SlideShare a Scribd company logo
1 of 12
Download to read offline
Sample Preparation for
Diagnostics & Life Science
A
G
C
T
Next Generation
Sequencing Products
CancerSeq-Characterized Cancer FFPE tissue samples
by Next Generation Sequencing (NGS)
Sample and Services for Next Generation Sequencing
Cancer Gene Panel-NGS Testing Service
RapidSeq-Directonal mRNA Sample Prep Kit for NGS
RapidSeq-Small RNA Sample Prep Kit for NGS
Sample Preparation for
Diagnostics & Life Science
www.biochain.com
1-888-762-2568 (Main)
order@biochain.com (Order)
BioChain’s CancerSeq™
genetically characterized FFPE blocks give you
and your data more power
Blocks and Slides available for:
- Breast Cancers
- Colon Cancers
- Lung Cancers
- Melanomas
- Other Cancers (via request)*
Cancer Gene Panel Includes:
The Illumina TruSeq® Amplicon - Cancer Panel
(TSACP) to characterize 48 cancer genes,
including BRAF, KRAS, EGFR, ALK, and Tp53.
Features
- Tissue from a wide variety of sources, Whole FFPE blocks, slides, and DNA
- Suitable for immunohistochemistry, in situ hybridization assays,
and molecular applications
ABL1 ERBB4 JAK2 PIK3CA
AKT1 FBXW7 JAK3 PTEN
ALK FGFR1 KDR PTPN11
APC FGFR2 KIT RB1
ATM FGFR3 KRAS RET
BRAF FLT3 MET SMAD4
CDH1 GNA11 MLH1 SMARCB1
CDKN2A GNAQ MPL SMO
CSF1R GNAS NOTCH1 SRC
CTNNB1 HNF1A NPM1 STK11
EGFR HRAS NRAS TP53
ERBB2 IDH1 PDGFRA VHL
CATALOG # PRODUCT NAME SIZE
T2235086-SB CancerSeq™ Paraffin Tissue Tumor Block: Breast 1 Block
T2235090-SB CancerSeq™ Paraffin Tissue Tumor Block: Colon 1 Block
T2235152-SB CancerSeq™ Paraffin Tissue Tumor Block: Lung 1 Block
T2235218A-SB CancerSeq™ Paraffin Tissue Tumor Block: Skin Melanoma 1 Block
- Make sense out of ambiguous IHC results by knowing the genetics
- Buy just the blocks with the right genetic background
- Search our databases for blocks with novel mutations
- Take advantage of NGS without expensive infrastructure
NGS Samples and
Services
As a provider of tissues and nucleic acids derived from them,
BioChain is uniquely positioned to extract DNA and RNA from the
most challenging tissues, and perform re-sequencing and RNAseq.
Tissues:
We have over 300,000 Frozen and FFPE blocks to collect DNA and RNA
from. You may also contract with us to procure rare materials for your
sequencing project.
Extraction:
We have provided high quality DNA and RNA from the most challenging
tissues including FFPE blocks, cartilage, and brain for over 15 years.
Library preparation:
We are Experienced with all Illumina library preparation kits as well as
our proprietary RapidSeqTM small RNA library prep kit.
Illumina MiSeq NGS:
With special expertise in RNAseq and resequencing with Trueseq
Custom and Cancer Amplicon panels, we handle a wide variety of
sequencing projects.
Data analysis and consultation:
We can help with experimental design through variant calling and anno-
tation.
Cancer Driver Gene Panel
NGS Testing Service
One - Step Shop Cancer Sequencing Test
Services from Beginning to End
NGS Leading Platform
-
- Greater than 35 kb of cancer
consensus targets including BRAF,
KRAS & EGFR
- 212 amplicons in one tube; 48 genes
Unrivaled Multiplexing
- Up to 96 sample pooling on MiSeq
- >90% specificity and uniformity
- Detect low frequency variants (<5%)
Unparalleled Workflow
- FFPE-enabled with sample QC Kit
- Automated paired end sequencing
with MiSeq
Industry Standard Delivery
- Cost-effective solution
- Quick turn-around time
ABL1 EGFR GNAS MLH1 RET
AKT1 ERBB2 HNF1A MPL SMAD4
ALK ERBB4 HRAS NOTCH1 SMARCB1
APC FBXW7 IDH1 NPM1 SMO
ATM FGFR1 JAK2 NRAS SRC
BRAF FGFR2 JAK3 PDGFRA STK11
CDH1 FGFR3 KDR PIK3CA TP53
CDKN2A FLT3 KIT PTEN VHL
CSF1R GNA11 KRAS PTPN11
CTNNB1 GNAQ MET RB1
