Lab 2/3: DNA Extraction and Purification Isolation and purification of nucleic acids is the most fundamental procedure in molecular biology. There are three basic steps involved: 1. Lyse (break open) the cells (and nuclei in eukaryotes) to release the DNA 2. Remove contaminants (proteins, lipids, carbohydrates, salts) 3. Preserve the integrity of the DNA (prevent degradation and shearing) Step 1 can be accomplished in a number of ways, such as mechanical disruption (grinding, mincing), protein denaturation (detergents), and protein degradation (via proteases). These can be used singly or in combination depending on the type of biological sample you are starting with. Grinding the samples provides more surface area for the denaturants/proteases to interact with the cellular proteins, thus speeding up the denaturation process. We used liquid nitrogen (N2) and protein degradation (Proteinase K) in lab 2. Various salts are included in a cell lysis solution to stabilize the DNA by providing positive ions which insert between the negatively charged phosphates in the DNA backbone (creating a “salt bridge”). Buffers (such as Tris) also help to preserve DNA integrity by maintaining a neutral pH. Once the cells have been lysed, contaminating proteins, lipids, etc. must be separated from the DNA. A widely used and efficient way to remove proteins from nucleic acids solutions is to extract with a 1:1 mixture of phenol and chloroform (CHCl3). Phenol and CHCl3 are both hydrophobic organic solvents that unfold proteins. When mixed with an aqueous DNA/protein solution and then centrifuged, the denatured proteins are selectively partitioned into the denser organic phase, while the DNA (plus RNA and salt) remains in the aqueous phase. This procedure takes advantage of the fact that deproteinization is more efficient when two different organic solvents are used instead of one. Additionally, chloroform removes any lingering traces of phenol from the nucleic acid preparation (which would interfere with later applications). Since the aqueous phase contains RNA and salt in addition to the DNA, phenol:CHCl3 extraction is followed by ethanol (EtOH) precipitation. DNA (a polar molecule) is soluble in water (also polar) because the water molecules intercalate into the phosphate backbone of the DNA and thus maintain it in a soluble state, but DNA is insoluble in 95% EtOH (nonpolar). Water molecules have a higher affinity for the EtOH than the DNA, so when you add EtOH and salt [10 M ammonium acetate (NH4Ac); pH 5.2], Na+ ions replace water in the DNA backbone, essentially removing the water molecules, and the DNA is forced out of solution (precipitates). After precipitating with 95% EtOH, the DNA is “washed” in 70% EtOH to remove the salt. Since 70% EtOH contains 30% water, the salt, having a greater affinity for the water than the DNA, remains in the EtOH, and the DNA is forced out. The final step in the purification process is to preserve the DNA in a sta ...

1. Lab 2/3: DNA Extraction and Purification
Isolation and purification of nucleic acids is the most
fundamental procedure in molecular biology. There are three
basic steps involved:
1. Lyse (break open) the cells (and nuclei in eukaryotes) to
release the DNA
2. Remove contaminants (proteins, lipids, carbohydrates, salts)
3. Preserve the integrity of the DNA (prevent degradation and
shearing)
Step 1 can be accomplished in a number of ways, such as
mechanical disruption (grinding, mincing), protein denaturation
(detergents), and protein degradation (via proteases). These can
be used singly or in combination depending on the type of
biological sample you are starting with. Grinding the samples
provides more surface area for the denaturants/proteases to
interact with the cellular proteins, thus speeding up the
denaturation process. We used liquid nitrogen (N2) and protein
degradation (Proteinase K) in lab 2. Various salts are included
in a cell lysis solution to stabilize the DNA by providing
positive ions which insert between the negatively charged
phosphates in the DNA backbone (creating a “salt bridge”).
Buffers (such as Tris) also help to preserve DNA integrity by
maintaining a neutral pH.
Once the cells have been lysed, contaminating proteins, lipids,
etc. must be separated from the DNA. A widely used and

2. efficient way to remove proteins from nucleic acids solutions is
to extract with a 1:1 mixture of phenol and chloroform (CHCl3).
Phenol and CHCl3 are both hydrophobic organic solvents that
unfold proteins. When mixed with an aqueous DNA/protein
solution and then centrifuged, the denatured proteins are
selectively partitioned into the denser organic phase, while the
DNA (plus RNA and salt) remains in the aqueous phase. This
procedure takes advantage of the fact that deproteinization is
more efficient when two different organic solvents are used
instead of one. Additionally, chloroform removes any lingering
traces of phenol from the nucleic acid preparation (which would
interfere with later applications). Since the aqueous phase
contains RNA and salt in addition to the DNA, phenol:CHCl3
extraction is followed by ethanol (EtOH) precipitation. DNA (a
polar molecule) is soluble in water (also polar) because the
water molecules intercalate into the phosphate backbone of the
DNA and thus maintain it in a soluble state, but DNA is
insoluble in 95% EtOH (nonpolar). Water molecules have a
higher affinity for the EtOH than the DNA, so when you add
EtOH and salt [10 M ammonium acetate (NH4Ac); pH 5.2], Na+
ions replace water in the DNA backbone, essentially removing
the water molecules, and the DNA is forced out of solution
(precipitates). After precipitating with 95% EtOH, the DNA is
“washed” in 70% EtOH to remove the salt. Since 70% EtOH
contains 30% water, the salt, having a greater affinity for the
water than the DNA, remains in the EtOH, and the DNA is
forced out.
The final step in the purification process is to preserve the DNA
in a stable medium for storage. DNA prefers a slightly basic pH
and must be protected from degradation by DNases (enzymes
that break down DNA). Tris:EDTA (TE), at pH 7.8, is the most
commonly used storage medium for DNA. As you know, Tris is
a buffer that resists changes in pH that could be detrimental to
the DNA. EDTA (ethylenediamine tetraacetic acid) is a
chelating agent that is used to sequester divalent cations (e.g.;

3. Mg2+, Ca2+) which are required cofactors for the enzymatic
action of DNase.
Lab 4: Agarose Gel Electrophoresis
Gel electrophoresis is a core diagnostic technique that is used to
separate DNA, RNA, and protein molecules based on size. It is
simple, rapid, and capable of resolving fragments containing as
little as 1 ng of DNA. Agarose gel electrophoresis is performed
in a gel box filled with an ionic solution (TA =Tris- a buffer,
and Acetic acid- provides ions) called a “running buffer”. The
gel box has a negative electrode at one end and a positive
electrode at the opposite end. The gel is placed in the solution
and a current is applied. Since DNA has a net negative charge
(due to the phosphates that makeup its backbone), it moves
through the gel from the negative electrode toward the positive
one. Because there is one phosphate for each nucleotide, the
negative charge is directly proportional to the length of the
DNA molecule.
Agarose is a natural colloid extracted from seaweed. It is a
linear polysaccharide; when boiled, then cooled, the sugars
crosslink causing the solution to gel into a semi-solid matrix.
The concentration of the agarose determines how dense the
matrix will be and thus, how quickly (or slowly) the DNA will
move through the gel. Large DNA molecules will have greater
difficulty moving through the gel than small DNA molecules.
For most applications, a 1% gel will provide adequate
separation of fragments. However, if you are trying to resolve
very large DNA fragments (such as genomic DNA), you would
use a less concentrated gel (0.5%), and for very small fragments
(< 200 bp), a 1.5 – 2% gel would be appropriate.
Purified DNA is colorless; therefore, various stains are used to
visualize samples. Loading buffer, added to the DNA in a 1:6
ratio (1 μl buffer/5 μl DNA), gives color and density to the

4. sample to facilitate loading into the wells. The dyes used in
loading buffers are negatively charged, thus they move in the
same direction as the DNA during electrophoresis allowing you
to monitor the progress of the gel. The most common dyes are
OrangeG, Bromophenol Blue and Xylene Cyanol; these migrate
at ~50, 300, and 4000 base pairs, respectively. Loading buffer
also contains glycerol, a viscous liquid compound that increases
the density of the DNA samples making them settle in the wells
more efficiently. Ethidium bromide (EtBr) is another stain used
in gel electrophoresis. It specifically binds to DNA by
intercalating between the bases and fluoresces orange under
ultraviolet light. When EtBr (Cf = 0.5 μg/ml) is added to the
agarose gel before it sets, it will bind the DNA fragments as
they migrate through the gel. Caution must be exercised when
using EtBr because it is a strong mutagen; always wear gloves!
Gel electrophoresis is normally used in conjunction with a
standard marker that separates into a series of bands of known
size and concentration. Comparison between sample and
standard bands allows quantitative analysis of the sample DNA
[i.e, #of base pairs and concentration (ng/μl)]. The standard that
we are using is called the “Lambda HindIII” ladder. It has 7
fragments (8 including a 125bp fragment usually not seen)
ranging from 564 bp to 23,000 bp and each band contains a
specified concentration of DNA (see figure). We can use this
information to determine the concentration of our sample DNA
by comparing the gel band from our sample to the size and
brightness of the marker bands. For example: we run our DNA
sample and the resulting gel has a single band that migrates the
same distance as the 4000 bp band of the marker; this tells us
that our DNA sample is ~4 kb in size. Now we want to
determine the concentration of our sample – a bit trickier! To do
this we compare the thickness and intensity of our sample band
to each band of the standard marker. If our sample appears
about equally as bright and thick as the 1 kb band, we can
estimate that our band contains ~18 ng of DNA. If it seems

5. twice as bright (or thick), we multiply that by 2( 18 x 2 = 36 ng
of DNA in our sample. A better way to express the
concentration is in ng/μl; if we loaded 5 μl of our sample ( 36/ 5
≈ 7ng/μl.
Lamda HindIII Ladder
Lab 5-6 Notes: The Polymerase Chain Reaction
PCR in a Nutshell:
The polymerase chain reaction (PCR) is a quick and inexpensive
in vitro technique used to amplify (copy) small segments (<10
Kb) of DNA. Because molecular and genetic analyses of
isolated pieces of DNA require significant amounts of a DNA
sample, PCR amplification has become an indispensable tool in
the scientific community.
Background:
In the Spring of 1984, Kary Mullis, a biochemist working for
the Cetus Corporation, presented a poster outlining the basic
concept of the polymerase chain reaction at the company’s
annual scientific meeting. He had done some preliminary testing
of his theory in order to convince himself that it would actually
work. He was sure that he must be missing some key problem;
otherwise, someone else certainly would have figured this out.
Fortunately, Mullis’ new technique was both brilliant and
workable despite its simplicity and his invaluable contribution
to science was rewarded with a Nobel Prize in 1993. Since then,
the PCR technique has been extensively adopted (and adapted)
by virtually every branch of science.
PCR Components:
The simple elegance of the PCR is that it merely mimics in vitro
what nature does in vivo. Before a cell divides, it replicates its
DNA by unwinding the double helix strands, attaching primers
to each strand, and then using DNA polymerase to add

