This honors thesis examines variants in the human PTK7 gene in 192 spina bifida patients and 190 controls. Three novel missense mutations in PTK7 were identified in cases but not controls. Reporter assays showed the mutations had significant effects on JNK activity compared to wild type PTK7, suggesting they may contribute to genetic risk for spina bifida.

1. Variant Analysis of the Human Planar Cell Polarity Regulator Gene
PTK7 in Neural Tube Defects
Christina B. Khoury
May 2014

2. VARIANT ANALYSIS OF HUMAN PLANAR CELL POLARITY
REGULATOR GENE PTK7 IN NEURAL TUBE DEFECTS
An Honors Thesis Submitted to
the Department of Nutritional Sciences
in partial fulfillment of the Departmental Honors Program
UNIVERSITY OF TEXAS AT AUSTIN
by
CHRISTINA B. KHOURY
MAY 2014

3. VARIANT ANALYSIS OF HUMAN PLANAR CELL POLARITY
REGULATOR GENE PTK7 IN NEURAL TUBE DEFECTS
by
CHRISTINA B. KHOURY
Approved for submittal to the Department of Nutritional Sciences
for consideration of granting graduation with honors:
Research Sponsor
Dr. Richard H. Finnell __________________Date __________________
Second Reader
Dr. Yunping Lei _______________________ Date __________________

4. TABLE OF CONTENTS:
Abstract……………………………………………………………………………...Page 1
Introduction…………………………………………………………………...……..Page 2
Materials & Methods……………………………….………………………………..Page 7
Results……………………………………………………………………………...Page 11
Discussion………………………………………………………………………….Page 13
Reference Page……………………………………………………………………..Page 15
Figure 1………………………………………………………………..……...……Page 22
Figure 2………………………..……………………………………………...……Page 23
Table 1…………………………….………………………………………………..Page 24
Table 2…………………………….………………………………………………..Page 25
Appendix 1…………………………….…………………………………………...Page 26
Appendix 2………………………………………………………..………………..Page 27
Appendix 3………………………………………………………………………....Page 29
Biography………………………………………………………………….……….Page 32

5. 1
ABSTRACT
Neural tube defects (NTDs), including spina bifida, anencephaly, and
craniorachischisis, are serious birth defects that affect approximately one in every 1000
live births in the US. In recent studies, mutations in planar cell polarity (PCP) pathway
genes were implicated in the pathogenesis of NTDs in both mice and in human cohorts.
Mouse models indicate that the disruption of the PTK7 gene, a PCP regulator, results in
craniorachischisis, whereas embryos that are double heterozygous for PTK7 and
VANGL2 mutations result in spina bifida. In this study, exons of the human PTK7 gene in
192 spina bifida patients and 190 controls were sequenced from samples obtained from
the California Birth Defects Monitoring Program (CBDMP). Live-born cases with spina
bifida were the only NTDs included in this study. Controls were randomly selected from
a population of live born infants corresponding to the same birth time period and
geographic location as the cases. The DNA used for genotyping was obtained from
newborn screening bloodspots. In spina bifida cases, three novel, rare missense
heterozygous PTK7 mutations (p.Thr186Met, p.Arg630Ser and p.Tyr725Phe) were
identified that were absent in all control samples. AP1 luciferase transcriptional reporter
assays revealed significant differences in stimulatory effects on JNK activity between
these three mutations and the wild type PTK7. This study suggests that missense
mutations in PTK7 may contribute to the genetic risk of spina bifida in this population.
ACKNOWLEDGEMENTS: This work was supported in part by NIH grant HD067244

6. 2
INTRODUCTION
Neural tube defect (NTD) is a term that describes a variety of congenital
malformations of the central nervous system (CNS). Two of the most common NTDs
include spina bifida and anencephaly, and result from the improper closure of the neural
tube in the lower spinal cord and developing brain, respectively. While most US infants
born with spina bifida survive at the cost of severe long-term disabilities, infants born
with anencephaly invariably die shortly after birth [1]. Unlike spina bifida and
anencephaly, craniorachischisis is quite uncommon. This defect is characterized by
congenital fissure of the skull and vertebral column and results from neural tube closure
failure, leading to fetal demise and stillbirth [2].
NTDs affect approximately one in every 1,000 US live births; however,
prevalence varies according to geographical location and ethnicity [3]. For instance, areas
such as Northern China, Turkey, Ireland, and Latin America have been reported to have
higher incidence rates as compared to the declining rates observed in North America,
Europe, Australia, and New Zealand. [4-13] In the United States, Hispanics have a higher
risk of NTD occurrence followed by Non-Hispanic Whites, Native Americans, African-
Americans and Asians [14-18]. These observed differences in NTD prevalence rates were
one of the first suggestions that the disease may be a product of multiple factors [19].
Following those reports, AEDs and Diabetes were identified as risk factors for NTDs
[20,21]. Soon after, maternal folic acid supplementation during the periconceptional
period was shown to significantly decrease the risk of NTDs by about 50-70% [22-25].
Largely based on this finding, the United States mandated the fortification of all grains
and cereals with folic acid so that women in their childbearing years would receive a

