BioChain Next Generation Sequencing Products


Published on

Introducing Biochain Next Generation Sequencing Products

Published in: Health & Medicine, Technology
  • Be the first to comment

  • Be the first to like this

BioChain Next Generation Sequencing Products

  1. 1. Sample Preparation for Diagnostics & Life Science A G C T
  2. 2. Next Generation Sequencing Products
  3. 3. CancerSeq-Characterized Cancer FFPE tissue samples by Next Generation Sequencing (NGS) Sample and Services for Next Generation Sequencing Cancer Gene Panel-NGS Testing Service RapidSeq-Directonal mRNA Sample Prep Kit for NGS RapidSeq-Small RNA Sample Prep Kit for NGS Sample Preparation for Diagnostics & Life Science 1-888-762-2568 (Main) (Order)
  4. 4. BioChain’s CancerSeq™ genetically characterized FFPE blocks give you and your data more power Blocks and Slides available for: - Breast Cancers - Colon Cancers - Lung Cancers - Melanomas - Other Cancers (via request)* Cancer Gene Panel Includes: The Illumina TruSeq® Amplicon - Cancer Panel (TSACP) to characterize 48 cancer genes, including BRAF, KRAS, EGFR, ALK, and Tp53. Features - Tissue from a wide variety of sources, Whole FFPE blocks, slides, and DNA - Suitable for immunohistochemistry, in situ hybridization assays, and molecular applications ABL1 ERBB4 JAK2 PIK3CA AKT1 FBXW7 JAK3 PTEN ALK FGFR1 KDR PTPN11 APC FGFR2 KIT RB1 ATM FGFR3 KRAS RET BRAF FLT3 MET SMAD4 CDH1 GNA11 MLH1 SMARCB1 CDKN2A GNAQ MPL SMO CSF1R GNAS NOTCH1 SRC CTNNB1 HNF1A NPM1 STK11 EGFR HRAS NRAS TP53 ERBB2 IDH1 PDGFRA VHL CATALOG # PRODUCT NAME SIZE T2235086-SB CancerSeq™ Paraffin Tissue Tumor Block: Breast 1 Block T2235090-SB CancerSeq™ Paraffin Tissue Tumor Block: Colon 1 Block T2235152-SB CancerSeq™ Paraffin Tissue Tumor Block: Lung 1 Block T2235218A-SB CancerSeq™ Paraffin Tissue Tumor Block: Skin Melanoma 1 Block - Make sense out of ambiguous IHC results by knowing the genetics - Buy just the blocks with the right genetic background - Search our databases for blocks with novel mutations - Take advantage of NGS without expensive infrastructure
  5. 5. NGS Samples and Services As a provider of tissues and nucleic acids derived from them, BioChain is uniquely positioned to extract DNA and RNA from the most challenging tissues, and perform re-sequencing and RNAseq. Tissues: We have over 300,000 Frozen and FFPE blocks to collect DNA and RNA from. You may also contract with us to procure rare materials for your sequencing project. Extraction: We have provided high quality DNA and RNA from the most challenging tissues including FFPE blocks, cartilage, and brain for over 15 years. Library preparation: We are Experienced with all Illumina library preparation kits as well as our proprietary RapidSeqTM small RNA library prep kit. Illumina MiSeq NGS: With special expertise in RNAseq and resequencing with Trueseq Custom and Cancer Amplicon panels, we handle a wide variety of sequencing projects. Data analysis and consultation: We can help with experimental design through variant calling and anno- tation.
  6. 6. Cancer Driver Gene Panel NGS Testing Service One - Step Shop Cancer Sequencing Test Services from Beginning to End NGS Leading Platform - - Greater than 35 kb of cancer consensus targets including BRAF, KRAS & EGFR - 212 amplicons in one tube; 48 genes Unrivaled Multiplexing - Up to 96 sample pooling on MiSeq - >90% specificity and uniformity - Detect low frequency variants (<5%) Unparalleled Workflow - FFPE-enabled with sample QC Kit - Automated paired end sequencing with MiSeq Industry Standard Delivery - Cost-effective solution - Quick turn-around time ABL1 EGFR GNAS MLH1 RET AKT1 ERBB2 HNF1A MPL SMAD4 ALK ERBB4 HRAS NOTCH1 SMARCB1 APC FBXW7 IDH1 NPM1 SMO ATM FGFR1 JAK2 NRAS SRC BRAF FGFR2 JAK3 PDGFRA STK11 CDH1 FGFR3 KDR PIK3CA TP53 CDKN2A FLT3 KIT PTEN VHL CSF1R GNA11 KRAS PTPN11 CTNNB1 GNAQ MET RB1 48 Cancer Biomarker AATTCCGGCCGATCAGGGG TTTACACCAATGGGACCATTAC CCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGG AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACC CAAAGGCC TTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGAATTCCGGCCGATCAGGGGTTTACACCAAT GGTTTACACCAATGGGACCATTACCAAC