6. deoxyribonucleotides (dNTPs) in the 5’ to 3’ direction. The
PCR makes use of these same basic materials to make millions
of copies of a desired DNA template, all in one tiny tube! The
necessary requirements are:
1. Primers – these are two synthetic DNA oligonucleotides,
generally 18-24 bases in length (any
sequence greater than17 bases long is statistically unlikely to
appear more than once), and designed to
flank the region of interest. They should be complementary
to opposite ends of the desired segment and
oriented so they are moving 5’(3’ toward each other. The
melting temperatures (Tm) of the primer pair
should be as close to each other as possible since they
determine the annealing temperature. Primers are
added to the reaction in excess to make sure that they are
available for each cycle.
2. Thermostable DNA Polymerase – this is usually Taq
polymerase, purified from a bacterium
(Thermus aquaticus) that lives in 90°C + hot springs; it is not
denatured by the high temperatures
required to separate the DNA strands during each PCR cycle.
This enzyme is very efficient and
minimal amounts are needed for each reaction.
3. Buffer – usually designed for the specific requirements (salt,
pH, MgCl2) of the particular polymerase

7. used in the reaction. Taq is supplied with its ideal buffer in a
10X concentration; the working
concentration must be 1X. MgCl2 is a required co-factor for
Taq function.
4. dNTPs – free nucleotides consisting of equimolar amounts of
all four nitrogenous bases (adenine,
guanine, cytosine, thymine) must be added in excess so that
the Taq can continue to extend the DNA
sequence at the end of each cycle. We use a 10 mM stock of
dNTPs in our PCR reactions (10 mM each
of: dATP, dGTP, dCTP, dTTP).
5. DNA Template - the DNA used as a template for PCR
amplification can come from almost any
source: genomic DNA, cDNA, plasmids, etc, can all be
amplified. However, the PCR is extremely
sensitive so any contaminants in your template will seriously
affect the quality of your product.
6. Deionized Water (dH2O) – is used as a filler in PCR; the
volume used is determined by
summing the amounts of all of the above reagents (1-5) and
subtracting them from the total
reaction volume. Despite being “filler”, the water used in
PCR must be pure; if contaminated
with chemicals or nucleases, your product will be degraded

8. instead of amplified.
The PCR Process:
The basic PCR process is as follows:
· Double-stranded DNA is heated to >90°C: this disrupts the
hydrogen-bonds holding the two strands together and they
separate (denature). [~30 sec.]
· The temperature is dropped to ~50-70°C (exact temp. depends
on the primers used): this allows the primers to find and bind
(anneal) to their target sequence. [30 sec – 2 min]
· The temperature is raised to 68-72°C (exact temp. depends on
type of polymerase used): this is the ideal temp. range for the
enzymatic function of Taq polymerase; it binds to the DNA and
adds nucleotides, starting at the primer and extending the
sequence in the 3’ direction (extension).
[30 sec – 2 min]
This cycle is repeated 30-35 times; amplification occurs
exponentially so at the end of 30 cycles, more than a billion
copies have been made! More than 35 cycles is not
recommended due to the depletion of the enzymatic activity of
the Taq polymerase.
Automation of the PCR process is achieved using a
programmable thermal cycler. Reactants are placed insmall,
thin-walled tubes for efficient heat transfer during cycling. The
desired parameters (times and temps) are programmed into the
machine and tubes are fitted into the top. Once started, the
thermal cycler automatically raises and lowers the temperature
as specified by the program. It has sensors to monitor the
temperature at each step and does not start “timing” until the
proper temp. has been achieved. Usually, a program includes an

9. initial denaturing step of 92-94°C for ~3 minutes. This is
followed by the repeating loop of denature-anneal-extend. After
the final cycle there is a final extension at ~72°C for 3-10 min;
this gives the polymerase plenty of time to finish extending any
incomplete strands.
The basic PCR program outlined here is the most commonly
used; however, scientists have found no limit to the number of
ways that the PCR can be adapted. I can’t possibly explain all
of the variations of PCR that exist and new ones are being
invented all the time. If you want to know more about them, the
internet has hundreds of sites explaining them in great detail.
The manual PCR that we will do in class involves the use of
universal primers. These are not specific to the DNA that we are
using as template, but were designed based on multiple
sequence alignments of the CO1 and matK gene from a wide
variety of animals and plants, respectively. The CO1 primers
are from highly conserved regions that are likely to be 80-90%
identical in most invertebrates. Because the primers are
expected to have some mismatches with the template DNA, we
need to lower the stringency of the amplification. We do this by
using an annealing temp of ~40-45°C; within this temperature
range, primers with only ~80% identity to template can bind and
be extended. If we were to use an annealing temp very close to
the Tm of the primers, the primers would need to be exactly
complementary to the DNA template (100% identity); this is a
high-stringency amplification. The primers we are using have
also been designed to contain a restriction endonuclease
recognition site at the 5’ end; the forward primer has a HindIII
site (A↓AGCTT), while the reverse primer has a SpeI site
(A↓CTAGT). These sites will enable us to easily clone our
amplified DNA into a vector in a subsequent lab. Restriction
endonucleases will be discussed in more detail at that time.
PCR Schematic:

10. Diagram is from:
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/P/PCR.h
tml
Applications of PCR:
The uses and applications for PCR technology are numerous,
diverse, and expanding rapidly. These include the mapping of
the human genome project, molecular cloning, molecular
analysis of ancient DNA, molecular ecology and behaviour,
disease diagnosis and drug discovery. In the field of forensic
science, PCR has become indispensable to the characterization
of biological material recovered from crime scenes and victims,
as well as paternity determination.
PCR Concept Map:
Concept map is from: “An Introduction to Genetic
Engineering”, 2nd Ed., Desmond S.T. Nicholl
Lab 6: Restriction Endonucleases
Background
The discovery of restriction enzymes (molecular “scissors”) in
the late 1960’s was an important biological breakthrough which,
in conjunction with the discoveries of DNA ligase (molecular
“glue”) and DNA polymerase, ushered in a new era in biological
research and gave birth to the field known as “Molecular
Biology”. These three enzymes gave scientists the tools
necessary to effectively manipulate DNA to create hybrid DNA
molecules (by “cutting and pasting”) that allow in-depth
analysis of genes and their functions.
Function

11. Restriction enzymes, called “endonucleases” because they cut
within the DNA strand (“endo” means “inner”), were originally
isolated from bacteria that were observed to have the ability to
“restrict” a virus’s ability to infect them by chopping up the
viral DNA (a sort-of “immune system” for bacteria). Bacteria
that produce restriction enzymes (RE’s) also produce methyl
transferases – enzymes that add methyl groups to specific
nucleotides of the bacterium’s DNA to prevent its own RE’s
from recognizing the sequence and cutting it up. RE’s (most
paired as “dimers”) only bind double-stranded DNA and cut
both strands at the same time. The binding site (restriction site)
is usually a 4-6 base pair sequence that forms an inverted repeat
or palindrome. Although several thousand RE’s have been
isolated, there are only a few hundred unique restriction sites.
This is because many different RE’s recognize the same
sequence; different RE’s with the same recognition site are
called “isoschizomers”.
Nomenclature
RE’s are named according to the organism (usually a bacterium)
from which they are derived. The first letter is from the
organism’s genus, and the next two are from the species; the
strain of bacteria may also be indicated. If more than one RE is
isolated from a given genus and species, roman numerals are
used to distinguish them (usually by the order in which they
were discovered). Since the RE names are derived from genus
and species names, they are always italicized (but not the roman
numerals).
Examples: EcoRI ( Escherichia (genus),coli (species),RY13
(strain), I (1st found)
HindIII ( Haemophilus (genus), influenza (species), Rd (strain),
III (3rd found)

12. XbaI ( Xanthomonas (genus), badrii (species), I (1st found)
Cutting Patterns
RE’s cut DNA strands by hydrolyzing the sugar-phosphate
backbone leaving a free phosphate group at the 5’ end, and a
free hydroxyl group at the 3’ end. Cuts can be either staggered
(leaving “sticky ends”), or blunt. The staggered cuts can
produce either a 5’ overhang, or a 3’ overhang. Staggered cuts
are more useful in recombinant DNA technology because they
permit base-pairing between overhangs with complementary
sequences, allowing two fragments to be joined together by
DNA ligase. In addition, they facilitate directional cloning
(DNA inserts and vector are cut with the same two RE’s,
generating different sticky ends that will not self anneal and can
only be ligated together in a specific orientation), and are much
more efficiently ligated.
Examples: 5’ overhang: EcoRI ( 5’- G↓A A T T C – 3’
3’- C T T A A↑G – 5’
3’ overhang: PstI ( 5’ – C T G C A↓G – 3’
3’- G↑A C G T C – 5’
Blunt cut: PvuII ( 5’ – C A G↓C T G – 3’
G T C ↑G A C – 5’
Since RE’s recognize a specific nucleotide sequence, the
frequency with which a given RE will cleave a random piece of
DNA can be statistically determined. Given that there are four
possible bases (A, T, G, C), a RE that has a 4-base recognition
sequence will cut approximately once every 256 bases (44). A
6-base cutter (such as EcoRI) will cut ~once every 4096 bases

13. (46). Therefore, if we use EcoRI to cut genomic DNA
(thousands of ~50,000 bp fragments), each fragment would be
cut ~12 times; multiplied by a few thousand, gives us tens of
thousands of tiny restriction fragments. When run out on an
agarose gel (with ethidium bromide), all those fragments will
appear as a smear of brightness down the entire lane.
Restriction Enzyme Digests
RE’s are measured in “Units of activity”; 1Unit is defined as:
the amount enzyme needed to digest 1 μg of DNA in 1 hour (1
U : 1 μg : 1 hr). RE’s are very expensive so, in most cases, the
minimum amount necessary is used in a reaction. In addition,
RE’s are stored in 50% glycerol, an inhibitor of biological
reactions, so RE’s should not make up more than 10% of the
final volume of a digestion reaction. Each RE has specific
requirements for optimum activity; the most important of these
are the buffer (controls salt concentration), and the reaction
temperature (usually, but not always, 37°C). The components of
a RE digestion are:
1. DNA – best to know the concentration (μg/μl) to determine
optimum RE amount
2. RE – minimum amount based on time and total DNA in
reaction
3. Buffer – optimum buffer recommended for the RE being
used; supplied as 10X; Cf = 1X
4. Water – dH2O is added to make up the difference
between the final volume desired, and the
cumulative volume of the DNA, RE, and
buffer.