48 Cancer Biomarker
AATTCCGGCCGATCAGGGG
TTTACACCAATGGGACCATTAC
CCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGG
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACC
CAAAGGCC
TTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGAATTCCGGCCGATCAGGGGTTTACACCAAT
GGTTTACACCAATGGGACCATTACCAAC
Directional mRNA
Sample Prep Kit
Sample Prep System for mRNA Sequencing
Features
• Low RNA Input
Requires as little as 50 ng of total RNA input
• Directional
Increased useful number of reads
• < 1 Hour Hands-on Time
Streamlined workflow
Library construction in < 7 hours
• All-in-One Kit
Includes all necessary enzymes and plastics
• FFPE RNA Compatible
High Quality Libraries without
Artifacts or Contaminations
Bioanalyzer Trace of Constructed Library
of mRNA from corn
Description
The RapidSeq Directional mRNA Sample Prep kit provides strand-specific cDNA synthesis
with reduced costs and increased sensitivity.
Directionality Assessment
Comparison with TruSeq in Prokaryotic Cells
mRNA Input (ng) Sample Type % Sense
100 (Competitor I Kit) FFPEmRNA (1 year) 97.85%
100 (RapidSeq Kit) FFPEmRNA (1 year) 97.88%
500 (Competitor I Kit) FFPEmRNA (10 years) 97.59%
500 (RapidSeq Kit) FFPEmRNA (10 years) 97.57%
Parameter TruSeq RapidSeq
Coverage Rate 44.00% 65.00%
rRNA Contamination with 23s, 16s, and 5s
removal
2.70% 1.50%
tRNA contamination 64.00% 57.00%
Unknown sequence percentage 5.00% <1%
Directional Percentage 74% 77.50%
Average Quality Score (range from 0 to 40,
with 40 being the highest quality)
26 37
CATALOG # PRODUCT NAME
KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner
KS073012 I-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligners 1-48
K2012008 MagSeq mRNA Purification Kit
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGAC
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGACCCATTTAGAACAG
Small RNA Sample
Prep Kit Everything you need in one box
Applications
• Small RNA discovery and quantification
• miRNA expression profiling
• miRNA related functional assessments
Description
The RapidSeq Small RNA Sample Prep Kit
is a cost effective and reliable solution for small
RNA library preparation using Illumina’s
sequencing platform. Our reagents are master
mixed for optimal performance and simple
experiment setup, which minimizes human error.
RapidSeq can be used for a variety of studies
involving small RNA libraries.
Construct Pure Libraries
with no Artifacts or Contamination
Bioanalyzer Trace of FFPE microRNA Library
Highly Consistent and
Reproducible Results
Normalized R2 Plot of miRNA counts
from Two Replicate Libraries
CATALOG # PRODUCT NAME
KS071012-I RapidSeq Small RNA Sample Prep Kit - With Aligner 1-12
KS071012-II RapidSeq Small RNA Sample Prep Kit - With Aligner 13-24
KS071012-III RapidSeq Small RNA Sample Prep Kit - With Aligner 25-36
KS071012-IV RapidSeq Small RNA Sample Prep Kit - With Aligner 37-48
Save time
Less than 1 hour hands-on (7 hours with incubations).
Avoid purchasing headaches
Includes all necessary enzymes and plastics.
Don’t worry about RNA quantity
Good results with as little as 1 ng or as much as 10 µg of total RNA.
Have FFPE RNA? No problem!
FFPE RNA compatible
NGS Related
Products
T2235086-SB CancerSeq Parafin Tissue Tumor Block: Breast 1 Block
T2235090-SB CancerSeq Parafin Tissue Tumor Block: Colon 1 Block
T2235152-SB CancerSeq Parafin Tissue Tumor Block: Lung 1 Block
T2235218A-SB CancerSeq Parafin Tissue Tumor Block: Skin Melanoma 1 Block
KS073012-I RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS073012-II RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS073012-III RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS073012-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner 1 Kit
