Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Bioinformatica e genomica comparata: nuove strategie
sperimentali e computazionali per la produzione e
analisi di dati NGS...
Several NGS platforms are now available on the market, which are progressively


-­‐  Roche	
  (assembled	...

-­‐  256	
-­‐  >	
-­‐  Paired	...




Upcoming SlideShare
Loading in …5

Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimen


Published on

Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimentare.

Published in: Health & Medicine, Technology
  • Be the first to comment

  • Be the first to like this

Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimen

  1. 1. Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimentare. Ernesto Picardi University of Bari IBBE-CNR   BiP-­‐Day  5/12/2013  
  2. 2. Next-­‐Genera*on  Sequencing     Several NGS platforms are now available on the market, which are progressively improved in term of throughput and cost- and time-efficiency. Ion Proton   Roche / 454 Genome Sequencer FLX titanium (800 bp, 800 Mb / run) PacBio   Illumina / Solexa Genetic Analyzer HiSeq 2000 (150x2 bp, 600 Gb / run) Applied Biosystems SOLiD 4 SystemTM (100x2 bp, 400 Gb / run)
  3. 3. Worldwide  distribu*on  of  NGS  pla;orms   >2558  total  machines  (>1000    US,  >300    China,  ..,  >50  Italy)   Source:  
  4. 4. Our  first  experience   RNA-­‐Seq  reads:   -­‐  Roche  454  (GS-­‐20):  >120000  conBgs  (assembled  reads  from  4  Bssues)   -­‐  Illumina/Solexa:  >  200  M  reads  (from  2  Bssues)   -­‐  SOLiD  :  >  320  M  reads  (from  4  Bssues)   Jaillon  et  al.  2007  Nature    
  5. 5. Available  compu*ng  facili*es  at  UNIBA/IBBE-­‐CNR   HP  Proliant  Server   -­‐  256  GB  RAM   -­‐  40  cores   -­‐  2  RAIDs  (24  +  36  TB)   HP  Proliant  Server   -­‐  2  TB  RAM   -­‐  80  cores   -­‐  2  RAIDs  (36  +  48  TB)   -­‐  4  GPUs   Tape  library   3  Xserve  Apple   -­‐  16x3  GB  RAM   -­‐  RAID  3  TB     External   Partners  
  6. 6. Available  NGS  pla;orms  at  UNIBA/IBBE   Illumina  MiSeq   -­‐  >  50  M  reads/run   -­‐  Paired  2x300   •  DNA sequencing (DNA-Seq) -­‐   genome  resequencing  (SNPs,  CNV,  GWAS)   -­‐   de  novo  sequencing     -­‐   idenBficaBon  of  genome  structural  variants    (cancer  genome)   -­‐   Epigenomics  (chromaBn  state  and  genome  methylaBon)   -­‐   Metagenomics  (Microbiota  analysis  of  clinical  /environmental  samples)     •  RNA sequencing (RNA-Seq) -­‐   QualitaBve  and  quanBtaBve  analysis  of  the  Transcriptome     -­‐   IdenBficaBon  and  characterizaBon  of  miRNAs  and  other  ncRNAs     -­‐  RNA  ediBng   -­‐   Metatrancriptomics  (funcBonal  analysis  of  environmental  samples)   Illumina  HiSeq1500   -­‐  >  300  GB/run   -­‐  Paired  2x100    
  7. 7. DNA  sequencing:  variant  analysis   ProducBon  of  DNA-­‐Seq  reads  for  the  idenBficaBon  of  SNPs  or  Indels  in  normal  and/or   pathological  condiBons,  and  development  of  dedicated  socware.   QC  (quality  control)     Align  to  reference   genome   Variant  (SNP  &   INDEL)  calling     Epstein-­‐Barr  genotyping   In  mulBple  sclerosis   (30  samples  –  0.2  M  reads/sample  )   A  “family  trio”  for  variants  linked   to  the  Majewski  syndrome  –  like   disease  (>260  M  reads  Illumina)   Variant  annotation   Functional  validation   Somatic  mutations  in  human   tissues  (3  donors/  6  tissues)    (18  WXSs  >  1080  M  reads  Illumina)  