7. 3
target of no less than 400ug of folic acid daily [26]. To this point, it was still uncertain
whether these defects were caused by environmental factors alone or if a genetic
component was involved. Eventually, observances of increased recurrence risks in
siblings and concordance of the defect in same-sex twins led to the belief that NTDs have
a multifactorial etiology [27]. It is now understood that genetic predisposition poses a
large risk for the formation of NTDs, however, an environmental stimulus must be
present in order for the defect to be expressed [28-30].
Embryology
The establishment of both primitive cell layers and embryonic polarity sets the
framework for the network of cells that will contribute to the development of the brain
and the spinal cord. Gastrulation is an essential process that plays a role in this initial
establishment of the embryonic body plan [31]. Gastrulation is observed in all vertebrate
embryos and is characterized by the invagination of the developing embryo, which begins
as a single sheet of cells, eventually generating three layers on approximately the 6th day
post-fertilization; the outer layer, middle layer, and inner layer, termed the ectoderm, the
mesoderm, and the endoderm, respectively. Along with the formation of cell layers,
gastrulation also produces the notochord, a distinct cylinder of mesodermal cells
extending along the midline of an embryo [31]. Cranial to the notochord lie the cells of
the neuroectoderm, which eventually contributes to the entire nervous system. The
notochord is responsible for inducing neural differentiation and properly positioning the
developing nervous system. This is accomplished through the transmission of inductive
signals to the ectoderm resulting in the differentiation of the neuroectodermal cells into

8. 4
neural precursor cells [31]. This process, occurring on approximately the 19th day post-
fertilization, is called neurulation and results in the formation of the neural plate [32].
On approximately the 23rd day post-conception, the neural groove or a shallow median
groove of the neural plate of an embryo is formed as a result of the folding neural plate
along its midline [32]. This formation is believed to proceed through the presence of the
mesenchyme in the neural folds [33]. When the neural folds are sufficiently extended,
fusion at the midline occurs in a discontinuous fashion at multiple de novo fusion sites
beginning at the alpha site in between somites two and three and extending in both a
rostral and caudal direction [34]. Next, fusion at the beta site begins and proceeds
unidirectionally in a caudal manner. Convergent extension or the restructuring of the
embryo through narrowing in one axis and elongating in another is the driving force of
neural tube closure and results in a neurospore at both the rostral and caudal end. These
neuropores eventually close at approximately Carnegie stages 11 and 13, respectively
[34]. In secondary neurulation, the ectoderm and several cells from the endoderm form
the medullary cord, which then condenses, separates, and forms cavities, which merge to
form the caudal end of the neural tube [35]. When the embryo becomes a fully functional
organism, the formation of specific organs and structures occurs in a process termed
organogenesis.
Planar Cell Polarity
Most cells and tissues display aspects of polarization. Consider epithelial tissues
and organs; they not only display cell polarity along the apical-basolateral axis, but are
also polarized within the plane of the epithelium [36]. This cellular property is generally

9. 5
referred to as Planar Cell polarity (PCP), and can be described as a geometric property of
cells that allows for cellular behaviors to be oriented and aligned along the plane of a cell
sheet [37]. PCP is generally overseen by a conserved set of proteins encoded by PCP
genes; these proteins work through coordinating developmental signaling cues with
individual cell behaviors [37]. The study of PCP derived from work in arthropods such as
Drosophila; however, many vertebrate tissues and developmental processes have been
identified as sharing these PCP properties [36]. Studies of gastrulation in Xenopus first
suggested that a noncanonical Wnt/PCP system was also present in higher vertebrates
[36]. It was also discovered that the disruption of core PCP genes causes a widened space
between the neural folds and prevents successful convergent extension of the axial
mesoderm and neuroepithelium, thereby compromising proper neural tube closure [38].
Purpose of Study
In recent publications, several PCP genes were found to be associated with human
NTDs. These genes include VANGL1 [39,40], VANGL2 [41,42], PRICKLE1 [43], FZD6
[44], CELSR1 [45,46], and SCRIB [45]. A PCP effector gene FUZ [47] and a PCP
regulator gene DACT1 [48] have also been found to be associated with increased human
NTD risks. Generally PCP genes, including both effector and regulatory genes, play
important roles in convergent extension movements and consequently, neural tube
closure. As such, they represent solid candidate genes of susceptibility to be studied in
human NTD cohorts.
In vertebrate embryos, Protein tyrosine kinase 7 (PTK7) is a regulator of PCP and
is required for a broad range of processes regulated by genes within the PCP signaling

10. 6
pathway [49]. One particular process is convergent extension, which as previously
mentioned describes a morphogenetic pattern of cell movement required for proper
neural tube closure. Failures in convergent extension are indicative of a malfunctioning
PCP signaling pathway [50]. PTK7 is a one-pass transmembrane protein with tyrosine
kinase homology. It has the capability to act as a Wnt co-receptor to activate the PCP
pathway and inhibit canonical Wnt signaling [51]. More recently it has been reported that
convergent extension cell movements in Xenopus, zebrafish, and mice are dependent on
PTK7 [52-54]. The role of PTK7 in PCP and neural tube closure led us to investigate the
human ortholog in the pathogenesis of human NTDs.

11. 7
MATERIALS AND METHODS
Human subjects
Newborn screening blood spots were obtained from the California Birth Defects
Monitoring Program (CBDMP). This program is an ongoing population-based
surveillance system used for collecting information on infants and fetuses with birth
malformations, still births, as well as miscarriages. The CBDMP registry is funded by the
California Birth Defects Monitoring Fund and is dedicated to uncovering opportunities
for the prevention of birth defects. This study included 192 singleton infants with spina
bifida (cases) and 190 non-malformed infants (controls). Cases were randomly selected
from all live born cases and a random sample of non-malformed control infants
ascertained by the CBDMP corresponding to birth years 1994–1998. The case and
control infants were linked to their newborn bloodspot. All samples were obtained with
approval from the State of California Health and Welfare Agency Committee for the
Protection of Human Subjects.
Ethics Statement
The DNA used for genotyping during this study was extracted from anonymous
newborn bloodspots. As previously mentioned, all samples were obtained with the
approval from the State of California Health and Welfare Agency Committee for the
Protection of Human Services. In California, bloodspots are obtained from all newborn
infants for the purpose of genetic testing. Information forms that detail the potential use
of the bloodspots are provided to the parents during collection. Although these
informative forms do not request official consent, they provide parents with instructions