KS073012-T
RapidSeq High Yield Directional mRNA Sample Prep Kit, Trial version enough
for 2 rxn. Customer select aligners
1 Kit
KS074012-I RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS074012-II RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS074012-III RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS074012-IV RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS074012 RapidSeq High Yield Small RNA Sample Prep Kit - Without Aligners 1 Kit
KS074012-T
RapidSeq High Yield Small RNA Sample Prep Kit, Trial version enough for 2 rxn.
Customer select aligners
1 Kit
KS075012-I RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS075012-II RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS075012-III RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS075012-IV RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS075012 RapidSeq Mastermix Directional mRNA Sample Prep Kit - Without Aligners 1 kit
KS071012-I RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS071012-II RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS071012-III RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS071012-IV RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS071012 RapidSeq MasterMix Small RNA Sample Prep Kit - Without Aligner 1 Kit
CATALOG # DESCRIPTION UNITS
Other Related
Products
D1B34999-G02 Control Genomic DNA - Bovine Female 100 µg
D1B34999-G01 Control Genomic DNA - Bovine Male 100 µg
D1C34999-G02 Control Genomic DNA - Chicken Female 100 µg
D1C34999-G01 Control Genomic DNA - Chicken Male 100 µg
D1534999-Cy-G02 Control Genomic DNA - Cynomolgus Monkey Female 100 µg
D1534999-Cy-G01 Control Genomic DNA - Cynomolgus Monkey Male 100 µg
D1734999-G02 Control Genomic DNA - Dog Female 100 µg
D1734999-G01 Control Genomic DNA - Dog Male 100 µg
D1G34999-G02 Control Genomic DNA - Guinea Pig Female 100 µg
D1G34999-G01 Control Genomic DNA - Guinea Pig Male 100 µg
D1H34999-G02 Control Genomic DNA - Hamster Female 100 µg
D1H34999-G01 Control Genomic DNA - Hamster Male 100 µg
D1234999-G02 Control Genomic DNA - Human Female 100 µg
D1234999-G01 Control Genomic DNA - Human Male 100 µg
D1334999-G02 Control Genomic DNA - Mouse Female 100 µg
D1334999-G01 Control Genomic DNA - Mouse Male 100 µg
D1934999-G02 Control Genomic DNA - Porcine Female 100 µg
D1934999-G01 Control Genomic DNA - Porcine Male 100 µg
D1834999-G02 Control Genomic DNA - Rabbit Female 100 µg
D1834999-G01 Control Genomic DNA - Rabbit Male 100 µg
D1434999-G02 Control Genomic DNA - Rat Female 100 µg
D1434999-G01 Control Genomic DNA - Rat Male 100 µg
D1534999-G02 Control Genomic DNA - Rhesus Monkey Female 100 µg
D1534999-G01 Control Genomic DNA - Rhesus Monkey Male 100 µg
R1234010-50 Total RNA - Human Adult Normal Tissue: Bladder 50 µg
R1234035-50 Total RNA - Human Adult Normal Tissue: Brain 50 µg
R1234086-50 Total RNA - Human Adult Normal Tissue: Breast 50 µg
R1234090-50 Total RNA - Human Adult Normal Tissue: Colon 50 µg
R1234090-P Total RNA - Human Adult Normal Tissue 5 Donor Pool: Colon 50 µg
R1234122-50 Total RNA - Human Adult Normal Tissue: Heart 50 µg
R1234142-50 Total RNA - Human Adult Normal Tissue: Kidney 50 µg
R1235010-10 Total RNA - Human Tumor Tissue: Bladder 10 µg
R1235023-10 Total RNA - Human Tumor Tissue: Bone 10 µg
R1235086-50 Total RNA - Human Tumor Tissue: Breast 50 µg
R1235090-50 Total RNA - Human Tumor Tissue: Colon 50 µg
R1235142-50 Total RNA - Human Tumor Tissue: Kidney 50 µg
R1235149-50 Total RNA - Human Tumor Tissue: Liver 50 µg
Control Genomic DNA
Total RNA
Sample Preparation for Diagnostics & Life Science
www.biochain.com
1-888-762-2568 (Main)
order@biochain.com (Order)

