SlideShare a Scribd company logo

Transcript editing (Eukaryotes) 12- In this transcript's sequence- the.pdf

•
•
A
Adam7scPullmanq

Transcript editing (Eukaryotes) 12. In this transcript's sequence, the introns have been identified and underlined. Write the edited transcript and the translation 5 augggagguggcgaggaagaugacgugguaguugucgcggcagcugccaggagaaguagcaagaa a 3 Transcript with introns removed and translated: 3 5 AA seq:.

Education
1 of 1
Download to read offline
Transcript editing (Eukaryotes) 12. In this transcript's sequence, the introns have been identified and underlined. Write the edited transcript and the translation 5 augggagguggcgaggaagaugacgugguaguugucgcggcagcugccaggagaaguagcaagaa a 3 Transcript with introns removed and translated: 3 5 AA seq:

Recommended

USING JAVA- Implement a simple e-mail messaging system- A message has.pdf
USING JAVA- Implement a simple e-mail messaging system- A message has.pdfUSING JAVA- Implement a simple e-mail messaging system- A message has.pdf
USING JAVA- Implement a simple e-mail messaging system- A message has.pdfAdam7scPullmanq
 
using c# 5-0 Create a program that tracks UFO sightings for a work wee.pdf
using c# 5-0 Create a program that tracks UFO sightings for a work wee.pdfusing c# 5-0 Create a program that tracks UFO sightings for a work wee.pdf
using c# 5-0 Create a program that tracks UFO sightings for a work wee.pdfAdam7scPullmanq
 
Using arduino to control 7-segment display with 7-segment decoder- A p.pdf
Using arduino to control 7-segment display with 7-segment decoder- A p.pdfUsing arduino to control 7-segment display with 7-segment decoder- A p.pdf
Using arduino to control 7-segment display with 7-segment decoder- A p.pdfAdam7scPullmanq
 
Useful Life 1- Costs that are expensed in the period incurred- Depreci.pdf
Useful Life 1- Costs that are expensed in the period incurred- Depreci.pdfUseful Life 1- Costs that are expensed in the period incurred- Depreci.pdf
Useful Life 1- Costs that are expensed in the period incurred- Depreci.pdfAdam7scPullmanq
 
Use the source code below and change the part that will display the ag.pdf
Use the source code below and change the part that will display the ag.pdfUse the source code below and change the part that will display the ag.pdf
Use the source code below and change the part that will display the ag.pdfAdam7scPullmanq
 
Use the PESTLE tool to identify current- strategically relevant factor.pdf
Use the PESTLE tool to identify current- strategically relevant factor.pdfUse the PESTLE tool to identify current- strategically relevant factor.pdf
Use the PESTLE tool to identify current- strategically relevant factor.pdfAdam7scPullmanq
 
Use the links to explore Generation Z and then discuss how quickly you.pdf
Use the links to explore Generation Z and then discuss how quickly you.pdfUse the links to explore Generation Z and then discuss how quickly you.pdf
Use the links to explore Generation Z and then discuss how quickly you.pdfAdam7scPullmanq
 
Use the following information for the Quick Studies below- (Algo) -The.pdf
Use the following information for the Quick Studies below- (Algo) -The.pdfUse the following information for the Quick Studies below- (Algo) -The.pdf
Use the following information for the Quick Studies below- (Algo) -The.pdfAdam7scPullmanq
 

Recommended

USING JAVA- Implement a simple e-mail messaging system- A message has.pdf
USING JAVA- Implement a simple e-mail messaging system- A message has.pdfUSING JAVA- Implement a simple e-mail messaging system- A message has.pdf
USING JAVA- Implement a simple e-mail messaging system- A message has.pdfAdam7scPullmanq
 
using c# 5-0 Create a program that tracks UFO sightings for a work wee.pdf
using c# 5-0 Create a program that tracks UFO sightings for a work wee.pdfusing c# 5-0 Create a program that tracks UFO sightings for a work wee.pdf
using c# 5-0 Create a program that tracks UFO sightings for a work wee.pdfAdam7scPullmanq
 
Using arduino to control 7-segment display with 7-segment decoder- A p.pdf
Using arduino to control 7-segment display with 7-segment decoder- A p.pdfUsing arduino to control 7-segment display with 7-segment decoder- A p.pdf
Using arduino to control 7-segment display with 7-segment decoder- A p.pdfAdam7scPullmanq
 