12. 8
on how to request the destruction of their infant’s bloodspots if they choose to do so. If
the parents decide to opt out, requests must be made in writing to the State of California.
Once genetic testing is completed, the State of California preserves the remainder of the
bloodspot samples; these samples are then made available for approved researchers,
leading to ethical considerations. Parents who did not wish for their infant’s bloodspots to
be used anonymously for research are not included in this study.
DNA Resequencing and Genotyping
Genomic DNA was isolated from the study samples using the Puregene DNA
Extraction Kit (Qiagen, Valencia, CA). This genomic DNA was subjected to whole
genome amplification (WGA) using the GenomiPhi Kit (GE Healthcare) in order to yield
larger quantities of DNA for subsequent experiments. The genomic structure of human
PTK7 was determined using the NCBI GenBank (NT_007592.15, NM_002821.3 and
NP_002812.2). Specific primers flanking each of the exonic sequences of the human
PTK7 genes were designed using Primer3 (v. 0.4.0)
(http://gmdd.shgmo.org/primer3/?seqid=47). These primer sequences are available
(appendix 1). The exonic regions of PTK7 were then amplified by polymerase chain
reactions (PCR) using the GenomiPhi WGA product of the human DNA samples as the
substrate (Appendix 2). Following the amplification, the PCR products were purified
using a mixture of Exonuclease I and Shrimp Alkaline Phosphotase (ExoSap), and then
sequenced using the Prism Bigdye Terminator Kit (v3) on an ABI 3730XL DNA
analyzer (Life Technologies, Carlsbad, CA). Samples from infants with spina bifida (192)
were sequenced with either a forward or reverse primer (Appendix 3). Sequencing results

13. 9
were analyzed using the Mutation Surveyor software V4.0.7 (Softgenetics, Stage College,
PA). A second round of PCR and sequencing analysis confirmed the presence of the
detected mutations. For the exons with identified novel mutations, PCR and sequencing
analysis were performed on the control samples (190) to determine whether the mutations
exist in non-malformed infants. Non-synonymous changes that were most likely expected
to have a detrimental effect were further genotyped using the OpenArray Real-Time PCR
System (Life Technologies, Carlsbad, CA) following the manufacturer’s guide.
Bioinformatics
Mutations were annotated according to the HGVS nomenclature
(http://www.hgvs.org/mutnomen/). Nucleotide numbering reflects cDNA numbering with
+1 corresponding to the A of the ATG translation initiation codon 1 in the reference
sequence, according to journal guidelines. A variant was designated as novel if it was not
found in dbSNP Build 136 in 1000 genome data. The potential pathogenic effect of the
missense mutations on protein function was predicted using two online programs:
PolyPhen (Polymorphism Phenotyping) (http://genetics.bwh.harvard.edu/pph/) and
PANTHER (Protein Analysis Through Evolutionary Relationships)
(http://www.pantherdb.org/). Multiple alignments of the PTK7 proteins were done using
the CLUSTAL W program built in Mega software (V5.1), freely available online
(http://www.megasoftware.net/). Localization of the variants in protein domains was
assessed by Uniprot (http://www.uniprot.org/).

14. 10
DNA constructs and Reporter Assay
TurboGFP tagged PTK7 plasmid was purchased from Origene (Rockville, MD,
USA). PTK7 mutants were generated by QuikChange II Site-Directed Mutagenesis Kits
(Stratagene). Renilla-luciferase and AP1-luciferase plasmids were kindly provided by
Hongyan Wang (Fudan University, Shanghai, China). As previously described,
HEK293T cells were seeded in dishes and then transfected with AP1-luciferase, Renilla
luciferase and PTK7 variants plasmid. After 24 hours, the cells were harvested for
luciferase activity determination using a dual-luciferase reporter assay system (Promega)
[48].
Statistical Analysis
Rare variants were defined as those having a minor allele frequency (MAF) of at
most 1%, and the others (MAF≥0.01) were defined as common variants. Fisher’s exact
test was used to test association between NTDs and PTK7 rare variants. Chi-square test
was used to assess common variants and NTDs association analyses. Differences in
luciferase reporter assay among different PTK7 mutants were evaluated by a Student’s t
test. All statistical tests were 2-sided, with p<0.05 set as the significance level, and
performed by using SPSS 15.0 software (SPSS, Chicago, IL, USA).

15. 11
RESULTS
DNA Re-sequencing results
DNA re-sequencing in 382 subjects revealed 19 rare variants (MAF< 1%) and 5
common variants (MAF>1%). Of these, 9 had not been previously reported. Among the
192 spina bifida cases, three unique, novel missense mutations that were not present in
controls p.Thr186Met [c.557C>T], p.Arg630Ser [c.1888C>A] and p.Tyr725Phe
[c.2174A>T]) were identified (Table 1, Figure 1). These three mutations occurred in
amino acids that are highly conserved throughout species and are predicted as
deleterious. The PTK7 p.Thr186Met [c.557C>T] variant was identified in one case infant
and involves the immune-globin like domain of the protein, altering a hydrophilic residue
into a hydrophobic residue (Figure 1C). The p. Arg630Ser [c.1888C>A] variant was
identified in another case infant, and PolyPhen software predicted this allele as a potential
pathogenic mutation. In both chickens and Zebrafish, the amino acid at this position is
lysine, a positively charged amino acid. In humans, the amino acid at this position is
arginine, also a positively charged amino acid. However, in this spina bifida case, the
amino acid arginine was altered to serine, a hydrophilic uncharged amino acid. The
p.Tyr725Phe [c.2174A>T] variant was identified in a third case infant and affects another
highly conserved amino acid within the trans-membrane domain of PTK7. This variant
results in an alteration of tyrosine, a hydrophilic amino acid into phenylalanine, a
hydrophobic amino acid. PolyPhen software predicted that this alteration could be
damaging to the protein.
Three novel missense mutations unique to each of the three control infants were
also identified. These three mutations include p.Arg271Cys [c.811C>T], p.Arg294His