More Related Content

What's hot

20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA Roberto Scarafia
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsGolden Helix Inc
 
Next-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologiesNext-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologiesJan Aerts
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...QBiC_Tue
 
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowBrian Krueger
 
A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...Alexander Jueterbock
 
QIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAGEN
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencingDayananda Salam
 
140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposal140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposalGenomeInABottle
 
Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)LOGESWARAN KA
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Thermo Fisher Scientific
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeJustin Johnson
 
Aug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansAug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansGenomeInABottle
 
Exploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencingExploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencingQIAGEN
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Sebastian Schmeier
 
Molecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics PipelineMolecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics PipelineCandy Smellie
 
Next generation sequencing methods
Next generation sequencing methods Next generation sequencing methods
Next generation sequencing methods Mrinal Vashisth
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisBastian Greshake
 
Introduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) TechnologyIntroduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) TechnologyQIAGEN
 

What's hot (20)

20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and Variants
 
Next-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologiesNext-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologies
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...
 
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can Know
 
A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...
 
QIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene Panels
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposal140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposal
 
Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
 
Aug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansAug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plans
 
Exploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencingExploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencing
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)
 
Molecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics PipelineMolecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics Pipeline
 
Next generation sequencing methods
Next generation sequencing methods Next generation sequencing methods
Next generation sequencing methods
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome Analysis
 
Introduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) TechnologyIntroduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) Technology
 
Ngs part i 2013
Ngs part i 2013Ngs part i 2013
Ngs part i 2013
 

Viewers also liked

Viewers also liked (11)

Facts About America’s Power Grid
Facts About America’s Power GridFacts About America’s Power Grid
Facts About America’s Power Grid
 
Biochain PCR Products
Biochain PCR ProductsBiochain PCR Products
Biochain PCR Products
 
De Turbo
De TurboDe Turbo
De Turbo
 
Nigerian objectsquiz
Nigerian objectsquizNigerian objectsquiz
Nigerian objectsquiz
 
Verslag van Deskundig Onderzoek
Verslag van Deskundig OnderzoekVerslag van Deskundig Onderzoek
Verslag van Deskundig Onderzoek
 
Eindwerk De Turbo UptoDate
Eindwerk De Turbo UptoDateEindwerk De Turbo UptoDate
Eindwerk De Turbo UptoDate
 
All About Workplace Electrical Safety
All About Workplace Electrical SafetyAll About Workplace Electrical Safety
All About Workplace Electrical Safety
 
Electrical Safety In The Workplace
Electrical Safety In The WorkplaceElectrical Safety In The Workplace
Electrical Safety In The Workplace
 
Top 5 Causes of Electrical Accidents
Top 5 Causes of Electrical AccidentsTop 5 Causes of Electrical Accidents
Top 5 Causes of Electrical Accidents
 
Electrical Power Distribution Systems Design
Electrical Power Distribution Systems DesignElectrical Power Distribution Systems Design
Electrical Power Distribution Systems Design
 
Doc1
Doc1Doc1
Doc1
 

Similar to Sample Preparation for Next Generation Sequencing

Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideQIAGEN
 
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-SeqNUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-SeqHimanshu Sethi
 
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllThe QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllQIAGEN
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochureAffymetrix
 
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...QIAGEN
 
Apac distributor training series 3 swift product for cancer study
Apac distributor training series 3  swift product for cancer studyApac distributor training series 3  swift product for cancer study
Apac distributor training series 3 swift product for cancer studySwift Biosciences
 