14. Sample Calculation:
You want to digest 2 μg of DNA (0.5 μg/ μl) in a total reaction
volume of 10 μl; set up a reaction using the minimum amount of
RE (20 U/μl).
DNA [2 μg/(0.5 μg/ μl)]
4.0 μl
RE [2 μg DNA requires 2 U of RE: (2 U)/(20 U/μl)]
0.1 μl
Buffer [(10x)(Vi)=(1X)(10 μl)]
1.0 μl
Water [10 μl – (4 + 0.1 + 1)]
4.9 μl
Total Rxn Vol.
10.0 μl
Since we used the minimum amount of RE for the given amount
of DNA, this reaction should be completed in 1 hour; double the
RE amount and it will cut in 30 minutes.
Performing a Double Digest:
In lab 6 we used two different RE’s, HindIII and SpeI, to cut
our PCR-amplified DNA fragments which were amplified using
primers designed to contain recognition sites for these
particular RE’s. The vector, pBluescript, was cut with the same
two REs. These two enzymes were chosen based on several
criteria:
1. Buffer compatibility – Each RE is supplied by the
manufacturer with its optimal buffer

15. designed to ensure 100% activity; the primary differences
between the various buffers are salt
concentration and pH. Manufacturers also provide a guide to
the percent activity of each RE in
each different buffer. When performing a double digest it is
necessary to choose two enzymes
that have common buffer requirements so that the buffer used
in the digest allows optimal
enzyme activity. Both HindIII and SpeI have 100% activity
in New England BioLabs buffer 2.
2. Location of their recognition sites within the multicloning
site of the vector – Every cloning
vector has a map (Fig. 1) that details its particular features,
including every RE recognition site
both within, and outside of, the multicloning site (MCS).
Since our objective is to ligate
(“paste”) our cut DNA fragment into the pBluescript vector,
the two RE’s must have only 1 cut
site each within the MCS, and no cut sites in the remaining
vector sequence. Thus the vector
remains intact (a few bases between the two sites is lost, but
this is irrelevant), and ligation will
permanently reform a functional, circular recombinant
plasmid.

16. 3. Availability – You can’t use an enzyme you haven’t got; REs
are expensive so, if at all
possible, you try to find a compatible RE pair that you don’t
have to order!
Fig. 1: pBluescript Map with MCS
Lab 7:DNA Ligation
Overview:
DNA cloning requires two essential steps:
1. Creation of a recombinant DNA molecule
2. Propagation (amplification) of the recombinant DNA
Step 1 involves generation of DNA fragments using restriction
enzymes, and joining of DNA fragments to a vector (such as a
plasmid or virus). Step 2, propagation of the recombinant DNA,
can be accomplished in vivo by inserting the engineered vector
into a host cell (such as E. coli) and allowing it to reproduce.
Alternatively, propagation can be achieved in vitro using the
polymerase chain reaction (PCR).
In this lab we are creating recombinant DNA molecules by
inserting those fragments into a plasmid vector (pGem) that has
been cut with restriction enzymes. Since both vector and insert
have “blunt ends” with 3’-T and 5’-A overhangs, respectively.
Together in an appropriate environment, they will join together
via complementary base-pairing. However, because the majority
of fragments are either blunt or have overhangs only 1 base
long, the connection between insert and vector is very weak and
is easily disrupted. Therefore, to ensure that our newly created

17. recombinant molecules stay together, we use ligase (“molecular
glue”) to covalently bond insert to vector.
Vectors:
Vectors used for cloning are specifically engineered to optimize
insertion, propagation, and selection of foreign DNA; the most
commonly used vectors are plasmids, bacteriophages (bacterial
viruses), and phagemids (plasmid-phage hybrids). For cloning
very large pieces of DNA (as in large genome sequencing
projects), yeast artificial chromosomes (YACs) and bacterial
artificial chromosomes (BACs) are the preferred vectors.
Despite the variety of vectors available, all have certain
common features:
· Origin of Replication – so their DNA can be copied and
maintained in the host organism.
· Multiple Cloning Site (MCS; also call a “polylinker”) –
containing numerous restriction sites enabling convenient
insertion and excision of target DNA.
· Selectable Marker – (such as antibiotic resistance) for easy
identification of desired clones.
· Small Size – to facilitate handling and host incorporation.
Numerous other useful features can be engineered into a vector
(such as the β-galactosidase gene fragment which enables
blue/white screening in the presence of X-gal, or a promoter for
gene expression) depending on how it will be used. The vector
that we used, pGem, is a ~3kb plasmid with several of these
features. It has an ampicillin resistance gene (AmpR), an origin
of replication (OriC), a MCS embedded within the β-
galactosidase (lacZ) gene, and a lac promoter. It is a circular,
double-stranded DNA molecule that is easily taken up by
competent E. coli bacteria (transformation). Once inside the
bacterial cell, the plasmid is replicated by the host cell
machinery and a copy is segregated to each daughter cell when

18. the host cell divides (~every 20 minutes). Because the
replication enzymes cannot distinguish vector from insert, the
entire plasmid, including the foreign DNA, is copied over and
over again. Since the plasmid provides a benefit to the host cell
(drug resistance), its presence and propagation is tolerated.
Ligase/Ligation:
The natural function of ligase is to catalyze formation of 3’( 5’
phosphodiester bonds between the Okazaki fragments on the
lagging strand of DNA (during replication) to produce a
continuous DNA chain. In recombinant DNA technology, ligase
is an essential tool for the creation of recombinant DNA
molecules. When added to a solution containing restriction
fragments with compatible ends, ATP (catalysis is an energy-
dependant reaction), and an appropriate buffer, ligase will
covalently join the 3’-OH of one fragment to the 5’-P of another
fragment while they are transiently base-paired.
Although there are numerous types of ligases, the most
commonly used is T4 DNA ligase derived from the T4
bacteriophage; it is capable of ligating both sticky-end
fragments and blunt-end fragments. The optimal temperature for
T4 ligase activity is 16° C; however it works quite efficiently
across a broad range of temperatures and the size of the
fragments (thus, their melting temperature) must be considered:
the shorter the fragments, the lower their melting temperature,
and the lower the ligation temperature.
Another consideration when performing a ligation reaction is
the molar ratio of insert to vector. Ligation products are a
mixture consisting of: (i) linear DNA fragments, (ii)
concatameric DNA fragments, (iii) linear vector, (iv) intact
circular vector, and (v) circular vector/insert chimeras. Studies
have shown that the optimum ratio of insert-to-vector resulting
in the greatest percentage of (v) is 3:1. Although we did not

19. quantify our samples, the cut plasmid concentration was at least
2-fold less, and the ratio between the two should be sufficient to
obtain the desired ligation product. If we were to run the
ligation reaction out on a gel, the desired product would be
~700-2000bp (depending on kingdom) larger than a control of
just linearized pGem (~3 kb). In addition, we may see some
bands within a smear representing (ii), (iii), and (iv).
One last note: Since the ratios of reactants are important to the
success of the ligation, and ligation reactions are typically very
small volumes, it is important to prevent even the slightest
evaporation from occurring during the ligation. For this reason,
the ligation tubes were stored inverted at 20° C during the week
between labs.
Generalized Ligation Schematic:
www.bio.miami.edu/dana/104/104F02_24.html
Lab 9: Bacterial Transformation
Background:
In 1928, Frederick Griffith, a British medical officer, published
the results of studies done on different strains of
Streptococcuspneumoniae bacteria. He demonstrated that
“something” in heat-killed virulent strains could be “taken up”
by non-virulent strains (when both were mixed together)
causing the non-virulent to be “transformed” into virulent. At
that time it was not known that DNA was the carrier of genetic
information so his results, though curious, were not fully
appreciated. In 1944, Avery, McLeod, and McCarty, also
working with S. pneumoniae, proved that it was DNA from the
virulent strain that was taken up by the non-virulent strain
causing a heritable change in expression. This process is called
transformation.

20. Competent Cells:
Bacterial cells that are capable of taking up “naked” DNA (i.e.
DNA not associated with a cell or proteins) from the external
environment are said to be “competent”. A few bacterial genera
(such as Streptococcus) are naturally competent; most, however,
must be artificially induced to become competent. There are two
commonly used methods for producing competent bacterial cells
in the laboratory, (1) electroporation, and (2) chemical exposure
[usually calcium chloride (CaCl2)]. Both are rather inefficient
means of getting DNA into cells (only 1-2 % of cells take up a
plasmid); however, for most applications, this more than
enough.
Electroporation involves briefly “zapping” the cells (usually an
E. coli strain) with an electric pulse causing holes to form in the
bacterial membrane. Recombinant plasmids, added to the
bacterial solution prior to shocking, can enter the cells through
the holes before the membrane repair machinery has time to
close them. This method is quite simple and effective; however
it requires special equipment (an electroporator) not available in
all laboratories.
The second and much older method uses ice-cold CaCl2,
followed by heat-shock, to induce competence. Briefly, a single
colony from a freshly made bacterial streak-plate is cultured in
Luria-Bertani (LB) broth until the bacteria are in log phase
(exponential growth). The culture is centrifuged, the broth is
removed, and the cells are resuspended in chilled CaCl2.
Recombinant DNA is added to the cells, incubated on ice for
~20-30 minutes, heat-shocked for 1-2 minutes at 42°C, and then
returned to the ice. Although this method has been in use for
several decades, much is still not known regarding the precise
mechanisms involved. It is believed that exposing chilled cells
to divalent cations (such as Ca 2+) destabilizes the cell wall and

21. makes it permeable to DNA. It is additionally believed that the
stress caused by heat-shocking activates chaperone proteins that
aid in the uptake of exogenous DNA. The protocol
specifications (such as keeping everything very cold, using only
fresh cells in log phase, mixing very gently, etc.) have been
determined empirically through experimental trial and error.
The fact that this method requires no special equipment and is
quick and easy has made it the most widely used technique for
the preparation of competent cells.
While naturally competent cells are capable of taking up linear
DNA and incorporating it into their genome (via
recombination), artificially induced competent cells can only
take up circular, self-replicating DNA (plasmids) because
bacterial endonucleases rapidly degrade any foreign linear DNA
that enters the cell.
Significance:
Genetic engineering is the manipulation of an organism’s genes
using recombinant techniques. Through the use of restriction
enzymes and DNA ligase we are able to create completely new
DNA molecules that combine selected genetic material from two
or more sources. The potential applications for these
recombinant products are innumerable; however, in order to be
useful, the recombinant molecule must be replicated many times
(i.e. cloned). The oldest and still most commonly used method
for the amplification of genetically engineered DNA is bacterial
transformation. This in vivo method allows us to make use of
the bacteria’s natural replication machinery to produce a new
copy of our recombinant plasmid each time the cell divides.
Under optimal conditions, a bacterium will divide every 20
minutes resulting in millions of copies within just a few hours.
What is done next depends on the type of recombinant molecule
created and the desired application. The plasmids can be