16. 12
[c.881G>A] and p.Ala856Thr [c.2566G>A] (Table 1, Figure 1). PolyPhen software
predicted that two of these mutations, p.Arg271Cys [c.811C>T] and p.R294H
[c.881G>A] were probably damaging and p.Arg294His [c.881G>A] was also predicted to
be damaging using another program, SIFT (http://sift.jcvi.org/). Four rare variants, which
were predicted to be damaging by PolyPhen in dbSNP and that were previously reported,
were also detected in controls but not in cases (Table 1).
Five previously known common single nucleotide polymorphisms (SNPs) were
also identified in both cases and controls. However, none were associated with NTD
cases (p> 0.05) (Table 2). Only one of these common SNPs, rs6905948, had a relatively
high MAF (MAF>0.10) while all of the other common SNP’s had MAFs less than 0.05.
Functional analysis results
As previously mentioned, PTK7 is a PCP regulator in vertebrate embryos. Down
stream in the PCP pathway, the jun-N-terminal kinase (JNK) functions and is itself
phosphorylated by PCP signaling to activate c-Jun, which in turn forms the activator
protein-1 (AP1) transcription factor as a homo- or heterodimer. In this study, the rare
SNPs were tested to determine their affect on PTK7 activity to modulate the activation of
JNK. The AP1-luciferase reporter assay provides readout of JNK signaling and the
transcriptional activity of the AP1 promoter enhancer in cultured cells. The mutants
identified in NTD patients exhibited differential stimulatory effects on JNK activity with
p.Thr186Met, p.R630S and p.Tyr725Phe being more active than wild type PTK7. The
mutants detected in controls had the similar stimulatory effects compare to PTK7 wild
type (Figure 2).

17. 13
DISCUSSION
PCP signaling regulates events involved in neural tube closure and is mediated by
the noncanonical Wnt pathway. PTK7 is a vertebrate specific regulator of PCP. Recent
studies revealed that homozygous PTK7 deleterious variants disrupted proper neural tube
closure resulting in mouse embryos with craniorachischisis. It was also reported that
fetuses that were double heterozygous for PTK7 and VANGL2 variants presented with
spina bifida [48]. These observations led to the exploration of a potential association
between PTK7 and human spina bifida.
It was hypothesized that there would be a significant difference in the number of
functional rare variants between spina bifida cases and non-malformed controls. The
hypothesis was supported as three functionally significant rare variants in NTD cases
were revealed while no functional rare variants were detected in controls. The association
of five common PTK7 SNPs in spina bifida cases was also evaluated and no significant
frequency differences were found. Considering the small sample size, a haplotype
analysis on these common SNPs was not preformed.
The AP1 luciferase assays that were preformed revealed that the three private
mutations in spina bifida cases were more efficient than the wild type PTK7 in
stimulating an AP1 regulated promoter construct. It is widely understood that neural tube
closure is highly sensitive to alterations in PCP signaling. Both hypermorphic PCP
mutations such as PRICKLE1 p.Ile67Thr, p.Asn81His, p.Thr275Met, p.Arg682Cys [43]
and hypomorphic mutations such as SEC24B p.Phe227Ser [55] may contribute to neural
tube closure failure in humans. The three functional PTK7 variants revealed may act as
hypermorphic alleles and disturb normal neural tube closure.

18. 14
In this present study, cases were restricted to spina bifida. Additional studies
including a large number of more severe cases such as craniorachischisis and further
functional studies are warranted to determine whether PTK7 mutations contribute to other
types of human NTDs risk. For example, use of a model organism such as zebrafish may
be used to verify the results from the AP1 assays. Overall, data indicates that PTK7 gene
mutations contribute to the population burden of human spina bifida.

19. 15
REFERENCE PAGE
[1]. Marini NJ, Hoffman TJ, Lammer EJ, Hardin J, Lazaruk K, Stein JB, Gilbert DA,
Wright C, Lipzen A, pennachio LA, Carmichael SL, Witte JS, Shaw GM, Rine J.
(2011) A Genetic Signature of Spina Bifida Risk from Pathway- Informed
comprehensive gene-variant analysis. PLoS One 6(11):e28408.
[2]. Deopujari, R, Mangalgiri A, Dixit A, Longia GS. (2011) Neural Tube Defect
Spectrum- Study of Craniorachischisis. People’s Journal of Scientific Research
4(1): 23-27.
[3]. Forrester MB, Merz RD. (2000) Prenatal Diagnosis and Elective Termination of
Neural Tube Defects in Hawaii, 1986-1997. Fetal Diagn Ther 15:146-151.
[4]. Moore CA, Li S, Li Z, Hong SX, Gu HQ, Berry RJ, Mulinare J, Erickson JD.
(1997) Elevated rates of severe neural tube defects in a high-prevalence area
in northern China. Am J Med Genet 73:113-118.
[5]. Tunçbilek E, Boduroğlu K, Alikaşifoğlu M. (1999) Neural tube defects in Turkey:
prevalence, distribution and risk factors. Turk J Pediatr 41(3):299-305.
[6]. The EUROCAT Working Group. (1987) Prevalence of neural tube defects in 16
regions of Europe, 1980-1983. Int J Epidemiol 16(2):246-51.
[7]. Holden KR, Collins JS, Greene JF, Hinkle S, Nave AF, Portillo JM, Page GP,
Stevenson RE; Honduran Neural Tube Defect Project Team. (2002) Dietary
intake and blood folate levels in Honduran women of childbearing age. J Child
Neurol 17(5):341-6.
[8]. McDonnell RJ, Johnson Z, Delaney V, Dack P. (1999) East Ireland 1980-1994:
Epidemiology of neural tube defects. J Epidemiol Community Health 53:782-788.