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...Merck Life Sciences
 
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...MilliporeSigma
 
2012 10-24 - ngs webinar
2012 10-24 - ngs webinar2012 10-24 - ngs webinar
2012 10-24 - ngs webinarElsa von Licy
 
Achieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 GenomeAchieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 GenomeCamille Cappello
 
ATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative BiogeneATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative BiogeneDonglin Bao
 
Sensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging SamplesSensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging SamplesQIAGEN
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleQIAGEN
 
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012sequencing_columbia
 

Similar to Sample Preparation for Next Generation Sequencing (20)

Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the Guide
 
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-SeqNUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
 
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllThe QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochure
 
Pcr array 2013
Pcr array 2013Pcr array 2013
Pcr array 2013
 
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
 
Mutation pp
Mutation ppMutation pp
Mutation pp
 
Apac distributor training series 3 swift product for cancer study
Apac distributor training series 3  swift product for cancer studyApac distributor training series 3  swift product for cancer study
Apac distributor training series 3 swift product for cancer study
 
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
 
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
 
Ffpe pcr array
Ffpe pcr arrayFfpe pcr array
Ffpe pcr array
 
2012 10-24 - ngs webinar
2012 10-24 - ngs webinar2012 10-24 - ngs webinar
2012 10-24 - ngs webinar
 
Achieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 GenomeAchieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 Genome
 
ATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative BiogeneATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative Biogene
 
Pcrarray
PcrarrayPcrarray
Pcrarray
 
Epigenetics 2013
Epigenetics 2013Epigenetics 2013
Epigenetics 2013
 
Sensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging SamplesSensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging Samples
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE Sample
 
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
 
Wnt part ii 2013
Wnt part ii 2013Wnt part ii 2013
Wnt part ii 2013
 

More from biochain

Biochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNABiochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNAbiochain
 
Biochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-basedBiochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-basedbiochain
 
Biochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and PanelsBiochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and Panelsbiochain
 
Biochain RNA Research Tools
Biochain RNA Research ToolsBiochain RNA Research Tools
Biochain RNA Research Toolsbiochain
 
Biochain DNA Isolation Kits
Biochain DNA Isolation KitsBiochain DNA Isolation Kits
Biochain DNA Isolation Kitsbiochain
 
Biochain Cancer Tissue Array
Biochain Cancer Tissue ArrayBiochain Cancer Tissue Array
Biochain Cancer Tissue Arraybiochain
 

More from biochain (6)

Biochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNABiochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNA
 
Biochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-basedBiochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-based
 
Biochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and PanelsBiochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and Panels
 
Biochain RNA Research Tools
Biochain RNA Research ToolsBiochain RNA Research Tools
Biochain RNA Research Tools
 
Biochain DNA Isolation Kits
Biochain DNA Isolation KitsBiochain DNA Isolation Kits
Biochain DNA Isolation Kits
 
Biochain Cancer Tissue Array
Biochain Cancer Tissue ArrayBiochain Cancer Tissue Array
Biochain Cancer Tissue Array
 

Recently uploaded

Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...jageshsingh5554
 
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Dipal Arora
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...parulsinha
 
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Dipal Arora
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...astropune
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...narwatsonia7
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomdiscovermytutordmt
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...narwatsonia7
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...hotbabesbook
 
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Genuine Call Girls
 
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...aartirawatdelhi
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋TANUJA PANDEY
 
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...chandars293
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...narwatsonia7
 

Recently uploaded (20)

Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
 
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
 
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
 
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
 
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
 
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...Top Rated  Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 6297143586 ⟟ Call Me For Genuine ...
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 9332606886  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 9332606886 Meetin With Bangalore Esc...
 