22. purified away from the bacteria for further genetic/functional
analysis or, if the recombinant molecule consists of a gene
cloned into an expression vector, the protein product can be
purified out of the culture. Numerous plasmids are available for
use in cloning, each specially engineered to be best suited for a
particular application. Expression vectors contain a strong
promoter (in addition to a MCS, origin of replication, and
antibiotic resistance gene) that allows the inserted gene to be
translated constitutively. This type of vector is widely used to
make: (These are just a few of the current applications)
· Insulin for diabetics
· Blood clotting factors for hemophiliacs
· Human growth hormone
· Interferon
The vector we used, pGem, is a multi-use plasmid suitable for
many different applications. Since it contains the β-
galactosidase gene, with an embedded MCS, it is ideal for
Blue/White screening which permits us to visually determine
the success of our transformation experiment. In addition, pGem
has an ampicillin resistance gene; this allows us to put selective
pressure on the transformed bacteria, forcing them to retain the
plasmid in the presence of ampicillin.
Labs 9/10: Plasmid Purification
Alkaline Lysis:
Alkaline lysis is the most commonly used method for the
isolation of circular plasmids from bacterial cells. This
technique, based on that of Birnboim and Doly (1979), exploits
the one major difference between plasmid DNA and bacterial
chromosomal DNA: Chromosomal DNA ismuch largerthan

23. plasmid DNA. As a result, chromosomal DNA shears when
extracted from the cell (resulting in long, linear fragments),
while the much smaller plasmid DNA retains its closed, circular
form.
The key to this technique is in using a highly alkaline (hence
the name “alkaline lysis”) solution [NaOH, sodium dodecyl
sulfate (SDS); pH 12.5] to release and denature the DNA from
the bacterial cell. The long, linear strands of chromosomal DNA
separate, due to disruption of their hydrogen bonds, and become
entangled with the lysed cellular materials. However, plasmid
DNA, being a small, covalently closed circle, denatures to a
degree, but the strands cannot separate. Once the solution is
neutralized by the addition of acetic acid, the plasmid DNA
quickly renatures while the chromosomal DNA remains in a
denatured, single-stranded state. Potassium acetate (KAc),
added along with the acetic acid, provides a high salt
environment in which the potassium replaces the sodium in the
SDS, forming KDS, an insoluble salt:detergent complex which
co-precipitates with the ssDNA, denatured proteins, and cellular
debris.
The alkaline lysis procedure (also known as a“miniprep”) that
we are using begins with a culture of XL1-Blue or JM109 E.
coli cells grown up in Luria-Bertani (LB) broth. The cells are
from (1) a single white transformed colony that (hopefully)
contained a recombinant plasmid, and (2) from a single blue
colony that we expect has an intact plasmid vector. The plasmid
that we used was 4270 bp. The plasmid inserts ranged between
200-700bp. By growing up the cells in an ampicillin-enriched
environment, we force the bacteria to make millions of copies
of our recombinant plasmid because they can only survive if
they retain the plasmid providing the ampicillin resistance gene.
Next, we need to separate the plasmids from the E. coli cells in
which they are contained. The basic steps of the procedure are
as follows:

24. 1. Spin down the culture to pellet the cells; remove and discard
supernatent
2. Resuspend pellet in solution I (glucose, Tris, EDTA) – this
solution stabilizes the cells; Tris
maintains an optimum pH, glucose maintains
osmolarity (so cells don’t burst), and EDTA
prevents degradation by DNases.
3. Add solution II (NaOH, SDS) – this solution releases cellular
contents; SDS is a
detergent that pokes holes in the bacterial cell wall
allowing the plasmids to escape;
NaOH is a strong denaturant of both proteins and
nucleic acids; it causes sheared
chromosomal DNA to become single-stranded by
disrupting the H-bonds maintaining
the double helix. NaOH also denatures plasmid DNA
but it remains double-stranded.
[NOTE: after adding soln II, tubes must not be mixed
vigorously; this will create much larger
holes in the bacterial membrane, and cause the
chromosomal DNA to be broken into smaller
fragments, which will co-purify with (and

25. contaminate) your plasmid DNA].
4. Add solution III (KAc, glacial acetic acid) – this neutralizes
the alkaline solution; the
glacial acetic acid (pH 4.5) counteracts the high pH
of solution II to produce a neutral
pH environment; at neutral pH the plasmid renatures
to its normal conformation, but
the chromosomal ssDNA cannot. The addition of
KAc, a salt, causes ssDNA to
precipitate since large single-stranded molecules are
insoluble in high saline solutions;
KAc also interacts with SDS to form KDS, which is
also insoluble and precipitates out
[NOTE: soln III must be added within ~5 min. after
adding soln II; because soln II is
such a strong denaturant, if you wait too long to
neutralize, even the plasmid DNA will
be irreversibly denatured]
5. After neutralizing, the solution is centrifuged to pellet the
KDS, ssDNA, and cellular
debris; the supernatant, containing the plasmids, is
transferred to a new tube

26. Purification of Isolated Plasmids:
Following step 5, we perform an alcohol precipitation to remove
remaining salts and RNA. Once the DNA pellet is washed and
dried, it is resuspended in TE. This miniprep procedure
produces ~5-10 μg of high quality DNA that is suitable for
further analytical procedures such as restriction enzyme
digestion.
We will be running the plasmid DNA through gel
electrophoresis. Since the DNA is uncut, the plasmid DNA will
run slower than the linear DNA that we have worked with in the
past. Had the plasmids been cut with a restriction enzyme they
would run at their actual length as depicted by the bands in the
image on the right (See figure below).
http://www.promega.com/resources/articles/pubhub/enotes/remo
ve-the-high-speed-spin-from-pureyield-plasmid-preps/
':rj,"iil.Eirida',(:l as":l;3 *!r-i;i1"1 palel{l}5t si ;}iGafi*+5
iF{ii.liliiai* 5l!,i}
*>gu!!u,fgt ,J! 4f lJv t-J !l! L t!!U!:?rt !> !-grJ!xg J
=sutJalFlJlJJ".4J =tJ nltJIJS*|lJ! logug
t4
#I
rllstlv "lill:)l1l[)
pJlltllll'1'l'lrllqtltlttlj0,i e-ll
r.! i i.if,ri ;,.i r ll ?q tj ;] i i
q r 1,41ir;1ri;1 r a.i:i ir);+ii-1i.,.

27. vtt)
nlrriord^ dnnrE rrtpt 'n:cnrlv3 .n n1 (1rIi1tr^1 rorr r-rrIr rtrr
9rrrarrtrto tt-glCIA 3g1 !e SUIIC1USLU +Ul Oa,l??US
ucu:;iuu ui iuiJ uJ!-
aplrr qrpasa.l:ar tmlpsn axrua qrrr '(mf,r u-piai-i755ii in c5iEe
E (if, !t.irrrla aia n5a-lairiiie a.iii et-i-ii e,a! evl-.'- rv v'i' v:at
op Ala^rpaJla ol 'urrorn aq] Suls^l LlSnoJq] ruJorr aql uloJ*
VNO aql peJlxa o] sei leo8 ]slt} alll
uo!$e4xl vNo
'af,uanbas teurouqe aql 3to a3uanbas ueal3 e ulelqo o] s! ule Jno
isasuanbas
lEr.lrouqe pue letxjou ]o xrru e uo^rS seq Jf,d Joud 'af,u3nbas
;eur:ou at{} o} {lEq s$a^al uaql pue paxru
sauoraq vNo leupuoq)ol!ru aq] /33uanb3s
leulouqe aq1 ul 'supdsJ.to pue Jaqlouj uaa$]aq lelrluapr
=- -:---:::--'::-:=::-::-:1a-::1:: -a'i::!1 ^::: tt:: .-- -!:!:-a::- -- '.^ --
--^; :,.'^ ^'- oii
ijii.vi.i- vtIU :Eljiiuuiiru+!* u; ;or.i+v* ai.i+ rili ruiiurj+u v+
uu !i3rr-u ;iiuu Ei- Ei{Puuqiu+iw ai.i+
Llllrl^ 'VN0 j.,rproqrorru aql ur punol sr aluanbas leurouie srql
'urnlpouield ol relu.urs %0/ sr pue
'r.ll8ua; ul slred aseq 00I ilqBnor sl 'ur8uo ruJo/v arr +o ]ou sr
aluanbas snll 'ua8oqled e uroJ1 palrJap
s! eluanbas leuljouqe srql pa^arlaq s! 1l 'paJrn3f,o sPr.l

28. uorlPlost str{} rtqra lno puu ol s! }uaruljsdxa srq1lo
ure raqlouv 'suollelndod palelosr ur pa]e3ol aie oruanbas
leuilouqe slql8u!u!e]uof, srxjo/rl aq1 'sruro/vl
:rr r+l-r?r3 ja ?/=*a-42 u! pllne! !-!"aq AlsnolAa:d spu :eu]
arrrenbas !gu-!-rouqp up a1q8!ls-=.1'-!! *1 J"=-ra
." ..!-',,9^ ', -,,aq i-^^i r a,r,h^h. ..,^^. i^ ,^n-r c,.., u!
+uv*rur, vqvt I lUJl , +!ui iyi,J uruFi^u J vou.yJu+rrJ vy+ vevlJ
v+ l,uwru J! ruvr-lruu^" rlnl
{5002 'lazueg) '1 lrunqns aseprxo 3 auroJqsotAl le'Jpuor.l3o}lru
pue VNOr sBZ real3nu lerued
q8norLl] puno] a:ai, sapelr ]3urtsrp AllerqderSoa3 Z asaql
{?g6tr 'llajrel} 'slar3el8 letrsol 'a}eradual
uo palmol aje suorlelndod lsaqgrq Jraql 'J3l3el5 uosqo3er aql uo
elquntof qsllliE ur pals3ol sr r.llri.lrvl
'=:::1 ::::::r:a-: _j^j '^" '^a'_-^ i
-" ' ' vpiiv'ui?-+iivi aei+ r, iv,+.liis-q rctiiuiiciii uir iaavlivi i s-
ri.i. ;arv-.i- uvJy:riEU sY+ uv
-4r-i1-t u! yo+cs-u:
sr r-{lrr.ltrl'ape1: ural{uou aq} s! uo!}elndod asrafip arour pue
rapp aql 'saop uo!}Elndod ra8unoA aq}
uaql A]!sra^lp lBauaB aroul seq uollElndod laplo aql 'raqto aq]
txoj] aujof, seq suoltelndod aql Jo auO
'sapelr uralllnos pue uJaquou aq] uaarnlaq uolsl^lp aq] sl
?lqLunlof rls!]tJ8 pue P{selY uaaryuaq rapJoq
aqt 'pep ujaqlncs pue apell uJaquou aq]'suollelndod uleu o$l aje
aJaql elllauv luory ul 'srulofv
rnc:rt:r{c rDrrrrrrc:rnrccnrl D(t5r5t11 l:drt ttr rolttStrtvtIlrnf,l
rIt ntlnnt dtltn5Itrrcrrrrnsfltrqsltr
+u rsiJ=ur i-iiHii v,qirrv- L ii vivq+ +vq!- ut revi;riff v Hf erv -