20. 16
[9]. CDC. (1992) Spina bifida incidence at birth - United States, 1983-1990.
MMWR Morb Mortal Wkly Rep 41:497-500.
[10]. Yen IH, Khoury MJ, Erickson JD, James LM, Waters GD, Berry RJ. (1992)
The changing epidemiology of neural tube defect, United States, 1968-1989.
Am J Dis Child 146:857-861.
[11]. Little L, Elwood JM. Epidemiology of neural tube defects. (1991) Reproductive
and Perinatal Epidemiology. Kiley M, Ed., CRC Press, Boston, 251-336.
[12]. Campbell LR, Dayton DH, Sohal GS. (1986) Neural tube defects: a review of
human and animal studies on the etiology of neural tube defects. Teratology
34:171-187.
[13]. Owen TJ, Halliday JL, Stone CA. (2000) Neural tube defects in Victoria, Australia:
potential contributing factors and public health implications. Aust N Z J Public
Health 24:584-589.
[14]. Hendricks KA, Simpson JS, Larsen RD. (1999) Neural tube defects along the
Texas-Mexico border, 1993-1995. Am J Epidemiol 149:1119-1127.
[15]. Canfield MA, Annegers JF, Brender JD, Cooper SP, Greenberg. (1996)
Hispanic origin and neural tube defects in Houston/Harris County, Texas. I.
Descriptive epidemiology. Am J Epidemioly 143:1-11.
[16]. Shaw GM, Jensvold NG, Wasserman CR, Lammer E. (1994) Epidemiologic
characteristics of phenotypically distinct neural tube defects among 0.7
million California births, 1983-87. Teratology 49:143-149.
[17]. CDC. (1992) Spina bifida incidence at birth - United States, 1983-1990. MMWR
Morb Mortal Wkly Rep 41:497-500.

21. 17
[18]. Chavez GF, Cordero JF, Becerra JE. (1988) Leading major congenital
malformations among minority groups in the United States, 1981-1986. Mor
Mortal Wkly Rep CDC Surveill Summ 37:17- 24.
[19]. Carter CO. (1974) Clues to the aetiology of neural tube malformations.
Developmental medicine and child neurology 16 (6):3-15.
[20]. Loeken MR. (2005) Current perspectives on the causes of neural tube defects
resulting from diabetic pregnancy. Am J Med Genet Part C 135C:77-87.
[21]. Wasserman CR, Shaw GM, Selvin S, Gould JB, Syme SL. (1998) Socioeconomic
status, neighborhood and social conditions, and neural tube defects. Am J Public
Health 88:1674-1680.
[22]. Smithells RW, Sheppard S, Schorah CJ, Seller MJ, Nevin NC, Harris R, Read AP,
Fielding DW. (1981) Apparent prevention of neural tube defects by
periconceptional Vitamin supplementation. Arc Dis Child 56(12): 911–918.
[23]. Milunsky, A., H. Jick, S.S. Jick, C.L. Bruell, O.S. MacLaughlin, K.J.
Rothman, and W. Wlllett. (1989) Multivitamin/folic acid
supplementatlon in early pregnancy reduces the prevalence of neural
tube defects. JAM 262: 2847-2852.
[24]. Carmichael SL, Shaw GM, Selvin S, Schaffer DM. (2003) Diet quality and Risk of
Neural Tube Defects. Med Hypotheses 60:351-355.
[25]. Ross ME. (2010) Gene-environment interactions, folate metabolism and the
Embryonic nervous system. Wiley Interdiscip Rev Syst Biol Med 2(4):471–480.

22. 18
[26]. Hobbs CA, Shaw GM, Werler MM, Mosely B. (2010) Folate Status and Birth
Defects Risk. Epidemiological perspective. Folate in Health and Disease. ed
Bailey LB(CRC Press, Taylor & Francis Group, Boca Raton, FL), 2nd ed, pp 133-
153.Comprehensive Gene- Variant Analysis. PLoS one 6(11) e28408.
[27]. Parlington MD, Mclone DG. (1995) Hereditary factors in the etiology of neural tube
defects: results of a survey. Pediatr Neurosurg 46:229-241.
[28]. Copp AJ, Stanier P, Greene NDE. (2013) Neural tube defects: recent advances,
unsolved questions, and controversies. Lancet Neurol 12:799-810.
[29]. Carter CO. (1969) Polygenetic inheritance and common diseases. Lancet 1:1252-
1256.
[30]. Carter CO. (1974) Clues to the aetiology of neural tube malformation. Dev Med
Child Neurol 16:3-15.
[31]. Purves D, Augustine GJ, Fitzpatrick D. (2001) Neuroscience: The Initial Formation
of the Nervous System: Gastrulation and Neurulation. Sinauer Associates 2
[32]. Shum AS, Copp AJ. (1996) Regional differences in morphogenesis of the
neuroepithelium suggest multiple mechanisms of spinal neurulation in the mouse
Anat Embryol 194:65-73.
[33]. Finnell RF, Gould A, Spiegelstein O. (2003) Pathobiology and genetics of neural
tube defects Epilepsia 44:14-23.
[34]. O’Rahilly R, Müller F. (2002) The two sites of fusion of the neural tube and two
neuropores in the human embryo Teratology 65:162-170.
[35]. Shimokita E1, Takahashi Y. (2011) Secondary neurulation: Fate-mapping and gene
manipulation of the neural tube in tail bud. Dev Growth Differ 53:401-410.