Sample Preparation for Next Generation Sequencing

  • 1. Sample Preparation for Diagnostics & Life Science A G C T
  • 3. CancerSeq-Characterized Cancer FFPE tissue samples by Next Generation Sequencing (NGS) Sample and Services for Next Generation Sequencing Cancer Gene Panel-NGS Testing Service RapidSeq-Directonal mRNA Sample Prep Kit for NGS RapidSeq-Small RNA Sample Prep Kit for NGS Sample Preparation for Diagnostics & Life Science www.biochain.com 1-888-762-2568 (Main) order@biochain.com (Order)
  • 4. BioChain’s CancerSeq™ genetically characterized FFPE blocks give you and your data more power Blocks and Slides available for: - Breast Cancers - Colon Cancers - Lung Cancers - Melanomas - Other Cancers (via request)* Cancer Gene Panel Includes: The Illumina TruSeq® Amplicon - Cancer Panel (TSACP) to characterize 48 cancer genes, including BRAF, KRAS, EGFR, ALK, and Tp53. Features - Tissue from a wide variety of sources, Whole FFPE blocks, slides, and DNA - Suitable for immunohistochemistry, in situ hybridization assays, and molecular applications ABL1 ERBB4 JAK2 PIK3CA AKT1 FBXW7 JAK3 PTEN ALK FGFR1 KDR PTPN11 APC FGFR2 KIT RB1 ATM FGFR3 KRAS RET BRAF FLT3 MET SMAD4 CDH1 GNA11 MLH1 SMARCB1 CDKN2A GNAQ MPL SMO CSF1R GNAS NOTCH1 SRC CTNNB1 HNF1A NPM1 STK11 EGFR HRAS NRAS TP53 ERBB2 IDH1 PDGFRA VHL CATALOG # PRODUCT NAME SIZE T2235086-SB CancerSeq™ Paraffin Tissue Tumor Block: Breast 1 Block T2235090-SB CancerSeq™ Paraffin Tissue Tumor Block: Colon 1 Block T2235152-SB CancerSeq™ Paraffin Tissue Tumor Block: Lung 1 Block T2235218A-SB CancerSeq™ Paraffin Tissue Tumor Block: Skin Melanoma 1 Block - Make sense out of ambiguous IHC results by knowing the genetics - Buy just the blocks with the right genetic background - Search our databases for blocks with novel mutations - Take advantage of NGS without expensive infrastructure
  • 5. NGS Samples and Services As a provider of tissues and nucleic acids derived from them, BioChain is uniquely positioned to extract DNA and RNA from the most challenging tissues, and perform re-sequencing and RNAseq. Tissues: We have over 300,000 Frozen and FFPE blocks to collect DNA and RNA from. You may also contract with us to procure rare materials for your sequencing project. Extraction: We have provided high quality DNA and RNA from the most challenging tissues including FFPE blocks, cartilage, and brain for over 15 years. Library preparation: We are Experienced with all Illumina library preparation kits as well as our proprietary RapidSeqTM small RNA library prep kit. Illumina MiSeq NGS: With special expertise in RNAseq and resequencing with Trueseq Custom and Cancer Amplicon panels, we handle a wide variety of sequencing projects. Data analysis and consultation: We can help with experimental design through variant calling and anno- tation.
  • 6. Cancer Driver Gene Panel NGS Testing Service One - Step Shop Cancer Sequencing Test Services from Beginning to End NGS Leading Platform - - Greater than 35 kb of cancer consensus targets including BRAF, KRAS & EGFR - 212 amplicons in one tube; 48 genes Unrivaled Multiplexing - Up to 96 sample pooling on MiSeq - >90% specificity and uniformity - Detect low frequency variants (<5%) Unparalleled Workflow - FFPE-enabled with sample QC Kit - Automated paired end sequencing with MiSeq Industry Standard Delivery - Cost-effective solution - Quick turn-around time ABL1 EGFR GNAS MLH1 RET AKT1 ERBB2 HNF1A MPL SMAD4 ALK ERBB4 HRAS NOTCH1 SMARCB1 APC FBXW7 IDH1 NPM1 SMO ATM FGFR1 JAK2 NRAS SRC BRAF FGFR2 JAK3 PDGFRA STK11 CDH1 FGFR3 KDR PIK3CA TP53 CDKN2A FLT3 KIT PTEN VHL CSF1R GNA11 KRAS PTPN11 CTNNB1 GNAQ MET RB1 48 Cancer Biomarker AATTCCGGCCGATCAGGGG TTTACACCAATGGGACCATTAC CCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGG AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACC CAAAGGCC TTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGAATTCCGGCCGATCAGGGGTTTACACCAAT GGTTTACACCAATGGGACCATTACCAAC