  7. 7. Directional mRNA Sample Prep Kit Sample Prep System for mRNA Sequencing Features • Low RNA Input Requires as little as 50 ng of total RNA input • Directional Increased useful number of reads • < 1 Hour Hands-on Time Streamlined workflow Library construction in < 7 hours • All-in-One Kit Includes all necessary enzymes and plastics • FFPE RNA Compatible High Quality Libraries without Artifacts or Contaminations Bioanalyzer Trace of Constructed Library of mRNA from corn Description The RapidSeq Directional mRNA Sample Prep kit provides strand-specific cDNA synthesis with reduced costs and increased sensitivity. Directionality Assessment Comparison with TruSeq in Prokaryotic Cells mRNA Input (ng) Sample Type % Sense 100 (Competitor I Kit) FFPEmRNA (1 year) 97.85% 100 (RapidSeq Kit) FFPEmRNA (1 year) 97.88% 500 (Competitor I Kit) FFPEmRNA (10 years) 97.59% 500 (RapidSeq Kit) FFPEmRNA (10 years) 97.57% Parameter TruSeq RapidSeq Coverage Rate 44.00% 65.00% rRNA Contamination with 23s, 16s, and 5s removal 2.70% 1.50% tRNA contamination 64.00% 57.00% Unknown sequence percentage 5.00% <1% Directional Percentage 74% 77.50% Average Quality Score (range from 0 to 40, with 40 being the highest quality) 26 37 CATALOG # PRODUCT NAME KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner KS073012 I-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligners 1-48 K2012008 MagSeq mRNA Purification Kit AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGAC AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGACCCATTTAGAACAG
  8. 8. Small RNA Sample Prep Kit Everything you need in one box Applications • Small RNA discovery and quantification • miRNA expression profiling • miRNA related functional assessments Description The RapidSeq Small RNA Sample Prep Kit is a cost effective and reliable solution for small RNA library preparation using Illumina’s sequencing platform. Our reagents are master mixed for optimal performance and simple experiment setup, which minimizes human error. RapidSeq can be used for a variety of studies involving small RNA libraries. Construct Pure Libraries with no Artifacts or Contamination Bioanalyzer Trace of FFPE microRNA Library Highly Consistent and Reproducible Results Normalized R2 Plot of miRNA counts from Two Replicate Libraries CATALOG # PRODUCT NAME KS071012-I RapidSeq Small RNA Sample Prep Kit - With Aligner 1-12 KS071012-II RapidSeq Small RNA Sample Prep Kit - With Aligner 13-24 KS071012-III RapidSeq Small RNA Sample Prep Kit - With Aligner 25-36 KS071012-IV RapidSeq Small RNA Sample Prep Kit - With Aligner 37-48 Save time Less than 1 hour hands-on (7 hours with incubations). Avoid purchasing headaches Includes all necessary enzymes and plastics. Don’t worry about RNA quantity Good results with as little as 1 ng or as much as 10 µg of total RNA. Have FFPE RNA? No problem! FFPE RNA compatible