Useful Life 1- Costs that are expensed in the period incurred- Depreci.pdf
Useful Life 1- Costs that are expensed in the period incurred- Depreci.pdfUseful Life 1- Costs that are expensed in the period incurred- Depreci.pdf
Useful Life 1- Costs that are expensed in the period incurred- Depreci.pdfAdam7scPullmanq
 
Use the source code below and change the part that will display the ag.pdf
Use the source code below and change the part that will display the ag.pdfUse the source code below and change the part that will display the ag.pdf
Use the source code below and change the part that will display the ag.pdfAdam7scPullmanq
 
Use the PESTLE tool to identify current- strategically relevant factor.pdf
Use the PESTLE tool to identify current- strategically relevant factor.pdfUse the PESTLE tool to identify current- strategically relevant factor.pdf
Use the PESTLE tool to identify current- strategically relevant factor.pdfAdam7scPullmanq
 
Use the links to explore Generation Z and then discuss how quickly you.pdf
Use the links to explore Generation Z and then discuss how quickly you.pdfUse the links to explore Generation Z and then discuss how quickly you.pdf
Use the links to explore Generation Z and then discuss how quickly you.pdfAdam7scPullmanq
 
Use the following information for the Quick Studies below- (Algo) -The.pdf
Use the following information for the Quick Studies below- (Algo) -The.pdfUse the following information for the Quick Studies below- (Algo) -The.pdf
Use the following information for the Quick Studies below- (Algo) -The.pdfAdam7scPullmanq
 
Use the following information to calculate the net income for Tornado.pdf
Use the following information to calculate the net income for Tornado.pdfUse the following information to calculate the net income for Tornado.pdf
Use the following information to calculate the net income for Tornado.pdfAdam7scPullmanq
 
Use the following information for the Quick Studies below- (Algo) -The (1).pdf
Use the following information for the Quick Studies below- (Algo) -The (1).pdfUse the following information for the Quick Studies below- (Algo) -The (1).pdf
Use the following information for the Quick Studies below- (Algo) -The (1).pdfAdam7scPullmanq
 
Use the following information for the Exercises below- (Algo) -The fol.pdf
Use the following information for the Exercises below- (Algo) -The fol.pdfUse the following information for the Exercises below- (Algo) -The fol.pdf
Use the following information for the Exercises below- (Algo) -The fol.pdfAdam7scPullmanq
 
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdfUse the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdfAdam7scPullmanq
 
Use the diagram above to answer the following questions- Which letters.pdf
Use the diagram above to answer the following questions- Which letters.pdfUse the diagram above to answer the following questions- Which letters.pdf
Use the diagram above to answer the following questions- Which letters.pdfAdam7scPullmanq
 
Use the data in the spreadsheot provided to estimate the beta of Shce.pdf
Use the data in the spreadsheot provided to estimate the beta of Shce.pdfUse the data in the spreadsheot provided to estimate the beta of Shce.pdf
Use the data in the spreadsheot provided to estimate the beta of Shce.pdfAdam7scPullmanq
 
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdfUse the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdfAdam7scPullmanq
 
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdfUSE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdfAdam7scPullmanq
 
Use one half of your dissection to complete a lab drawing of a sheep b.pdf
Use one half of your dissection to complete a lab drawing of a sheep b.pdfUse one half of your dissection to complete a lab drawing of a sheep b.pdf
Use one half of your dissection to complete a lab drawing of a sheep b.pdfAdam7scPullmanq
 
True or False- 1- The price (interest rate) of bonds may differ by ris.pdf
True or False- 1- The price (interest rate) of bonds may differ by ris.pdfTrue or False- 1- The price (interest rate) of bonds may differ by ris.pdf
True or False- 1- The price (interest rate) of bonds may differ by ris.pdfAdam7scPullmanq
 
Use an analogy-example when creating this illustration when explaining.pdf
Use an analogy-example when creating this illustration when explaining.pdfUse an analogy-example when creating this illustration when explaining.pdf
Use an analogy-example when creating this illustration when explaining.pdfAdam7scPullmanq
 