29. ! pvr iv+ v,! v,u!&
{5ooz'lazrleH)
'tuauuoJl^Ua alll u! uorlerper Jo lunoue paseajlul aq] 01anp
&qrssod sr uo,]eluauErd u| asea;cu1
sl.ll 'splaeJgqrua Jaqlo ol paJeduor aJe Aalll uaLl/$
uorle1uauJ8rd qBrq r;aqr s! luauuoJllua auarlxa
Jraql o1 uolleldBpe Jaqlouv 'a3r aql uo anrl ol trlaql Suralo;1e
'srujon asalll ,t uotleldepB A:eu;ud aql
clrrvraalrtonttnf,octtrt lranz,llzttettl
.crcortl=n:tnlot3r{ttt:r:tIrcDc:cpf}itttctttlnsfsfttitttntlnnt
J! Ul U +e vvuePvr r{v JtY r t a(rtrL v-r r+v-vvr&v
uqlr ar. ,^.r,,n4,r6 -q,h',.,^.,,^ .F^^^.n
GiV rv Jlerlel ys.i,l ey! OIV j,v J+errvqs ertgl ure+svr +Jrrw
rll?J ?Y* +uewuvrrrrue rrY* u! urrr v* rJeJvru
Jelnllat aql JoJ JapJo ul 'aAur.ll srlilo/rj a3r alll laA
'saJnlejadLual auIaJlxa q3ns ]e unJ o] alqe aq lou pue
u/vop lnlls plno^rl srxslueSJo lsouJ Io sassa3ord relnllas aql
'saJnlejedtual roplo3 q3nu }e lsnl'o8Japun
lla3 uetunq leq} sassa3ojd atues aLll Allellu3ssa oBJapun
sLuJorlA aql u!LlllnA slla3 aql 'fo0 le af,eld
a{el sutofrl aq} unllljl aleld a{pl}eq} suol}3par le3ttuall3olq
all} }o llv 'azaaJ} ialll slle} aJn}E.ladtlla}
rrrrr ct,!!n,.-..
=t!a c=<!! =!n1p!:c!!t=::t!1 !t .- .^r19 a4!! -!!!.!!!^=!^ -.1!!! .-
1!i=!!
=!!'!
nlijnP a-1i rq+ ii +i<ii.ii iiiifi r!_Jv,.. vr+ vee!,

30. --,,+riouuq+ !q+ +! j6rj i= diiii >u:rustiu =icrij iris!i cq+ iJiuri.
u+
JapJo ut ]r{8lu aq} Suunp anr}f,e aJe suJo/r1 asaql (p967
'11a.r.rel} 'a3! uo alll o} tustuPBro xalduol }sotu
aql puE '3o0}e Bulnll rraa; 'ueozslauj ale8rlqo A11erre13
$a8Jel aq] aJe pue sulJaqlopa aJe '(S002 'lazueH)
stsuaJatuleJ sn8nJtlos snap;]Ar{f,uasaW pup sn8n}rlos
snael}Aqsuasaln 'sLillot/ a3l Jallelg
a I^alnhna !tt aa dst+,r----+-a
aM pue pa/veq1aluo os 'uazor; sei uollnlos srrll 'ozH pue
'asetautilod 'zp8y1 NtuE '{5002 ';azpep)
(rrws:gl-3999rtg]Vrf ) 7'g rauud .E lllr.u B'0 '(s002 'lazveg]
{gwsvf:rnv99rlD!.v9)
1'5;aurr.rd .S ntrw B'0'sdINp t1lrx ,'0 '{11O 'Et41 'eN 'g'L pd
sr.r1} ra#nq {rols xgT sr q:rr.l/rr ra}Jnq uort3paJ
:rIt cr:totdrlrSl frll rn nannrllrr .rrprdtrt:t D arDarl n1 gil rl:rc
rcttt arrl ua r tnt :tprl:td nt
vYt Jt v+elvwvt vY+ v. tsvP. rtvvt v+ervwv+ ! v+ve.J vt *,tr
vv+J +,-t+ vY+ €. rtt -v+ u,ev.dv s+
u3d
':j=.j si p33;": ;-q -3i v;,ic
=.i-i
jc il=3 i=.:i=;=*3ii
=r-'--.-'i
'V;.jc

31. =..i;
3,:,ic:sip
=i
paxru pue pappe serv ozH pallllslp aJoraq salnurtu 0I JoJ fup
r;e o1pa*rolle a.rarvr spl;ad aq1 '8ull.lncoo
ruoJJ suollleal JaqUnJ luanald llrrrr loueqla lenplsal Aue
';oueqla aq] Jo llp a*oual ol panorua;
se/v lupleuladns aql pue salnuru o/vu Jo+ paads xstu le
pa8ntruluar ararn saldtups aql 'paxauon
ararvr saldu.rps aqt pue a;dules qf,ea o1 pappe se/v touellla
%O/ 'slles aqtr alotlral pue 1a11ad aql qse/v
nr .h-Anrrrrr cDli arrDlolrrrr{nc:trr nrro rlrtlrl lrrr 9Irtlo:r
rrrnrr Hf,rfl f rrr lr13Af rrl nr:Elnttn!r31 frrr rrrntr
v+ Pv'rvwv- rerrr tve+ev Fee +vllvv vY+ !urrrevt wvr+ v tvu
v!a +vv,rv-u v+ vv..+r{Evv v{r sv*t
i.'i...^'i -.-.. -^.i... ^r ^^rd'e v^tar 16 .^^E^....".-^
Perrvwe, .rl*uwvru ef,e.rr JsluwcJ eYI v llu eY* +JellvJ v+
Peeur Asw *c Je*r turw e.r, rvJ, yeur rrlJ+veJ
a'tarvr salduEs alll 'suertoueu ,val e {uo tletus fuan s; VNO }o
}unoure aql 'uol$los }o }no a}e3orre
o] vNo aqt arJoJ 013o0g- le paJols ararvl uorlnlos ]les pue
louEl.lla aql q}!ia ssldues aql
'lno lle] otr sa:a1d a8.re; Alr;e; u! aq ot paau plno/v VNC aq]
pue 'uollnlos u! rtels uel splre ou!ue alll
aal-^=1--:::::=:::a --.:'a=a-:-a: =a---:::-^-:li:-t:: -^-- :=:-:5:=.-
!r::=: nlal:==:!: /::=:^l: ::l=9s
=-:l- =:=:-l t=::''iI::== Je+.,tvJ s+v*v{s
+vq uy Jv;r r+u-eew

32. aqf 'alElldlraJd aq ol VNC aq] s/vlolle slr{} VNO aq} rl}l^ u;
3u;11;1 ruorJ ll Sulluana"ld ':eln8allg s! tua^los
JalB/v pue loueqla aqtr pue sauoqlleq aleqdsoqd aql uaarvusq
aEpuq llEs e saleaJ3 alelasv runrpos
aql 'xttrr 01 paxauo^ pup loueqla o/os6 lo saunlo^ aajql pappe
uaql aA 'saldules aql paxtut uaql pue
'Z'S lo Hd e LlIflr lVeN y{ t Jo aunlo^ 0I o} T e pappp a/v
saldues pap}tdl}ard aq} ul 's}allad Suruleluor
rrlsrra rn nMf rrrrM c:rdrttpc L narDf rl linrr lAarr:A^ 'rnrt
atalp nrtp narptrr{t1arr{ =t:m c:Irlttloc wvB+ +v vrrr+ Y+t,.r
JvlvwvJ y Pv+Lv-g ,.rvv v.rvY vrvl +vu v{v,rQ Pue tsv+e+ru.
Jvls*.L,
- ,--.,i...-- ^.-..".--.n.... ..r^r..E.d el+
rv c reluwLJ rrreu c e+Eerr u+ c v+ur Petr!rr!P erE.fr Jeluwsr
eYl rrrYeP ller lruE +uewsru PeutE+uvr
feql lallad B paleaJf, srql 'paads xeul le salnultx o/nl Joj
pa8nlutua3 aiarrr saldues aLlI
'salnulur 0I ra, fo96 trP palssrl uaql ara/$ saldues
aql 'spl3e oulure lselut pue vNc pelul sr aldures aql u! luasard
'uo!]eqnlul Jnoq auo aql lauv 'ui/op
==-1:=a:::=i::'i==:-a:i!.'-.'. -l-=:::'::":1-^--- r!=_J"_.!- ^'"' _"'---
'i
rEiii-Jilvq+ ,:EE;'ti iiiiii,ivia+ uiiiuii uv4viia UvEii oilC -ii rui-
+uju -q+ i.v !ic Er-ui-i -iiirE UuiUa u+ui JuiE+Uiu
aqt u/vop s)|esjq ) asEuraloJd aql 'Apoq aql ul ulaloJd luepunqe
lsou, aql 'sauolslq Aq snalrnu aql u1
dn paSelred sl VN{l aql 'slua8ratap }o asuasard aq} ur a{rl
suor}lpuo3 r{sreq ur $lrortl pue'{}saq sl f,o5g