  8. 8. DNA  sequencing:  de  novo  sequencing   Using  the  Illumina  MiSeq  plaform  we  have  sequenced  >20  full  prokaryoBc  genomes   generaBng  on  average  2  M  reads  per  sample.     Illumina  MiSeq  Reads   In  collaboraBon  with:   -­‐  Doh.  Parisi  (IsBtuto  ZooprofillaBco)   -­‐  Prof.  Palmieri  (UNIBA-­‐IBBE)   -­‐  Doh.  Ceci  (IBBE)   -­‐  Prof.  Golyshin  (Bangor  Univ.  UK)   Read  Assembling     ConBgs  
  9. 9. DNA  sequencing:  sequencing  of  mtDNA   Assembly  of  full  mtDNAs  in  human  by  WXS  and  WGS  experiments.      In  collaboraBon  with:   Prof.  Akmonelli   Picardi  and  Pesole  2012  Nature  Methods    
  10. 10. DNA  sequencing:  metagenomics   Deep   sequencing   of   environmental   samples   to   funcBonally   characterize   the   biodiversity   (no  need  for  laboratory  culBvaBon  and/or  isolaBon  of  individual  specimens).     BioMaS   (BioinformaBc  analysis  of  Metagenomic  ampliconS)   hhp://     Raw  Data   Merged  and  Denoised   Sequences   Dereplicated   Sequences   DB  matching   TANGO   Specimen   assessment   In  collaboraBon  with:   Prof.  Valiente  (Catalogna  Univ.)     CorrelaBon  between  Invasive   Species  and  the  microbial   composiBon  (>  15  M  reads)   Microbiota  variaBon  in   colorectal  cancer   (>  125  M  reads)   Development  of     BioinformaBc  tools   MICROMAP
  11. 11. RNA  sequencing:  RNA-­‐Seq  analysis   Development  of  dedicated  computaBonal  tools  to  automate  the  analysis  of  RNA-­‐Seq   samples.   Transcriptome  variaBons   in  6  ALS  samples     (>120  M  reads  Illumina/sample)   Transcriptome  variaBons   in  6  human  Bssues     (>150  M  reads  Illumina/sample)   Transcriptome  variaBons   in  Alzheimer  disease  (15  samples)   (>150  M  reads  Illumina/sample)  
  12. 12. RNA  sequencing:  miRNA-­‐Seq  analysis   ProducBon  of  miRNA-­‐Seq  data  and  development  of  ad  hoc  tools  to  analyse  reads  in   mulBple  experimental  condiBons.   miRNA  expression  in   6  ALS  samples     (>5  M  reads  Illumina/sample)   miRNA  expression   in  6  human  Bssues     (>5  M  reads  Illumina/sample)   miRNA  expression  in    aging  and  Alzheimer  disease   (15  samples)  (>3  M  reads  sample)   Dr  David  Horner  
  13. 13. RNA  sequencing:  RNA  edi*ng   Development  of  the  first  toolkit  to  detect  RNA  ediBng  by  massive  sequencing  data   (RNA-­‐Seq,  DNA-­‐Seq  and  miRNA-­‐Seq).   Picardi and Pesole 2013 Bioinformatics r1 r2 r3 r4 r5 r1 r2 r3 r4 r5 GGGTGCCTTTATGCAGCAAGGATGCGATATT! GGGTGTCTTTATGCAGCAAGGATGCGATACTTCGC! GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG! ..............A.....................! TGGGTGCCTTTATGCAGCAAGGATGCGATATTTCGCC gDNA! ..............G.....................! GGGTGCCTTTATGCGGCAAGGATGCGATATT! GGGTGTCTTTATGCAGCAAGGATGCGATACTTCGC! GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG! RNA  ediBng  in  ALS   (RNA-­‐Seq:  >120  M  reads/sample   WXS:  >  30  M  reads/sample)   RNA  ediBng  in  human  Bssues   (RNA-­‐Seq:  >120  M  reads/sample   WGS:  >  300  M  reads/sample)   RNA  ediBng  in  Alzheimer  disease   Fluidigm  tech.  and  Illumina  Seq.   (>2000x  per  ediBng  candidate)   Italy – Israel Actions
  14. 14. Other  NGS-­‐related  experiences   -­‐  Gene  expression  in  collaboraBon   with  Prof.  Giorgino  (UNIBA)   -­‐  Gene/exon  expression  in  renal   carcinoma   OMNIA  LH75   Automated  qPCR  for   validaBon  of  molecular   biomarkers  
  15. 15. Acknowledgments     PRIN2009   PRIN2010   PRIN2013   MICROMAP CNR-­‐Aging  program Italy – Israel Actions