  • 7. Directional mRNA Sample Prep Kit Sample Prep System for mRNA Sequencing Features • Low RNA Input Requires as little as 50 ng of total RNA input • Directional Increased useful number of reads • < 1 Hour Hands-on Time Streamlined workflow Library construction in < 7 hours • All-in-One Kit Includes all necessary enzymes and plastics • FFPE RNA Compatible High Quality Libraries without Artifacts or Contaminations Bioanalyzer Trace of Constructed Library of mRNA from corn Description The RapidSeq Directional mRNA Sample Prep kit provides strand-specific cDNA synthesis with reduced costs and increased sensitivity. Directionality Assessment Comparison with TruSeq in Prokaryotic Cells mRNA Input (ng) Sample Type % Sense 100 (Competitor I Kit) FFPEmRNA (1 year) 97.85% 100 (RapidSeq Kit) FFPEmRNA (1 year) 97.88% 500 (Competitor I Kit) FFPEmRNA (10 years) 97.59% 500 (RapidSeq Kit) FFPEmRNA (10 years) 97.57% Parameter TruSeq RapidSeq Coverage Rate 44.00% 65.00% rRNA Contamination with 23s, 16s, and 5s removal 2.70% 1.50% tRNA contamination 64.00% 57.00% Unknown sequence percentage 5.00% <1% Directional Percentage 74% 77.50% Average Quality Score (range from 0 to 40, with 40 being the highest quality) 26 37 CATALOG # PRODUCT NAME KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner KS073012 I-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligners 1-48 K2012008 MagSeq mRNA Purification Kit AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGAC AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGACCCATTTAGAACAG
  • 8. Small RNA Sample Prep Kit Everything you need in one box Applications • Small RNA discovery and quantification • miRNA expression profiling • miRNA related functional assessments Description The RapidSeq Small RNA Sample Prep Kit is a cost effective and reliable solution for small RNA library preparation using Illumina’s sequencing platform. Our reagents are master mixed for optimal performance and simple experiment setup, which minimizes human error. RapidSeq can be used for a variety of studies involving small RNA libraries. Construct Pure Libraries with no Artifacts or Contamination Bioanalyzer Trace of FFPE microRNA Library Highly Consistent and Reproducible Results Normalized R2 Plot of miRNA counts from Two Replicate Libraries CATALOG # PRODUCT NAME KS071012-I RapidSeq Small RNA Sample Prep Kit - With Aligner 1-12 KS071012-II RapidSeq Small RNA Sample Prep Kit - With Aligner 13-24 KS071012-III RapidSeq Small RNA Sample Prep Kit - With Aligner 25-36 KS071012-IV RapidSeq Small RNA Sample Prep Kit - With Aligner 37-48 Save time Less than 1 hour hands-on (7 hours with incubations). Avoid purchasing headaches Includes all necessary enzymes and plastics. Don’t worry about RNA quantity Good results with as little as 1 ng or as much as 10 µg of total RNA. Have FFPE RNA? No problem! FFPE RNA compatible
  • 9. NGS Related Products T2235086-SB CancerSeq Parafin Tissue Tumor Block: Breast 1 Block T2235090-SB CancerSeq Parafin Tissue Tumor Block: Colon 1 Block T2235152-SB CancerSeq Parafin Tissue Tumor Block: Lung 1 Block T2235218A-SB CancerSeq Parafin Tissue Tumor Block: Skin Melanoma 1 Block KS073012-I RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit KS073012-II RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit KS073012-III RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit KS073012-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner 1 Kit