Unexpected inflation lenders and borrowers- benetits- does not affect.pdf
Unexpected inflation lenders and borrowers- benetits- does not affect.pdfUnexpected inflation lenders and borrowers- benetits- does not affect.pdf
Unexpected inflation lenders and borrowers- benetits- does not affect.pdfAdam7scPullmanq
 
Types of Antibodies Complete the sentences describing the various clas.pdf
Types of Antibodies Complete the sentences describing the various clas.pdfTypes of Antibodies Complete the sentences describing the various clas.pdf
Types of Antibodies Complete the sentences describing the various clas.pdfAdam7scPullmanq
 
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdfUse any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdfAdam7scPullmanq
 
upiter Manulacturing began business on January 1 - During its first ye.pdf
upiter Manulacturing began business on January 1 - During its first ye.pdfupiter Manulacturing began business on January 1 - During its first ye.pdf
upiter Manulacturing began business on January 1 - During its first ye.pdfAdam7scPullmanq
 
Trey Monson starts a merchandising business on December 1 and enters i.pdf
Trey Monson starts a merchandising business on December 1 and enters i.pdfTrey Monson starts a merchandising business on December 1 and enters i.pdf
Trey Monson starts a merchandising business on December 1 and enters i.pdfAdam7scPullmanq
 
Translate the following sentences into a PL knowledge base (use any la.pdf
Translate the following sentences into a PL knowledge base (use any la.pdfTranslate the following sentences into a PL knowledge base (use any la.pdf
Translate the following sentences into a PL knowledge base (use any la.pdfAdam7scPullmanq
 
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdfUnlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdfAdam7scPullmanq
 
TravelBiz is a nationwide travel agency that specializes in business t.pdf
TravelBiz is a nationwide travel agency that specializes in business t.pdfTravelBiz is a nationwide travel agency that specializes in business t.pdf
TravelBiz is a nationwide travel agency that specializes in business t.pdfAdam7scPullmanq
 
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdfUnit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdfAdam7scPullmanq
 
Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Association for Project Management
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 

More Related Content

More from Adam7scPullmanq

Use the following information to calculate the net income for Tornado.pdf
Use the following information to calculate the net income for Tornado.pdfUse the following information to calculate the net income for Tornado.pdf
Use the following information to calculate the net income for Tornado.pdfAdam7scPullmanq
 
Use the following information for the Quick Studies below- (Algo) -The (1).pdf
Use the following information for the Quick Studies below- (Algo) -The (1).pdfUse the following information for the Quick Studies below- (Algo) -The (1).pdf
Use the following information for the Quick Studies below- (Algo) -The (1).pdfAdam7scPullmanq
 
Use the following information for the Exercises below- (Algo) -The fol.pdf
Use the following information for the Exercises below- (Algo) -The fol.pdfUse the following information for the Exercises below- (Algo) -The fol.pdf
Use the following information for the Exercises below- (Algo) -The fol.pdfAdam7scPullmanq
 
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdfUse the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdfAdam7scPullmanq
 
Use the diagram above to answer the following questions- Which letters.pdf
Use the diagram above to answer the following questions- Which letters.pdfUse the diagram above to answer the following questions- Which letters.pdf
Use the diagram above to answer the following questions- Which letters.pdfAdam7scPullmanq
 
Use the data in the spreadsheot provided to estimate the beta of Shce.pdf
Use the data in the spreadsheot provided to estimate the beta of Shce.pdfUse the data in the spreadsheot provided to estimate the beta of Shce.pdf
Use the data in the spreadsheot provided to estimate the beta of Shce.pdfAdam7scPullmanq
 
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdfUse the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdfAdam7scPullmanq
 
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdfUSE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdfAdam7scPullmanq
 
Use one half of your dissection to complete a lab drawing of a sheep b.pdf
Use one half of your dissection to complete a lab drawing of a sheep b.pdfUse one half of your dissection to complete a lab drawing of a sheep b.pdf
Use one half of your dissection to complete a lab drawing of a sheep b.pdfAdam7scPullmanq
 
True or False- 1- The price (interest rate) of bonds may differ by ris.pdf
True or False- 1- The price (interest rate) of bonds may differ by ris.pdfTrue or False- 1- The price (interest rate) of bonds may differ by ris.pdf
True or False- 1- The price (interest rate) of bonds may differ by ris.pdfAdam7scPullmanq
 