33. -SS) saJntpJaduj?l q8lq fe lla/n $lro/'A tl 'snBun} e uorJ pa^uap
sr leql atx^zua f,Ur3adsuou e sl slLl] 'spuoq
aprldad 3q1lsa3lp lll/v ) aseuraloJd aql 'Jnoq auo loJ 3os9 le
qleq rale/$ e u! paleqnlu! uaql aja/vl
c5dhaarrr .crrr{rrrocrrlndrtrn:rorrlcDAlrrnrlnr6ccrrrr
,rrnrllDaISrrrr{nnr:r{c^1 tSnrnrttnSlDrlrt3lrrnl
reqr ra uql JrtvwvJ q+v9 v! PvJuts Ju,ri uvr+r rlvJ JrY+
svt+ruv'.*q+ ur r PvvvJ v+ .vF.v vr P--'+v.+'r:L'rs'-'-'
^.,^.,. i.^.,,*.,- ^....^ .,.i +.*'.-^-i i1....-.--*.^^
ervtJ ,rl+Herl nu ur lLr+rrou Jr uvr+r'lvJ rlYl , srLu.e+vrs PUE
rlr! sursre+uuJ Pe*Ee.r
sefl uotlnlos sul p 'eleldtuor sefv Buttf,A3 aLll Jauv 'sal3^3
/yreql azaar+ aql ol papafqns sB/y ulJofv
aLll pup 'ragnq aql u! pa8:auqns Allnl aJarvi sturo/v aql aJnsua
ol paIoaq3 aJaq$ saldues aql
'ra#nq e u! {ron Aluo 111r*'anssr}
, ^.-. i-',- .-d- q'.'..-. -i.^.. r^ . ,^ ..;
vUi iicciu ui uEpEvu ;*;iiuo oq+ ;ri aicu!E+ui.J +iLuE uui!!.+
*uit yitu oY+ +usrioiu ru!oY 5 f +u nu
e qtr!/v ra#nq Suo.lls e sl qlrq/n ',sul aq] pue ',vNo aql JoJ
suolllpuo3 alelJdoJddE aq] ulelulPtu o] uollnlos
ut tuasaJd aJe lf,)l pue zl33!l aql 'saloq 8ulteatc rarlel-rq e u!
sprdll palled {;reln8al }o aueJqruau aq}
ldnJslp r{l!qrr sptle
^ueJ
Jo pasoduor sl }Er1l}ua8ralap e s! uaafll aq} allqm Jaztllqe}s
ula}oJd P se spe

34. u[ela8 aql 'ouH pue 'u!]ela3 %s0'0',67 uaarvrl %sv'o ',r:x
ruz'o',{o'e Hd} slrl tAI "l3Bk! NI paule}uo3
rf,rrnn rrnrrlDrlva alrr .13rrnn rrnrrlprry= rn rrnrlrnnD 3rtr
rrlril catr{tttps 7 n]ll! nA'!P.-3!1 rt.ttttM cttllns nAAl joiiiiq
uuiiiLi+,aE aq L iu++:iq uui+rLi+,av iU uU'i+iFpE
=q+ q+iiii JEi-ur- j a- saui tsv+uv-r HJ!Yrrr
'sa!uolo3 allqfn Jo ]unoure afuel e alnpoJd lll/v paleld
.--....-^.; :=-.-..:-1 ::::.aa i=::-^.'- ^...'--'i a::.: ::::-::=:-a::t::
ijgq,.1.i ii-Jii,i,a,i '.Ji^;iarjeiil rju
iaiy rirvrr;i qf irr wy-* Je,,, ,s,+svv --y+u-uE i,iiurii Pi*rE;iil
(,ri+ +i uu!+E!iiiiirsi
JO lunoule aql a3s ol uasut ou q]!mr apeuJ se^ aldujes loJtuol v
'pauaAu! aJa/{ pue 'A;;auq paSnJlJtua3
'paxagon aJa/v uorlnlos uolle8rl arfl pue luautel; aua8 IOf a$
qlpvl VNO leUpuoqsolttu Suguleluot
s1a11ed alll 'Jaqlla saleqdsoqd uleluos ]ou plp luragd Jno os
'saleqdsoqd uletruol lou plp lcnpo.td
trd lng 'qfual ul qI I o1 dn 's8ueqJano I ,€ r.ltrl/v
s1uau.lfler1:rd auo;r o1 pauBlsap servr luagd 'pasn
lol3aA eu,tsegd ar.ll 'Sululol s$=sut pus spl'Jseld a';] lo a-
lus!,|f, sul assal3u! o] lspJottl pszluriuitx set*
Eiii i ;ul oi oEooE seir.l iEui uoiritio5 uoirb'Eii ic Eruilion iu i
'u$iiJEai Siji ulii,'v.t ;j;ijdlu! liiiyi ii iojoiiili'
zoi'ut,{l;"rrrr8 ,o,rur}uaf,uo) e sl'araLl}'}! pu* '1or"ri18
suleruoeauAzua aseatt
"t{i

35. 'lalerv pue 'tagnq
y7 'pttuseld 'aseBgl 9691> Sugureluo3 apptu seA, uorlnlos
uo!]e8ll V 'fup lle ol pa/vtolle aja/v sa;dules aql
pue 'parouual sefl! lueleuladns aql 'paads xeu trp a1nulru 1 .tog
pa8n3;l1uar 'paxayoA uaql a:arn saldues
aql 'uo!]nlos olu! Euto8 uoJt VNO aq1 sdaa>; loueqta aql alrq/n
's{ss aq} sallosstp Ja}enA all} 'pappe sen
l--::31:t=:-.-^-_, :ta::: .-=.1.11::=: !:=t:: a:..-1 ,^tF- -.!- r. '.'- a.'-
...--..^- -^,.^i -- --^J-
satnulu g "lo; pa8nlutuar uaq] a:ar* saldues Z aq1 'pappe aral{
louptl}a %SG }o ssunlon g'7 'Suqxayorr
rauv 'xlru o1 paxauo^ uaql pue pappP ser!^ z'5 gd ryep H€ *o
aulnlo^ 0I/I 'uollnlos Jo lno vNo aq]
alelrdr:a;d o1 'fuarocal %06-08 ue sn 3urn13'la8 aqt txorl
patr3eJlxs aq o1VNO puE Jate/v all] pasne3
sll.{t '1. paads 1e salnulul € lo} satlls ;a8lno Surure}uor
suunlo3 aq1 pa8n;1.t1u43 aAA 'uunlo} e o}u!
n:rprr{nrron:rAnrlrlrrf^
cnuDnrn^nr!D'rn'rqp[AtaPattr'na'!'!nnttn'!spA^c!sa!nl!f!Lr!rr=t:
t:rtv iicJalu iiua ijorivuEi gjEiii iiius'q jl i!' -PUi +i ii J-rii isD
e-!a+ P-+Ji iPuue iLrir J,Jv.vYevrtrvlv ,vffv
uoReH!'l
'uollerPdas,o aleJ aq] palloJluol r{lu0 t{3!qr 'ftll;'Ipa;a
r- !!!1 ,.4.- !=-!:- -,F^r^,!d^,.-^'^:=*=:.: .:=Y!kr:=!= -=-=---: -
::= r-::ti:
tv wJrrrr -.,; ;U,.=r:ijjiuqi.iU;;-'aio isJ qrri i-r truiEUC Eri+ ui
iliatii U+u! uc'*+ PaP=U'! iiuE y-EouJ
xeu 1e spuof,as 0I lo1 uaql paBnlpluai 'satdues alll paxayon
am'VNO 1o sa;drues Z Bql ol aAp Sutpeo;

36. y1 8u;ppe lagy '(a8uelo 'dq 661) a8uero aulptlse pue '{an1q
}q3ll 'Ql 7) loueir aua;ix'{anlq llep
'dq OOS) anlq gouaqdouorq '1o:arA13 %0I ]o patsrsuof, raJJnq
3u;peo; aq1 '1aB aql olu! VNO aqt Sutpeol
ro] papaau osle serv raJ+nq Sugpeol V 'azllensl^ dlaq o1
'ap1u.to;q unlplqla pue 'suol ]o uollelluaf,uo3
arrrDc srrl aAott tcnrrr r:9 =ttr r{rl"tttr,!ala! l.!nnrrnl nt cttnr
crtolrrnl rrttttm 'tattnn{! vT P nannp a-iu'ta? eltt suij E'ri+
aiicrt
+iiiu io! oi,i+ ii+ir'ii+iEiE +riiiiUU'i U+ iuv'i ruis+uu'J liriil.iii
i-*iiVUlL iL ! PvPPv v[r lvv vY+
ri5ii^riri/iiiiiiii5rriiniiii^i^i
rrnrnrii'r:F5CnioFouo'oQi4iqia5eniSFrri!
'i?!S.,i.Otrt.iAiU:=fQ!gdai
i=:rl';'-i+;:+,--.;;;s,=tr;r-s-J- yr;tF;-;t tir-u;;J! 7uo v - *-."r--.'1--
--l! --:*"-l vllv -at
ol papnpuot aq plno3 sgsa.roqdo.rl3ala lell] os ga8 asoJe8e olut
papeol ualll alafi saldues aq1
crca rar rd^ rtn5rlGA rt,v-vi5v-+svl3wu
'pua ,E aLl] oluo lle1y llod e qf,Blle 11tr* bel aL{l 'uolsua}xa
leu!, p 'a.loutAue {Jo/v tr.usaop }l lllun bel ol asn o} se/n
s!Ll}'sa}nullu aA!} toJ 3azLry a;du.les aql pa}eaq
aA^ Ufd aq1 ap;dtuol oI 'aqnl aql Jo dot pue sapls aql uo
paru;ol lerll uollesuapuos Aue anouta.l
u+ioyi,aoq;yo.!iii:i;ij-3,+3=if,nrS,rrii,:ij3,'r3:=ljs -5pUu;-
35ril;=jlr"i,,JFu3'Spirv;vr=9ju+Jiar
'alnultu I rol foZS :sltnletadu-rat pup saurrl Sulrvrollo3