23. 19
[36]. Simons M, Mlodzik M. (2008) Planar cell polarity signaling: from fly development
to human disease. Annu Rev Genet. 42:517-540.
[37]. Wallingford JB. (2012) Planar cell polarity and the developmental control of cell
behavior in vertebrate embryos Annu Rev Cell Dev Biol 28:627-653.
[38]. Ybot-Gonzalez P, Savery D, Gerrelli D, Signore M, Mitchell CE, et al. (2007)
Convergent extension, planar-cell-polarity signaling and initiation of mouse
neural tube closure. Development. 134:789-799.
[39]. Kibar Z, Torban E, McDearmid JR, Reynolds A, Berghout J, et al. (2007)
Mutations in VANGL1 associated with neural-tube defects. N Engl J Med 356:
1432-1437.
[40]. Kibar Z, Bosoi CM, Kooistra M, Salem S, Finnell RH, et al. (2009) Novel
mutations in VANGL1 in neural tube defects. Hum Mutat 30: E706-715.
[41]. Lei YP, Zhang T, Li H, Wu BL, Jin L, et al. (2010) VANGL2 mutations in human
cranial neural-tube defects. N Engl J Med 362: 2232-2235.
[42]. Kibar Z, Salem S, Bosoi CM, Pauwels E, De Marco P, et al. (2011) Contribution of
VANGL2 mutations to isolated neural tube defects. Clin Genet 80: 76-82.
[43]. Bosoi CM, Capra V, Allache R, Trinh VQ, De Marco P, et al. (2011) Identification
and characterization of novel rare mutations in the planar cell polarity gene
PRICKLE1 in human neural tube defects. Hum Mutat 32: 1371-1375.
[44]. De Marco P, Merello E, Rossi A, Piatelli G, Cama A, et al. (2012) FZD6 is a novel
gene for human neural tube defects. Hum Mutat 33: 384-390.

24. 20
[45]. Robinson A, Escuin S, Doudney K, Vekemans M, Stevenson RE, et al. (2012)
Mutations in the planar cell polarity genes CELSR1 and SCRIB are associated
with the severe neural tube defect craniorachischisis. Hum Mutat 33: 440-447.
[46]. Allache R, De Marco P, Merello E, Capra V, Kibar Z (2012) Role of the planar cell
polarity gene CELSR1 in neural tube defects and caudal agenesis. Birth Defects
Res A Clin Mol Teratol 94: 176-181.
[47]. Seo JH, Zilber Y, Babayeva S, Liu J, Kyriakopoulos P, et al. (2011) Mutations in
the planar cell polarity gene, Fuzzy, are associated with neural tube defects in
humans. Hum Mol Genet 20: 4324-4333.
[48]. Shi Y, Ding Y, Lei YP, Yang XY, Xie GM, et al. (2012) Identification of novel rare
mutations of DACT1 in human neural tube defects. Hum Mutat.
[49]. Lu X, Borchers AG, Jolicoeur C, Rayburn H, Baker JC, et al. (2004) PTK7/CCK-4
is a novel regulator of planar cell polarity in vertebrates. Nature 430: 93-98.
[50]. Roszko I, Sawada A, Solnica-Krezel L (2009) Regulation of convergence and
extension movements during vertebrate gastrulation by the Wnt/PCP pathway.
Semin Cell Dev Biol 20: 986-997.
[51]. Peradziryi H, Tolwinski NS, Borchers A (2012) The many roles of PTK7: A
versatile regulator of cell-cell communication. Arch Biochem Biophys 524: 71-
76.
[52]. Golubkov VS, Chekanov AV, Cieplak P, Aleshin AE, Chernov AV, et al. (2010)
The Wnt/planar cell polarity protein-tyrosine kinase-7 (PTK7) is a highly efficient
proteolytic target of membrane type-1 matrix metalloproteinase: implications in
cancer and embryogenesis. J Biol Chem 285: 35740-35749.

25. 21
[53]. Wehner P, Shnitsar I, Urlaub H, Borchers A (2011) RACK1 is a novel interaction
partner of PTK7 that is required for neural tube closure. Development 138: 1321-
1327.
[54]. Yen WW, Williams M, Periasamy A, Conaway M, Burdsal C, et al. (2009) PTK7 is
essential for polarized cell motility and convergent extension during mouse
gastrulation. Development 136: 2039-2048.
[55]. Yang XY, Zhou XY, Wang Q, Li H, Chen Y, et al. (2013) Mutations in the COPII
Vesicle Component Gene SEC24B are Associated with Human Neural Tube
Defects. Hum Mutat.

26. 22
Figure 1
Figure 1. Identification of NTD-associated non-synonymous amino acid substitutions in
the PTK7 gene. (A) Conserved domains of the PTK7 and positions of the detected novel
rare missense mutations: TM, transmembrane domain; IG, immunoglobulin domains.
Red mutations marked at the upper were identified in NTDs, lower variants were detected
in controls. (B) Alignment of PTK7 ortholog protein sequences using the ClustalW
method. Conserved residues were shaded by GeneDoc. The following sequences were
used: human, NP_002812.2; chimpanzee, XP_518486.2; dog, XP_538929.2; cattle,
NP_001179894.1; mouse, NP_780377.1; chicken, NP_001026206.1; and zebrafish,
XP_002667315.1

27. 23
Figure 2
Figure 2. Functional analysis of PTK7 novel rare mutations identified in this study.
A: AP1 luciferase assay. HEK293T cells were transfected with AP1-luciferase, Renilla
luciferase and PTK7 variants plasmid. After 24 hours, the cells were harvested for
luciferase activity determination (**p<0.01, t test)