Use an analogy-example when creating this illustration when explaining.pdf
Use an analogy-example when creating this illustration when explaining.pdfUse an analogy-example when creating this illustration when explaining.pdf
Use an analogy-example when creating this illustration when explaining.pdfAdam7scPullmanq
 
Unexpected inflation lenders and borrowers- benetits- does not affect.pdf
Unexpected inflation lenders and borrowers- benetits- does not affect.pdfUnexpected inflation lenders and borrowers- benetits- does not affect.pdf
Unexpected inflation lenders and borrowers- benetits- does not affect.pdfAdam7scPullmanq
 
Types of Antibodies Complete the sentences describing the various clas.pdf
Types of Antibodies Complete the sentences describing the various clas.pdfTypes of Antibodies Complete the sentences describing the various clas.pdf
Types of Antibodies Complete the sentences describing the various clas.pdfAdam7scPullmanq
 
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdfUse any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdfAdam7scPullmanq
 
upiter Manulacturing began business on January 1 - During its first ye.pdf
upiter Manulacturing began business on January 1 - During its first ye.pdfupiter Manulacturing began business on January 1 - During its first ye.pdf
upiter Manulacturing began business on January 1 - During its first ye.pdfAdam7scPullmanq
 
Trey Monson starts a merchandising business on December 1 and enters i.pdf
Trey Monson starts a merchandising business on December 1 and enters i.pdfTrey Monson starts a merchandising business on December 1 and enters i.pdf
Trey Monson starts a merchandising business on December 1 and enters i.pdfAdam7scPullmanq
 
Translate the following sentences into a PL knowledge base (use any la.pdf
Translate the following sentences into a PL knowledge base (use any la.pdfTranslate the following sentences into a PL knowledge base (use any la.pdf
Translate the following sentences into a PL knowledge base (use any la.pdfAdam7scPullmanq
 
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdfUnlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdfAdam7scPullmanq
 
TravelBiz is a nationwide travel agency that specializes in business t.pdf
TravelBiz is a nationwide travel agency that specializes in business t.pdfTravelBiz is a nationwide travel agency that specializes in business t.pdf
TravelBiz is a nationwide travel agency that specializes in business t.pdfAdam7scPullmanq
 
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdfUnit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdfAdam7scPullmanq
 

More from Adam7scPullmanq (20)

Use the following information to calculate the net income for Tornado.pdf
Use the following information to calculate the net income for Tornado.pdfUse the following information to calculate the net income for Tornado.pdf
Use the following information to calculate the net income for Tornado.pdf
 
Use the following information for the Quick Studies below- (Algo) -The (1).pdf
Use the following information for the Quick Studies below- (Algo) -The (1).pdfUse the following information for the Quick Studies below- (Algo) -The (1).pdf
Use the following information for the Quick Studies below- (Algo) -The (1).pdf
 
Use the following information for the Exercises below- (Algo) -The fol.pdf
Use the following information for the Exercises below- (Algo) -The fol.pdfUse the following information for the Exercises below- (Algo) -The fol.pdf
Use the following information for the Exercises below- (Algo) -The fol.pdf
 
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdfUse the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
Use the folicwieg diagas to atdwer the next quection- in the daguam- s.pdf
 
Use the diagram above to answer the following questions- Which letters.pdf
Use the diagram above to answer the following questions- Which letters.pdfUse the diagram above to answer the following questions- Which letters.pdf
Use the diagram above to answer the following questions- Which letters.pdf
 
Use the data in the spreadsheot provided to estimate the beta of Shce.pdf
Use the data in the spreadsheot provided to estimate the beta of Shce.pdfUse the data in the spreadsheot provided to estimate the beta of Shce.pdf
Use the data in the spreadsheot provided to estimate the beta of Shce.pdf
 
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdfUse the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
Use the algorithm- Write the transitions- 7- Construct an npda corresp.pdf
 
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdfUSE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
USE R CODE 4-a Generate a dataframe d1 to have two variables- ID and.pdf
 