  9. 9. NGS Related Products T2235086-SB CancerSeq Parafin Tissue Tumor Block: Breast 1 Block T2235090-SB CancerSeq Parafin Tissue Tumor Block: Colon 1 Block T2235152-SB CancerSeq Parafin Tissue Tumor Block: Lung 1 Block T2235218A-SB CancerSeq Parafin Tissue Tumor Block: Skin Melanoma 1 Block KS073012-I RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit KS073012-II RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit KS073012-III RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit KS073012-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner 1 Kit KS073012-T RapidSeq High Yield Directional mRNA Sample Prep Kit, Trial version enough for 2 rxn. Customer select aligners 1 Kit KS074012-I RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit KS074012-II RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit KS074012-III RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit KS074012-IV RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit KS074012 RapidSeq High Yield Small RNA Sample Prep Kit - Without Aligners 1 Kit KS074012-T RapidSeq High Yield Small RNA Sample Prep Kit, Trial version enough for 2 rxn. Customer select aligners 1 Kit KS075012-I RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit KS075012-II RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit KS075012-III RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit KS075012-IV RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit KS075012 RapidSeq Mastermix Directional mRNA Sample Prep Kit - Without Aligners 1 kit KS071012-I RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit KS071012-II RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit KS071012-III RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit KS071012-IV RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit KS071012 RapidSeq MasterMix Small RNA Sample Prep Kit - Without Aligner 1 Kit CATALOG # DESCRIPTION UNITS
  10. 10. Other Related Products D1B34999-G02 Control Genomic DNA - Bovine Female 100 µg D1B34999-G01 Control Genomic DNA - Bovine Male 100 µg D1C34999-G02 Control Genomic DNA - Chicken Female 100 µg D1C34999-G01 Control Genomic DNA - Chicken Male 100 µg D1534999-Cy-G02 Control Genomic DNA - Cynomolgus Monkey Female 100 µg D1534999-Cy-G01 Control Genomic DNA - Cynomolgus Monkey Male 100 µg D1734999-G02 Control Genomic DNA - Dog Female 100 µg D1734999-G01 Control Genomic DNA - Dog Male 100 µg D1G34999-G02 Control Genomic DNA - Guinea Pig Female 100 µg D1G34999-G01 Control Genomic DNA - Guinea Pig Male 100 µg D1H34999-G02 Control Genomic DNA - Hamster Female 100 µg D1H34999-G01 Control Genomic DNA - Hamster Male 100 µg D1234999-G02 Control Genomic DNA - Human Female 100 µg D1234999-G01 Control Genomic DNA - Human Male 100 µg D1334999-G02 Control Genomic DNA - Mouse Female 100 µg D1334999-G01 Control Genomic DNA - Mouse Male 100 µg D1934999-G02 Control Genomic DNA - Porcine Female 100 µg D1934999-G01 Control Genomic DNA - Porcine Male 100 µg D1834999-G02 Control Genomic DNA - Rabbit Female 100 µg D1834999-G01 Control Genomic DNA - Rabbit Male 100 µg D1434999-G02 Control Genomic DNA - Rat Female 100 µg D1434999-G01 Control Genomic DNA - Rat Male 100 µg D1534999-G02 Control Genomic DNA - Rhesus Monkey Female 100 µg D1534999-G01 Control Genomic DNA - Rhesus Monkey Male 100 µg R1234010-50 Total RNA - Human Adult Normal Tissue: Bladder 50 µg R1234035-50 Total RNA - Human Adult Normal Tissue: Brain 50 µg R1234086-50 Total RNA - Human Adult Normal Tissue: Breast 50 µg R1234090-50 Total RNA - Human Adult Normal Tissue: Colon 50 µg R1234090-P Total RNA - Human Adult Normal Tissue 5 Donor Pool: Colon 50 µg R1234122-50 Total RNA - Human Adult Normal Tissue: Heart 50 µg R1234142-50 Total RNA - Human Adult Normal Tissue: Kidney 50 µg R1235010-10 Total RNA - Human Tumor Tissue: Bladder 10 µg R1235023-10 Total RNA - Human Tumor Tissue: Bone 10 µg R1235086-50 Total RNA - Human Tumor Tissue: Breast 50 µg R1235090-50 Total RNA - Human Tumor Tissue: Colon 50 µg R1235142-50 Total RNA - Human Tumor Tissue: Kidney 50 µg R1235149-50 Total RNA - Human Tumor Tissue: Liver 50 µg Control Genomic DNA Total RNA
  11. 11. Sample Preparation for Diagnostics & Life Science 1-888-762-2568 (Main) (Order)
