annealing to the sticky ends of the pBAD plasmid, which has been prepared by digesting with the same enzyme. <br />pBAD + inserted GAF domain (569)<br />
  33. 33. Rolling Circle Site-Directed Mutagenesis: <br />Mutating Cysteine Aspartate<br />Absorb light in the red region<br />Prevent photoreversibility<br />Fluorescence <br />Mutated plasmid<br />
  34. 34. Mutation of Cysteine (C) in the GAF domain of 569T<br />TGTGAT <br />GGGTTGGCCACAAGCTCGAGATCAGGTAATTGATTGAGCAGGCAGCC<br />AAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTG<br />CGCGATCGCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGA<br />ACTATTGGCCTGCGATCGTGTCATTGTCTATGCCTTTGATGACAACTAT<br />GTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAAGGATCCCTGTTTCC<br />GCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAGCCACG<br />ACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTC<br />CGGCCCCTCAAGGTTCGGGCAAATCTTGTCGTGCCGATGGTGATCGA<br />CGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGTGAACCACG<br />CCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCA<br />CCGGCAGCCTTGTCCTGGAGCGTCTCCATTTCCTTGAGCAGCCCGGG<br />
  35. 35. Site-Directed Mutagenesis: Example<br />Absorbing in the red region makes the protein look blue!<br />Protein Peak <br />660nm<br />Red Region<br />
  36. 36. Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html<br />Transformation of E. coli with pBAD + 569TM insert <br />
  37. 37. E.Coli with pPL plasmid<br />pPL plasmid<br />Contains genetic information to make PCB<br />Hemoxygenase (Ho1)<br />Reductase (PcyA)<br />
  38. 38. Plasmids used to express the cyanobacteriochrome 569TM<br />pBAD plasmid + 569TM insert<br />pPL plasmid <br />Produce: GAF domain Phycocyanobilin (PCB)<br />
  39. 39. Protein Expression<br />Grow E. coli with pPL + pBAD plasmid in batches in culture medium<br />Add IPTG<br />Add L-arabinose<br />E. Coli <br />
  40. 40. Protein Expression<br />Centrifugation results E. coli cells are colored<br />
  41. 41. Protein Purification<br />Mechanical Cell Lysis<br />Extract crude protein from cells<br />Centrifuge to separate soluble protein from cells<br />Next Step: Chitin binding<br /> www.diversified-equipment.com<br /> Microfluidizer<br />http://www.microfluidicscorp.com/<br />
  42. 42. Protein Purification<br />Column set up<br />
  43. 43. Protein Purification<br />Protein of <br />Interest<br />Chitin<br />Bead<br />Cleave!<br />Chitin<br />Bead<br />Elute<br />Chitin binding column<br />
  44. 44. SDS-PAGE<br />The process of using an electric current to separate bands of proteins.<br />Determine the purity of the isolated protein.<br />Pure protein is indicated by a single band of a particular size<br />The size of the protein can be determined<br />
  45. 45. SDS – sodium dodecyl sulfate<br />Charged groups<br />Anionic detergent<br />Proteins denature<br />Negative charge on proteins<br />Hydrophobic regions<br />http://www.bio.davidson.edu/courses/genomics/method/SDSPAGE/SDSPAGE.html#SDS<br />
  46. 46. PAGE – PolyAcrylamide Gel Electrophoresis<br />Gel restrains large molecules from migrating as fast as smaller molecules<br />Two gel layers<br />12% Resolving – pH 8.8 <br />4% Stacking – pH 6.68<br />
  47. 47. Preparing PolyAcrylimide Gel<br />http://upload.wikimedia.org/wikipedia/commons/7/75/SDS-PAGE_Acrylamide_gel.png- Modified<br />
  48. 48. Running Gel-Electrophoresis<br />Glass gel cassettes<br />Blue = Negative<br />Red = Positive <br />Protein Sample<br />Inner chamber<br />Outer Chamber<br />Electrode assembly<br />Lid<br />Mini Tank<br />Power Source<br />http://upload.wikimedia.org/wikipedia/commons/4/46/SDS-PAGE_Electrophoresis.png - Modified<br />
  49. 49. SDS-PAGE Gel Results<br />Rockwell, Nathan .Biochemistry 2008.<br />
  50. 50. Zinc Acetate Reveals Bilin Binding<br />Rockwell, Nathan .Biochemistry 2008.<br />Comassie stained gel<br />Transblot treated with zinc acetate<br />Rockwell, Nathan .Biochemistry 2008.<br />
  51. 51. Transfection<br />The process of introducing nucleic acids into eukaryotic cells <br />Opening transient pores in the cell membrane to allow the uptake of material <br />There are biochemical methods and physical methods<br />
  52. 52. Physical Method of Transfection: Electroporation<br />Use of high-voltage electric pulse to perturb the cell membrane and form transient pores, introducing DNA<br />Highly efficient for the introduction of foreign genes in tissue culture cells, especially <br /> mammalian cells <br />
  53. 53. Electroporation<br />
  54. 54. Transfection to Jurkat Cells<br />http://www.clontech.com/images/pt/PT3827-5.pdf<br />Plasmid we currently use for transfection<br />Jurkat Cells that are transfected by pDsRed-Monmer-Actin<br />
  55. 55. Visualizing the Transfected Cells<br />Deconvolution fluorescence microscope at CBST<br />
  56. 56. A video from CBST, taken on a deconvolution microscope<br />

×