28. 24
Table 1. Novel and Known Rare Variants (MAF<0.01) in the Coding Sequence of PTK7
Gene detected in this study
Nucleotide
change dbSNPID
AminoAcid
change Ct(190)/NTD(192) PolyPhenPrediction
SIFT
Prediction UniprotDomain
c.171T>A NA p.A57A 0/1 NA NA
c.557C>T NA p.Thr186Met 0/1 benign TOLERATED Ig-like C2-type 2
c.806G>A rs78949718 p.R269H 1/0 probablydamaging TOLERATED Ig-like C2-type 3
c.811C>T NA p.R271C 1/0 probablydamaging TOLERATED Ig-like C2-type 3
c.837A>G NA p.T279T 1/0 NA NA
c.881G>A NA p.R294H 1/0 probablydamaging DAMAGING Ig-like C2-type 3
c.958G>A rs141712145 p.A320T 1/0 probablydamaging TOLERATED Ig-like C2-type 4
c.1034C>T rs143537049 p.P345L 0/1 benign TOLERATED Ig-like C2-type 4
c.1075G>A rs148069775 p.A359T 1/0 possiblydamaging DAMAGING Ig-like C2-type 4
c.1214A>G rs138575208 p.N405S 1/0 benign TOLERATED Ig-like C2-type 4
c.1803G>A NA p.T601T 0/1 NA NA
c.1888C>A NA p.R630S 0/1 possiblydamaging TOLERATED Ig-like C2-type 7
c.2013C>T rs45453593 p.N671N 2/1 NA NA
c.2024C>T rs79644111 p.T675M 1/1 probablydamaging TOLERATED Ig-like C2-type 7
c.2174A>T NA p.Tyr725Phe 0/1 possibly damaging TOLERATED Transmembrane
c.2236A>C rs150631466 p.M746L 2/1 benign TOLERATED
c.2566G>A NA p.A856T 1/0 benign TOLERATED Proteinkinase
c.2925C>G rs55921533 p.P975P 2/1 NA NA Proteinkinase
c.3113G>A rs34865794 p.R1038Q 2/1 benign TOLERATED Proteinkinase

29. 25
Table 2. Common Variants (MAF>=0.01) in the Coding Sequence of PTK7 Gene detected in this study
Nucletide change
(NM_002821.3) dbSNP ID
Amino acid change
(NP_002812.2 )
MAF
Control/Case p Value
c.1176C>T rs56004029 p.H392H 0.018/0.023 0.82
c.1228A>T rs34021075 p.T410S 0.016/0.005 0.28
c.1851G>A rs6905948 p.G617G 0.374/0.382 0.88
c.2235G>C rs9472017 p.E745D 0.013/0.003 0.21
c.2330C>T rs34764696 p.A777V 0.027/0.030 0.99

30. 26
Appendix 1. Primer sequences and optimal PCR for PTK7
PTK7 Forward Primer Reverse Primer
EX1 TCTCTATTCTCCATCCCTCT TCTCCACTACTCCAGGG
EX2 AGAAAAGTTTTTCAGGGGAC TGATAAATGCATTCTGCCTG
EX3 CAGGCACTTAGTATCTGGTA AAAAGGGCACACAGTAATTC
EX4 ATACTGTATCCTCTCCACTG ATGTCTGTGATACAAATCGC
EX5 AACCATATCACTCTCTCTCG ATATCCTCTTCCTACTCCCA
EX6 AGAACATCATGTACCCTGAG CTGTCACTATTTCCTCTGGA
EX7 ATCACTTGAGCCTATGAGTT CATTCTTGAAGACCTCGAAC
EX8 TCTCAGAGGTGAGAAAGAAG GTGAACTTGAGCTTTTCTGT
EX9 GTTCGAGGTCTTCAAGAATG TTGAGTTGTCTTCCATGTTG
EX10 TCCTTCCCATAATTTCCCTT GAGCCATTCTGGAAGATGT
EX11 TGGTCTCTTTTCTTCCAGTT CTGAGTACAAGGTGACAAAC
EX12 GTTGGGAGGAGTTAGTAGAG GAAACAGCAGGGAATCATAG
EX13 CTAGGGGATAGCCATACATC AGGTAGTACACAGGAATGAC
EX14 GTCCCACCCTTTTATTTTGT CAGAAGCTGAGCATCATAAG
EX15 TTTTAAAGTTCTGCACTCCC TGTCTTCATCCACAAAATGG
EX16 GGCACTTTAGTTTGCTTAGT TGGAAAAAGGATGAGAAAGC
EX17 GTGGTTACCTCCAGATTTTG CACTCCGTCTCAAAAGAAAA
EX18 GGAGTCATCTTTTTCCGTTG TGTCCCTGATAGAGGAAGA
EX19 GCTGTCTTCCCTACAGATT ATTAAGGAACTCCCCACAAA
EX20 AATTTCTGGCCTTCAACTTC ATAAAAGTGTGGGGTAAGGA
EX21 TCCTTTCCTCATCCTAAGTG CACCATGTCCAGCTAATTTT