37. aql3u1sn sau;1gg aldules aqr palrAl ualll aA
.spuerls a;3ugs olul VNO aq] aleredas ot satnuru o/$t JoJ fotr6
te Supeaq Aq ueBaq aAA 'snoaueluelsul
lsoule s! a8ueqt alnleJadual aql asnelaq 'Ufd op ol rte,v
luall!#a lsou aql pue lsalseJ aql
st ]l asnplaq U3d Jo* poqlau lenueu alll pasn aM 'pauluJalap
Atlelljldura sern ajnleJoduatr sltll 'f,oZS
s! tseq xJoA.r plno.s ierll eJnls;adrual 8ul1!aru 3Ll.L
'as9Jau,r.lcd be1 atll papps 3;l.. 'll 3sn ol Lpeel eJer
's3tEijil ii-qiyui
pue Hd aql uleluteu ot Japlo ulVIol pue srJIlo pasrJduJo3 selvr
tlf,rq/a'uot1n;os iI ut papuadsnsa.t
uaql ser* aldues aql 'AJp Jle ot pafiolle serv pue loueqla %02
tlrl/r paqse/* spn alelldr)aJd aLll
pue 'panoural se/vr lueleuladns aql 'salnulur S JoJ paads xetrt ]e
pa8n;;;1uar sp*1 pue lotlosle lAdordost
Jo aurnlo^ lualenlnba ue Surppe {q parerldl:a.rd uaq} setr
JaAel snoanbe aql '}dal pue panoual sp/v
eiuseid Jno pauiEiuo] iiirr.l,t1 ;aAei snoenbe io doi aul 1s;aAet
Z oiui aiEiedas ol aiC'.ses auif'9nes q3ii.i,1A
Saliluiuj z ioi oadd5 xEiu ie oaBil;i;ru;: 'Dgx;lio^ 5ei,1 ai'.iujes
au i 'sui;iojc DUE SDidii sa^oiij;j uiiuiyi
'laAel uro]]oq sr& uolJ pasn serv louaqd aq1 'e13q3:aqa Aq dn
paueal3 se/* sltlt'slrqap letla]teq se/v
trueleuJadns aql ulrtll1 'papaau 'ta8uo1 ou seil 1ag;ad aq1 aruts
1da>; pue patoular seffi lueleuradns aql
lsalnurul 7.ro; paads xeu le pa8nluluar uaql aja/v sagdues aql
'lla3 aql u! pauleulaj VNO lPuapeq aql

38. a1;qm ?no auo] ot yg6 euseld aql Aguo parvrolle slql
'sauerquaur sllas lualadu-to: aq] *o sauerquau
a_i.ii ui :cic:.: ii:i;s .=eituici 3uc;i;-,ic: E <;58'ji u: siisi
ius;Ggixc3 siii i-3 !uipu=ds:':s=i si.ii 'p=:iii.ij
aJati suo!]nlos aql pue papuadsnsa; A;1n1aJa/n sllas ]ualaduro:
aql aJnsua ol Altua8 pailalul uaql aJa/v
sa;dues aql 'Z uollnlos azlleJlnau ol atela3e urnrsselod puE plle
Jllaf,e;o pasudu.to3 serv E uotlnlos
'auerqulatu s,euatf,eq aql u/vlop IBarq ot sdlaq leqllus8;alap e
st qlllllvt s6s %s'0 pue aptxorpAq
uJnlpos hl7'3 Jo pasg.rdruo: ser{ z uol}nlo5 'Bugsrnq riloJ}
sllas aq1 daa4 o1 asorng8 pue (S'l gd} strl
io sesl.iduJcs seru i uotl*lcs 'suo:lilios s ur papuedsnga; senA
i=iied aui pue 'penoule; seti lueieu;edns
,.^ r-^..-j
^1 .+1^rr!!!t - .^, ^--El:r !1!!11 a,:-t- c:rrilt:=" 1c1!! ! .a:11:l:.al
eq+ tiJ lia +elleu lelre+Jey E wiu, v+ Je+liuiu C ,v, yelrrjlr+usr
ererrr reluwEJ eJeYI Ye+JellvJ
aJa/v spluseld aq1 u;e1uo3 ol uruoul ajefn lelltr saldues aq1
'ullFrrdue
^au
pue 'p3sn Alsnotna:d ;;ao
DSHo aql O] ulerls leltuls e are }eq] sllal rlol a are qf,rq/n
's11er 1ualaduro3 50Iyllf pue uo!]nlos uolleSt;
Surureuat Ll]t/! auopa; se/n uollpE!l aql 'uoqsu!rxptuo3
q8norql pa3npoJlut a;afft leq] elJ?peq Jaqlo
se/vl lnq '!1oc a lou se/v saleld aql uo tly*o.r8 lerJapeq srlll
'llnsal aues leqt pBtl ussul ar.l] qltrvr ateld

39. !..t:rrn1 =!!t .M..-rnl= !Dlr:11=c tnt!!na'!!!!3 aX!pi p ctr.a-1
=!3i!l
np3lc::! r!!r.'aa'!iF-{:.!l il==i! 3.n.!! n!n-^.!!.3!3!!1
iU'l+uUJ viii 'qiiiiuig iVliY+J=V +u +uiiU#= eDiEi s JErii Eis-
!i+ Fi=+ru. Y+i.rvE vv svlY vireY PlrrvYJ v,vY+
u1g11t;drue rltlr* aleld lorluof, al.lt uO 'seleld aq] uo u*rol8
pell sua]f,eq Jo urnet e pealsu! lluasard lou
a;arnr urvro.lS aneq o1 papadxe aJaA leq] saluolor aql'su;a;qold
asaql ol ano '{padold Eutuoltrcunl }ou
se* leq] uq11lrrdu.re Jo lJow lou plp leql sllas lualadu:or ol
anp InJssaf,f,ns lou ssl,i Eulreld sltlf
'paleid a:ann
Siiir:iAqiiiiiiirii;diiv re+aiUiiijiji:iiiirq.-r-vrPeie{r'JtlyuE pe^.t
rll{qss },ePyerE,rruvt+rrlvrsvr{csll
aql'af,! uo atar6 s;1ar lualaduor aq] allqAA 'aptJolq3 runtf,lef,
plof, ul papuadsnsal A;1uaB servr 1a11ed eql
pue 'pa;roual serv lueleu.ladns aq1 '1a;1ad e olur slla3 aq]
ssalduror [1lua8 o1 paads xetu ]e spuolas 0E
.ro; pa8n;r.r1uaf, ala/$ s11ar lualaduros aLlI 'auerqulau aqt
sazlllqplsap qstqr 'pappe se&
'l]eJ ntru00I
'lualadulot lla3 all] aleu ol lapJo ul 'Aqlgeaq aJa/v pue 'pco;
'ua8Axo Jo lunoue lual34Jns e peq
,.^tai.i} :sSeUCi 5.3i ul Sieiyr. i.iiii.i,'ft ':i.3i e iO Uieiis
ieilelsSq e 'EqH'C 3i3fr... p39n 5iiSl' ]uslgGiji'33 3ii i
'asopele3 d Aq apqes{olpAq 1ou sl l43lqiv gldl
1ru/BtnggT pue lVgX 1w/Ewg7 'sa1e;d aql uo peelds ara/v

40. asolssl sltxlul ol aseqluls {lerltlaqr are }Pq}
s8o;eue asolf,el 8u;*ro11o; aqt tas atarvr sa1e1d alll JagV
'ssarord uolletulolsuEJl aqtr ul Jalel pappe aJa/v
trsr.ti slles lualadu;a: aul 01 saleudsaltd pue 'sale;pAqoqle3
'spl3e ouiu.:s sap*c;d slql '*ucldfu}o}:eq
iiiia riRaiiv5 ieaSi ,i=r6ii *iiiiiiqlii,ia ii-r/-ri.ai iiiiihii
iliiaiiiiiiiifiiiiE iilili.r-n{tT ii.iiha 5M saiE!d
='ri r-- r---i'-.= +;==.-: iJ;:ii -+:-..i-r-- -+J;r- r;"j;rt r-- j"Ill-::+*
l-, l"vv, r-rr* *'-''-'-l-' -li
Sut.redald uaqM 'sa1e;d letJalleq lno pa:edald arrR
'uotletuJo]suE:l 3ulta;duror ;o; aledald o1
u{rllPurre$u?Jl-
gZ pue LZ slla/$ otrut papeol ara^ soldures s,dnor8 A61 '"rcd
Jno Jo stlnsar slsaloqdolpala 1aE aql st 1'1 alnEtg
I'I aJnau
ri!'lri,::i;'i:i:
'UJOrv uOsqOleI
leruJou e uIoJ* seff paulelqo sem leql asuanbas aq] Jo lle
:a3u3nbas leuilouqe Aue auolf, ol alqeun
alam a/v 'suo11ecl1dtuo3 asaq] o] onO 'Eur1e1d 3u1.rnp
arnlleJ aql pasnes lelll utlll)!dure EuluollcunJ
-il,tu 3?q ii 1f t3 fruE 'i!Jadr=i'j Eii!r,ie'i+:uni a-ia^ si:il lt-
ia]+clLUal ?r-l+ iPqi !aaj ! 'saiuaioa aSlt{ri ptiE
anlq aLlt a3npoJci 01 alqe aJo/v arv leql lreJ aql o1 ano

41. 'uolleulueluos txor1 ellapeq Jo Auolo3 e uleluol
plp osle 1nq 'saguo;ol allq/r pue anlq parsap aql uletuo3 prp
sa;du.res lno JoJ pasn a/v leqt saleld orvrl
aqt Jo aug 'ur1;lrrdue Suluorloun;-uou Jo sllal lualaduor
]ualaduotu! Jar{}la ararvr 8ut1e;d palle} aqr Jo
sasnef, dla1r; aq1 'er;apeq Jo u/rel e qll/vr urvro;8;ano ara/t pue
'papadxa aJoAl lelll saluolol al!q/v pue
anlq aq+ 3u113er a:aan satrerd aqf 'rn+ssa:3ns se lou serl!
luauruadxa aql Jo ssaeold Surtcld aqt 'spluuseld
iiii i:rlt!: !tiEsii: ini aii'r ;I?-t niii, iini-1rr1;1lriiii? i:iii
lJailiii1i-t1 i-,1 iiijP A1;n;<!ar-'ri< FI!^^ I4i FliiiAl 'sii!ioryl
atq rarre;3 ]o %0€-02 u! puno; uaaq AlsnorAa;d seq
leq1a3uCInbas letilJouqe ue a1e311saaul o] Japro
u1 luau.rflel; auafi (IOf ) I 1!unqns aseplx3 J auoJqlolfif arlf
auoll 01 pau!e luautladxa slql
nr 16 -t r---rr
r5e rrl..JvG
'1aB aso;e8e ar{} o}ul papeol alarvr saldues aq} pue 'pappe
se*i aAp Buioecr x! e 'l:LE 1E salnuiui ST-C1 jo] oeieunlu;
arem saldues au i 'dq nfS iii=qs s: 'if,ii{,ln
uasiji 6qi piiE q,i € si ijliq/v p;ii;se;d 6qi 'vNu 1o sa;ar.j jeaijii
z ;.ri-rpo.id iiiii-r .riro Sui,jdo;p pi;e Bi;iiil-,;
sll.ll 'uasut aql trno do.rp pue lnl llr/s 1eq1 atuAzue uollf,lJtrsar
e s! qf,lq/$ TZOf,3 pue 'VNU Aue anoual
ol asVNU ,auu[zua yog 'tagnq XOI 'VNO :Surrno;1o1aq]
8u1u;e]uof, spetu sB/v uo!]nlos V 'papnpuos
aq o1 papaau srsa;oqdol]tala laB laqloup 'a;dures Jno lo