KS073012-T RapidSeq High Yield Directional mRNA Sample Prep Kit, Trial version enough for 2 rxn. Customer select aligners 1 Kit KS074012-I RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit KS074012-II RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit KS074012-III RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit KS074012-IV RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit KS074012 RapidSeq High Yield Small RNA Sample Prep Kit - Without Aligners 1 Kit KS074012-T RapidSeq High Yield Small RNA Sample Prep Kit, Trial version enough for 2 rxn. Customer select aligners 1 Kit KS075012-I RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit KS075012-II RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit KS075012-III RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit KS075012-IV RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit KS075012 RapidSeq Mastermix Directional mRNA Sample Prep Kit - Without Aligners 1 kit KS071012-I RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit KS071012-II RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit KS071012-III RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit KS071012-IV RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit KS071012 RapidSeq MasterMix Small RNA Sample Prep Kit - Without Aligner 1 Kit CATALOG # DESCRIPTION UNITS
  • 10. Other Related Products D1B34999-G02 Control Genomic DNA - Bovine Female 100 µg D1B34999-G01 Control Genomic DNA - Bovine Male 100 µg D1C34999-G02 Control Genomic DNA - Chicken Female 100 µg D1C34999-G01 Control Genomic DNA - Chicken Male 100 µg D1534999-Cy-G02 Control Genomic DNA - Cynomolgus Monkey Female 100 µg D1534999-Cy-G01 Control Genomic DNA - Cynomolgus Monkey Male 100 µg D1734999-G02 Control Genomic DNA - Dog Female 100 µg D1734999-G01 Control Genomic DNA - Dog Male 100 µg D1G34999-G02 Control Genomic DNA - Guinea Pig Female 100 µg D1G34999-G01 Control Genomic DNA - Guinea Pig Male 100 µg D1H34999-G02 Control Genomic DNA - Hamster Female 100 µg D1H34999-G01 Control Genomic DNA - Hamster Male 100 µg D1234999-G02 Control Genomic DNA - Human Female 100 µg D1234999-G01 Control Genomic DNA - Human Male 100 µg D1334999-G02 Control Genomic DNA - Mouse Female 100 µg D1334999-G01 Control Genomic DNA - Mouse Male 100 µg D1934999-G02 Control Genomic DNA - Porcine Female 100 µg D1934999-G01 Control Genomic DNA - Porcine Male 100 µg D1834999-G02 Control Genomic DNA - Rabbit Female 100 µg D1834999-G01 Control Genomic DNA - Rabbit Male 100 µg D1434999-G02 Control Genomic DNA - Rat Female 100 µg D1434999-G01 Control Genomic DNA - Rat Male 100 µg D1534999-G02 Control Genomic DNA - Rhesus Monkey Female 100 µg D1534999-G01 Control Genomic DNA - Rhesus Monkey Male 100 µg R1234010-50 Total RNA - Human Adult Normal Tissue: Bladder 50 µg R1234035-50 Total RNA - Human Adult Normal Tissue: Brain 50 µg R1234086-50 Total RNA - Human Adult Normal Tissue: Breast 50 µg R1234090-50 Total RNA - Human Adult Normal Tissue: Colon 50 µg R1234090-P Total RNA - Human Adult Normal Tissue 5 Donor Pool: Colon 50 µg R1234122-50 Total RNA - Human Adult Normal Tissue: Heart 50 µg R1234142-50 Total RNA - Human Adult Normal Tissue: Kidney 50 µg R1235010-10 Total RNA - Human Tumor Tissue: Bladder 10 µg R1235023-10 Total RNA - Human Tumor Tissue: Bone 10 µg R1235086-50 Total RNA - Human Tumor Tissue: Breast 50 µg R1235090-50 Total RNA - Human Tumor Tissue: Colon 50 µg R1235142-50 Total RNA - Human Tumor Tissue: Kidney 50 µg R1235149-50 Total RNA - Human Tumor Tissue: Liver 50 µg Control Genomic DNA Total RNA
  • 11.
  • 12. Sample Preparation for Diagnostics & Life Science www.biochain.com 1-888-762-2568 (Main) order@biochain.com (Order)