31. 27
Appendix 2. PCR Amplification Protocol for PTK7
PCR Mixture (use 10x Buffer) 1X 100X
10X PCR Buffer 1 μl 100 μl
2.5 mM dNTPs 0.8 μl 80 μl
Forward and Reverse primer mix (10uM
each)
0.4 μl 40 μl
Taq (HSTaq, 5U/ul) 0.05 μl 5 μl
H2O 7 μl 700 μl
DNA(buccal brush) 1.0 μl
TOTAL 10.25 μl 1500 μl
PCR Procedure:
Step 1: Make PCR mixture in a 1.5ml tube, mix well.
Step 2: Aliquot 110ul PCR mixture in an 8-well stripe tube.
Step 3: Use the 10ul multiple channel pipette to dispense 9ul PCR mixture to a 96-well
PCR plate.
Step 4: Add 1ul DNA template to each well.
Step 5: Cover plate with 96-Well Full Plate Cover.
Step 6: Centrifuge at 3000rpm for 5 seconds.
Step 7: Set and Run PCR program SP110.
SP110 program:
Stage Temp. (°C) Time
1 95 3 minutes
2 95 30 seconds
3 63 15 seconds
4 72 40 seconds
Repeat steps 2-4 for 11 cycles
5 95 20 seconds
6 57 15 seconds
7 72 40 seconds
8 72 3 minutes
9 10 Hold

32. 28
Amplification Confirmation Procedure:
When PCR is complete, randomly pick 4-8 PCR products to run an agarose gel.
Step 1: Make loading buffer-PCR product mix-
1ul 6x DNA loading buffer + 2.5ul PCR product.
Step 2: Centrifuge at 3000rpm for 5 seconds.
Step 3: Make 1% agarose gel-
add 2.8g agarose powder to 280ml 1x TAE buffer.
Step 4: Microwave heat for 4 minutes.
Step 5: Add 13ul 10mg/ml ethidium bromide (EB) to the gel, mix well.
Step 6: Pull in a tray; insert 4 combs (usually 50 wells comb).
Step 7: Load Wells-
Load buffer mix to gel well, load PCR product, load 3ul DNA ladder to a gel well.
Step 8: Run gel at 160 V for 15 Minutes (blue dye to the middle of the gel).
Step 9:Take a picture of the gel.

33. 29
Appendix 3. Sequencing protocol for PTK7
Purification Procedure:
Step 1: Add 1ul of ExpSAP-ITr (USB Corporation, PN 78200) to 10 ul PCR products.
Step 2: Seal the plate with MicroAmp® 96-Well Full Plate Cover.
Step 3: Centrifuge the plate at 4000 x g for 30 seconds.
Step 4: Set and Run PCR program PURE:
Purification Program:
Stage Temp. (°C) Time
1 37 60 min
2 80 15 min
3 10 Indefinite hold
Step 5: Set the reaction volume to certain amount (15 ul).
Step 6: Place the reaction plate in the thermal cycler, cover the plate with an
MicroAmp® 96-Well Full Plate Cover, then start the run.
Step 7: After the run is complete, centrifuge the plate at 2000 x g for 5 seconds to bring
the contents to the bottom.
Step 8: Store the plate according to your designed step:
Within 12 hours – Store the plate at 0 to 4 ℃
After 12 hours – Store the plate at -15 to 25℃
Step 9: After storage and before opening the plate, centrifuge the plate at
2000 x g for 30 seconds.
Step 10: Dilute PCR product to 5-10ng/ul (Usually add 20ul ddH2O to each well).

34. 30
Sequencing Reaction Procedure:
1X 100X
1:3 Dilution of Purified DNA 1.0 ul -
5X Sequencing Reaction 1.0 ul 100.0 ul
Bid Dye Terminator Ready Reaction Mix 0.5 ul 50.0 ul
Primer (Fw/Rev) 0.5 ul 50.0 ul
Nuclease Free H2O 3.0 ul 300.0 ul
Sequencing Program
Stage Temp. (°C) Time Cycle
1 96 1 min 1
2 96 10 sec 25
3 50 5 sec
4 60 4 min
5 4 Hold
After the run is complete, centrifuge the plate at 2000 x g for 5 seconds to bring the
contents to the bottom.

35. 31
Precipitation Protocol
Step 1: Add 2ul of 125mM EDTA to each sample well, mix by vortex for 30 seconds.
Step 2: Add 20ul 100% ethanol to each sample well, seal the plate with aluminum foil,
mix by vortex for 30 seconds.
Step 3: Leave the plate at room temperature for 2 minutes.
Step 4: Centrifuge plate at 4000 rpm for 30 min at 10° C (remove immediately); if unable
to proceed to next step immediately, re-spin for another 5 minutes.
Step 5: Without disturbing the precipitates, remove foil and discard supernatant by
inverting the plate on several layers of Kimwipes.
Step 6: Place the inverted plate with Kimwipes into centrifuge and spin at 800 rpm for 5
seconds (very quick spin; just let centrifuge get up to speed and then turn off), remove the
tray and discard the Kimwipes.
Step 7: Add 40 ul 70% ethanol to each sample well, seal the plate with aluminum foil,
mix by vortex for 30 seconds.
Step8: Centrifuge plate at 4000 rpm for 15 min at 10°C (remove immediately); if unable
to proceed to next step immediately, re-spin for another 5 minutes.
Step 9: Repeat Step 6-7.
Step 10: Add 10ul Hi-Di Formamide to each precipitated sample (can either vortex or
pipet-mix). Place sample plate on sequencer (ABI3730), following the 3730 DNA
analyzer instruction taped on the desk.

36. 32
Biography:
Christina Khoury was born in Amman, Jordan and moved with her family to
Houston, Texas in 1999. She enrolled in the Honors in Advanced Nutritional Sciences
Program at the University of Texas at Austin in 2011. In college she was on leadership
for a student ministry called ECHO. She was also a student member of the Academy of
Nutrition and Dietetics and the Texas Academy of Nutrition and Dietetics. She worked in
the foodservice industry as a server, interned at the Methodist Hospital Wellness Center
in Houston, Texas and at the Fitness Institute of Texas in Austin, Texas. In the summer of
2015, she will complete the Coordinated Program in Dietetics at the University of Texas,
where she will gain eligibility to take her final exam and become a Registered Dietitian.