42. uolte3qlrnd leuU aq] alalduoc o1
:.r.ii;riii!l:{=l
uoRer!*und
'oq 00y ]i-roQE nijiaq +iasiji aqi
iO SijGllEllafix3 jir0 ui0 iJASEq 6iEirrliE
sl slql 'dq OOOI-OOS uaa/v]aq sl qlBualUasu! aqt aroJaraLll
:ql fS'e te punoJ se/v uasu! alltr Sululeluol
rolf,aA aLI]'qIE se/v pasn Jo]]aA atll t€ql aBpal/vou{ aq} pue
Jappel lllpulH epquel aq} uo pase8
'Jappel lllpulH epqrxq aql Sulsn pazAleue serv slsaloqdo.rpala
slql 't'I atnSp u! u/vloqs ale sllnsaJ
aql'saldues asaql Su,lztetun slsaroqdortrata taB raqtoue
palalduror aI 'atull srql saqnl uoltetg 3u;sn
JU9W|J9UAo JtrU pottUtlUVJ grvl ltttJJgJJtt) JErtt UVtlCUtl
Jtqt gJUt p94tJgttlJJtJgJ tJttt ptwJttu gqJ gJgqrtl
aJe saruolof, anlq aql pue 'lnJssalrn, ,.* uo11eBr1 aLl] ql!r{/v
u! saluolo, aJe saruolof, a}!rl/v arll 'ir;uo;o,
anlq pue allll/n qloq rvrarS 1oJ1uor aql pue ',saluo1ol an;q
rnar8 vNo3 pauletuos leql JoJluos aql ',sa1uo1oc
ou rvra;E sllar lualsduror ]snf paureluo3 leq] loiluol alll 'sllnsal
papadxa aql paf,npold pue 1n;ssacons
alarn Aaql'pa1e;d ara/v sllas osat{} uaq111 ',);ilfrf,,
punorSlreq }o }ol e parnpo.rd saldues esaql'.ranarvroq
^^,,-6i-^- "^-^.a-^- ^...'-:.'.- va+ rvY
'
na rallloue uoJJ se/vr saldues

43. ^", "ir".,r'ol
prr"rrtn3ou! ol pasn se/v 1eq}vNc aq1 'urnor8
Euraq s; etuseld lerltuapl 'a1Bu1s E leqt arns aq ].uef, noA pr.ll
pl poqlatu slLll ol lleJu/vop V 'arnlln3
prnbr; e uIoJ] saqnt uor1e81; palelnsour Jo1rnJlsur rno
'luautuadxa s;ql JaAo3aJ pue fu1o1
'auPl s/dnoJE Au, sarJluspl
ivoJJe aq1 'rolran prurseld ar{l olu! paleErl uaaq seq leq}
}rnpold "nd lno tro slsa.ror1do.r1ra1a ge8 aqt sr 7'1 aln8tl
7'1 arn3r3
I
{tg:N) 'sruro/v arr "rane;8 rc snbn!1os snao4lquasarry | }runqns
eseplxo aurotqcolAc
se/v qlleuJ %gGV 'surJo/v paluatu8as n utruoTaudotlds
pfilaufro3 '; lrunqns aseplxo aulo;qcolAr
JoJ se/n L{3teu }$!, aq} sulato.td ro} palselq se/v euerJ
Eulpea.r uado aq} uaqrl 'acuanbas aql ut spne
ouluJe go 8ut-tgs lsJ!] at-l] sl sltll 'aurlP^ e *11-/v spua pup
'auguele;I-uaqd e q11r'n spels '8uog splfe oulLtE
=a rr rrrttnlraa arrrt '^ arrrhr r F Al - itra 1n h11nlnr cr rrrrnrr
llrrrnarr rrrrin rrrr .iraarrl ,ar16rr^rr^Alrrrr
c vde,f rc -+ rl vI+ *v toJtrr, te.,t,svr1ev*.*
lspr ;etped 'aua8 (lOJ) | llunqns aseplxo auolr43olAl0ZO aletosl
'stilJotyt au non16 'sndnfips

44. snaottritpuasarry se/r,l qllet! ulselg ]srlJ aq] pue 'palselq servr
a:uanbas a^oqe aql uaq^
J]vV5ViyJVVJJJrVJSJij.
V9WV9V9IVIfITV I I I I I VILTYIWIVVISIf93IVILI-
V3IYILLTf,33If,99IIIVf,IffI9
IgVI9TVVVS1WWIVILTVf, gIVgvf, 33VITV9I313VI9 33Y9f,
133 gIW9 9V9WI[V9
9VI3lILtVfWf 9fl3 I r I I
1:)f,ffiLtVW19V99ItV1ltV1W1131l3lt_Wf1f 9VVVVJI
V9JJ93VV3I V3f JJVSVV.ttVggff
VII[VJ3V]33f,}V9I3V313VJJ*Vf 9V3 9JJII}VJ3 9
i i iViaiv iltiLirtlilVI,LivLli iViaiii7i iV i ii i iv i i iarviaiv-
lLiiI,l ti7li7 iV IVLIiV iVi lr)i
ouicv evr:rr rrrr:wviivuuvuws grroorr r g r rr svlvr:vluvrr-iuvu
IV99f IV13 9V9IVII-VIVIf, f, 1f VIsIf VIVWILVIWIf IV9 gIVf
VItVf W3 gVIIV9II.9
VILTVI9VffiTVI9 9Vf W33f IgVf 9II-Vf IV9IWf VV3 gvf, gvf,
Vf I.I.3VlVf, 9V93V3V
IV9VI53V9VIVI9 9VI9I3V]ILVIVIVf, f, WI3
9V9I.3}gItVILtVggVlf VI9V3 gII-VVg
=-.-i:^-r--':'-a-^-a::,':
l:.-ar!:-,sr--.rQ-:n..-^-,-na! rL.a=.-./!-.-.'-,::=.r--a,"--=.L.=r--.ai-
-,!a-LF-:^-=,::=-
ITVf V3If ILLVf 3 99993IT9939f
3VILLTWILLIVIVIVI3VV9V3f IVf, V99ILT3ITV9
:srYolloJ se sr aluanbas aqI 'uro/v
lerre;8 uosqoser e uoJ+ s! a3uanbas aLll'€'r aJnSu u! urrlor{s
slleq] uoneuJolsuEJl auPs aql uorl
'sauizua uorlf Ulsal Eursn palsa8rp

45. se^{ pue saqnl uoqle8l; aql u| aceld lool q3rq^ uo[euiJo]sueJl
puof,as aql Jo, slsarolldorpale la8 oqt sl g'tr arn8rl
€'I arnSu
A1,31ZlZ1,-Og/5'satnpal '31el3 'tau8etr6 nH
lalusq
,uleq5
@.{tg:trt)Uo!}PUJa}uIi8opuqra1o|gJo}Ja}uafleuo!}eN
.a8eul;
EIaT-9OZI :Eg'looz .r .ue3
(s1sua,ta1u1ot snbn$1os snao4At4tuasary pue snfinf,ps
snao4it4tuasallg) surom aa1 ,la;re;8;o AuaSolAqd
pue uorlnqutsl6 '5002 ''H leruee 1u;eq5 ''J eu;1su;; 'olq3lu
''1uos.lag;a1'ua1qE6 "'l qned llazpeg
€19-999:65
'uogn;on3 reln3ap6 Jo leurnof'sauag pals!f,ossv-c$a8;au31o
alua3;an16 :sn8n1;1os snaerlAqruasayl
'ruJoAA ael aq] u! uoBetdepv JqnralotN 'bAOl. ''H lalueo 'ulerls
''V ! tsu)l 'u!a1suaqo11 'g e;aBuy '11e;re3
se usJeleu
We have a small sequence from our clones (most were just
vector). Here it is:

46. ACTTCTGGATGTCCAAAGAATCTGTATTGACTTTCCATAT
TTTTTCAAAATCAGATCTTT
TCACGATCAATCGCAAGCTAGTCTCTACCTCTTCGCCTAA
TGGCAT
Here were the top hits:
Select seq ref|XM_014443147.1|
PREDICTED: Microplitis demolitor odorant receptor 13a-like
(LOC106693828), mRNA
44.6
44.6
35%
0.29
87%
XM_014443147.1
Select seq ref|XM_005292340.2|
PREDICTED: Chrysemys picta bellii laminin, beta 1 (LAMB1),
mRNA
44.6
44.6
40%
0.29
84%
XM_005292340.2
Select seq ref|XM_007065660.1|
PREDICTED: Chelonia mydas laminin, beta 1 (LAMB1),
transcript variant X2, mRNA
44.6
44.6
40%
0.29
84%
XM_007065660.1
Select seq ref|XM_007065659.1|
PREDICTED: Chelonia mydas laminin, beta 1 (LAMB1),
transcript variant X1, mRNA

47. 44.6
44.6
40%
0.29
84%
XM_007065659.1
Select seq gb|CP002792.1|
Methanothermococcus okinawensis IH1, complete genome
44.6
44.6
49%
0.29
83%
CP002792.1
One sequence was obtained by the class efforts (the other two
were vector only). Of the billions of sequences that have been
deposited in the worldwide sequence database (GenBank), this
sequence is unique (i.e., does not match any known sequence).
The five closest sequences are shown and were determined by a
BLAST search. The description of these five sequences provides
the only clue about what type of organism our sequence came
from and what function it may have. With this information, try
to formulate a plausible description of our unknown sequence,
keeping in mind where the sample was collected.
I don't have much details but let me explain, in the beginning of
semester my class and professor had a new unknown soil sample
from North of New York stat.. He wants us to find what in that
sample and we did experiment on that sample for this semester.
So, we have some result. So he wants to write paper for that.
(Intro- Material Method- result- discussion-References). We
found small sequence and he gave us top hits related to the
sample. He want to compare our result with other experiments
had done before.
The only one thing missing is the information about the sample

48. such as where has been taken, and how long been that and
stored temperature.