Use one half of your dissection to complete a lab drawing of a sheep b.pdf
Use one half of your dissection to complete a lab drawing of a sheep b.pdfUse one half of your dissection to complete a lab drawing of a sheep b.pdf
Use one half of your dissection to complete a lab drawing of a sheep b.pdf
 
True or False- 1- The price (interest rate) of bonds may differ by ris.pdf
True or False- 1- The price (interest rate) of bonds may differ by ris.pdfTrue or False- 1- The price (interest rate) of bonds may differ by ris.pdf
True or False- 1- The price (interest rate) of bonds may differ by ris.pdf
 
Use an analogy-example when creating this illustration when explaining.pdf
Use an analogy-example when creating this illustration when explaining.pdfUse an analogy-example when creating this illustration when explaining.pdf
Use an analogy-example when creating this illustration when explaining.pdf
 
Unexpected inflation lenders and borrowers- benetits- does not affect.pdf
Unexpected inflation lenders and borrowers- benetits- does not affect.pdfUnexpected inflation lenders and borrowers- benetits- does not affect.pdf
Unexpected inflation lenders and borrowers- benetits- does not affect.pdf
 
Types of Antibodies Complete the sentences describing the various clas.pdf
Types of Antibodies Complete the sentences describing the various clas.pdfTypes of Antibodies Complete the sentences describing the various clas.pdf
Types of Antibodies Complete the sentences describing the various clas.pdf
 
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdfUse any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
Use any tool that can complete these two pages (HTML- Boot- JS- etc-)-.pdf
 
upiter Manulacturing began business on January 1 - During its first ye.pdf
upiter Manulacturing began business on January 1 - During its first ye.pdfupiter Manulacturing began business on January 1 - During its first ye.pdf
upiter Manulacturing began business on January 1 - During its first ye.pdf
 
Trey Monson starts a merchandising business on December 1 and enters i.pdf
Trey Monson starts a merchandising business on December 1 and enters i.pdfTrey Monson starts a merchandising business on December 1 and enters i.pdf
Trey Monson starts a merchandising business on December 1 and enters i.pdf
 
Translate the following sentences into a PL knowledge base (use any la.pdf
Translate the following sentences into a PL knowledge base (use any la.pdfTranslate the following sentences into a PL knowledge base (use any la.pdf
Translate the following sentences into a PL knowledge base (use any la.pdf
 
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdfUnlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
Unlike HMO plans- PPO plan members MOST often a)receive no medical ben.pdf
 
TravelBiz is a nationwide travel agency that specializes in business t.pdf
TravelBiz is a nationwide travel agency that specializes in business t.pdfTravelBiz is a nationwide travel agency that specializes in business t.pdf
TravelBiz is a nationwide travel agency that specializes in business t.pdf
 
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdfUnit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
Unit 3 Discussion Topic -#2- Reporting and Analyzing Long-Term Debt 15.pdf
 

Recently uploaded

Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Association for Project Management
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfPoh-Sun Goh
 
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...Nguyen Thanh Tu Collection
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentationcamerronhm
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.MaryamAhmad92
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Jisc
 
Understanding Accommodations and Modifications
Understanding Accommodations and ModificationsUnderstanding Accommodations and Modifications
Understanding Accommodations and ModificationsMJDuyan
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17Celine George
 
Dyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxDyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxcallscotland1987
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfNirmal Dwivedi
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSCeline George
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxRamakrishna Reddy Bijjam
 

Recently uploaded (20)

Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdf
 
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentation
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
 
Understanding Accommodations and Modifications
Understanding Accommodations and ModificationsUnderstanding Accommodations and Modifications
Understanding Accommodations and Modifications
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17
 
Dyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxDyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptx
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Asian American Pacific Islander Month DDSD 2024.pptx
Asian American Pacific Islander Month DDSD 2024.pptxAsian American Pacific Islander Month DDSD 2024.pptx
Asian American Pacific Islander Month DDSD 2024.pptx
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POS
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docx
 

Transcript editing (Eukaryotes) 12- In this transcript's sequence- the.pdf

  • 1. Transcript editing (Eukaryotes) 12. In this transcript's sequence, the introns have been identified and underlined. Write the edited transcript and the translation 5 augggagguggcgaggaagaugacgugguaguugucgcggcagcugccaggagaaguagcaagaa a 3 Transcript with introns removed and translated: 3 5 AA seq: