Prostate cancer is a common type of cancer in men. Current prostate cancer diagnostics rely on prostate-specific antigen (PSA) testing, but PSA testing has limitations in specificity and can result in overdiagnosis. This project aims to develop an inexpensive and reliable diagnostic for early-stage prostate cancer using an electrochemical biosensor. The biosensor uses an aptamer that binds to the prostate cancer biomarker PCA3. Initial results show the biosensor can detect PCA3 at concentrations as low as 0.1 ng/ml, lower than the minimum concentration tested. Further work could improve the sensor's ability to reliably detect prostate cancer.
Development and Commercialisation of a Molecular Diagnostic CompanyMalavikaSankararaman
Development and commercialisation of a spin-out molecular diagnostics approach to detect different grades of Prostate Cancer using Fourier Transform Infrared Spectroscopy
On The Detection of Ctni - A Comparison of Surface-Plasmon Optical - Electroc...komalicarol
“Cardiovascular diseases (CVDs) are the number one cause of
death globally, taking an estimated 17.9 million lives each year.
CVDs are a group of disorders of the heart and blood vessels and
include coronary heart disease, cerebrovascular disease, rheumatic
heart disease, and other conditions
Development and Commercialisation of a Molecular Diagnostic CompanyMalavikaSankararaman
Development and commercialisation of a spin-out molecular diagnostics approach to detect different grades of Prostate Cancer using Fourier Transform Infrared Spectroscopy
On The Detection of Ctni - A Comparison of Surface-Plasmon Optical - Electroc...komalicarol
“Cardiovascular diseases (CVDs) are the number one cause of
death globally, taking an estimated 17.9 million lives each year.
CVDs are a group of disorders of the heart and blood vessels and
include coronary heart disease, cerebrovascular disease, rheumatic
heart disease, and other conditions
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
EIS Technology: bioimpedance chronoamperometry in adjunct to screen the prost...ES-Teck India
Through the 6 tactile electrodes, a weak DC current is sending alternatively between 2 electrodes with a sequence and the EIS system is recording the electrical conductance of 11 pathways of the human body.
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
EIS Technology: bioimpedance chronoamperometry in adjunct to screen the prost...ES-Teck India
Through the 6 tactile electrodes, a weak DC current is sending alternatively between 2 electrodes with a sequence and the EIS system is recording the electrical conductance of 11 pathways of the human body.
Similar to Introduction Prostate Cancer is amongst the common types of.pdf (8)
Normal Labour/ Stages of Labour/ Mechanism of LabourWasim Ak
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Introduction Prostate Cancer is amongst the common types of.pdf
1. Answers: Introduction Prostate Cancer is amongst the common types of
Answers:
Introduction
Prostate Cancer is amongst the common types of cancer in US, Europe, UK and even
globally, and the second most main origin of mortality after lung cancer in men. Usually, PCa
is sensed in older men of age, with a good number of cases identified in men who are middle
aged, normally between the age of 40 and 50 years. This type of cancer is asymptomatic and
slow growing; therefore, detecting it is a challenging issue amongst clinicians. Clinical
symptoms are the same as those of prostatitis, which makes it a challenge in accurately
distinguishing between the two. Due to untimely and ineffective diagnostics, the PCa
prognosis is poor generally, which is as a result of the high risk of metastatic development.
Diagnosing PCa in time can minimize rates of mortalities and provide the opportunity for
proper medical interventions. Thus, developing diagnostics that is reliable at early PCa
stages is of high significance.
Currently, PCa diagnostics are basically done on detecting and quantifying the sum of serum
prostate-specific blood antigen then through imaging studies and digitally rectal researches
in case there is an observation of PCa. The introduction of the PSA test was done in the late
1980s and resulted to a great advance in PCadiagnostics. Though, limitations on its
application are associated to its specificity absence since high PSA concentrations might not
be related always to cancer. Elecvated levels of PSA can be credited to a number of
conditions of benign such as infection and benign prostatic hyperplasia. In addition,
development of tumours may appear before PSAs concentrations increases. False tests of
PSA which are positive have resulted to overdiagnosis and finally overtreatment, which is
applied as the gold diagnosis technique in clinical works (Kim, 2021).
A biological sensor defines a device that is able to detect an analyte through integration of
biological element by using a transducer. The biomolecule is able to identify the analyte, and
the changes are changed to an electrical signal by the use of a transducer. Electrochemical
biosensor function through the conversion of chemical signals itno electrical signals. They
are able to detect a number of biomolecules like blood ketones, haemoglobin, DNA, lactate,
uric acid, cholesterol, glucose and many more. Thus, they can be applied in treating diseases
which result from biomolecules imbalance. Though, they are applied mainly for biosensor
2. applications and research on biosensors and where applications of delivery of drugs are
scarce. As part of this project, there will be an application of a biorecptoraptamer which is a
novel kind of and an electrochemical transducer. The application of the two will be used in
measuring data that can be used on other applications, like calculation of risk of prostate
cancer among patients (Cosnier, 2017).
The figure below shows the basic concepts of a biosensor.
Aims And Objectives
This project aims at providing a platform for developing a simple, reliable and inexpensive
diagnostics for prostate cancer. The objectives in this project include:
Conducting literature review on electrochemical biosensors and electrochemical apta-
sensors to be specific
To carry out a number of IS and CV measurements on electrodes which have immobilized
aptamers binding target molecules PCA3 in various concentrations (Afsarimanesh, 2019).
Approach And Methodology
Phase To Phase Aptasensor Fabrication
The CG-based aptamer of 277 bases specification was functionalized. The nucleotides
sequence is known for binding a 277 aptamer section schematically as shown in the figure
below:
Figure1, showing the bind of the CG 3 RNA –aptamer (the line and the red lines) to a PCA3
subsection including a 277 IncRNA bases transcripts (the line and the blue lines (Kumar,
2018)).
The immobilization of aptamers was done on the gold-screen electrodes printed on the
surface through following the method and procedure schematically outlined in figure 2. The
solution of the apatamer stock in a was diluted to 1 μM using HEPES binding buffer of 7.2-
7.6 ph accompanied using 3mm of mgcl2 and 1 mm of 1.4 dithiothretiol. DTT is applied in
breaking the bridges disulfide in the middle of two aptamers, releasing afterward the end
gropus of a 3 thiol. The free thiol groups give allowance for the covalent aptamer binding to
the screen of electrodes gold-printed on their surface. Before immobilizing is done the
liquid samples of aptamer were activated through heating rapidly for one minute up to 95
degrees Celsius, followed by a one minute cooling at four degrees Celsius in a
3. thermocycles (Costa & Miertus, 2015). Immobilization was conducted through casting the
solutions of the aptamer onto the screen surface of the electrodes that is golden printed.
After that, the incubation of the samples was done for 4 hours in a humidity chamber at a
room temperature.
Aptamers that were not reacting were separated from the surface of the electrode through
numerously rinsing the electrode with a non-folding buffer. The electrodes that were
printed on the screen in gold with aptamers which were immobile were reserved at 4
degrees Celsius in HBB to ensure the aptamers did not coil. PCA3 solutions resuspended in
phosphate buffer saline of PH 7-2 to 7.4 at 1000 ng/ml concentrations down to 0.1 ng/ml
were applied in the measurements of the electrochemical (Carneiro & Leonardo, 2018).
Figure 2, showing a step by step aptasensor fabrication: a. purchase of aptamers; b. splitting
of aptamers in HEPES binding buffer with an inclusion of Mgl2 and DTT; c. aptamers that
are reactivated following thermcycling; d. immobilization of aptamers on Au electrodes
with the labeling of the 50 redox done from its external; e. conformed changes of the
configuration of the aptamer following the binding of PCA3 and leading in a subsequent rise
of transfer of charge (Moretto & Kalcher, 2016).
Electrochemical Measurements
The application of the assembled three-electrode gold screen with reference of electrode of
Ag/AgCL were applied in the measurements of the cyclic voltammograms with the
application of a Metrohmpotentiostat STAT8000P and DropSens, voltage ranging from -0.5
to 0.5V. This was applied in the measurements of CV with a 10mv step and a 10 mv/s scan
rate. The recording of the CV cycles was done 3 times until there was an establishment of
the current readings (Sun, 2019). Besides the cyclic voltammetry, the cathodic current time
dependencies at –0.2 V on electrodes were recorded in the exposure of the PCA3 of various
concentrations. Measurements of the electrochemical impedance spectroscopy (EIS) were
conducted on inter-digitated dropsens electrodes printed on the gold screen surface with
50 fringes having a 5 µm spacing through the application of 4000 A EG & G impedance
analyzer. The 50 Mv amplitude AC signal with no DC off-set which has the frequency
variation from 0.1 Hz to 1 MHz was applied in these measurements. Both measurements of
EIS and CV were conducted on electrodes that had immobilized aptamers absorbed in PBS
ph 7.2 to 7.4 with various PCA3 concentrations ranging from 0.1 ng/ml to 1000ng/ml.
Buffer measurements alone were applied as a reference. Also carried out were the negative
control measurements through the application of bovine serum albumin of a concentration
of 100 ng/ml on PBS (Luo, 2014).
Literature Survey
4. As it has already been noted, prostate cancer is one of the most commonly known cancer
types in Europe, UK, US and even globally and the second-most mortality cause after lung
cancer amongst men. Usually, PCa is detected in men who are of old age, with a good
number of cases being witnessed in middle aged men who are between the age of 40 to 50
years. This type of cancer is asymptomatic and slow-growing; therefore, detecting it in its
early stages is a big challenge to clinicians. Clinical symptoms are the same as the benign
prostatitis, which makes it a challenge in distinguishing accurately between the two. Due to
lack of proper and in-time diagnostics, the PCa prognosis is poorly generally, which is as a
result of the high risk of metastatic development. Diagnosing PCa early enough can
minimize the rates of mortalities and increase proper medical intervention opportunities.
Thus, developing of diagnostics that is reliable at the early PCa stages can be of great
importance (Rafat, 2017).
Current PCa diagnostics are based on detecting and quantifying the total serum prostate-
specific antigen in blood then in case of suspecting PCa, digital rectal research and current
researches. The introduction of the test of PSA was done in the late 1980sand resulted to a
great improvement in the diagnosis of PCa. Though, limitations in its application are
associated to it lacking specificity since high PSA concentrations might not be related to
cancer always. Elevated levels of PSA can be credited also to a number of benign conditions
like benign infection or prostatic hyperplasia. In addition, the development of tumours may
happen before the PSA concentration increases. PSA tests that are false but positive have
resulted to both over-diagnosis and finally over-treatment of men in huge populations who
go through prostate biopsies that is needless, that is applied as the method of gold standard
diagnosis in clinical research. Therefore, identification of alternative biomarkers that is
specific to prostate cancer and development of techniques for detecting them in early stage
of the disease in needed (Zhang & Wang, 2017).
A wide range of PCa biomarkers that is promising like PSMA11, TMPRSS2, ERG gene fusion,
PCGEM 1 and RNA urine biomarker(DD3PCA3) have been known all to be over-expressed
as far as prostate turmours is concerned. The diffential display code 3 (DD3PCA3) gene, also
referred to as prostate cancer antigen 3 (PCA3) was established in the year 1999 and
currently it is one of the particular malignant PCa makers. The levels of PCA3 can predict
the outcome of the prostatic biopsies, particularly in combining them with other
biomarkers of PCa like PCa can minimize the possibility of false-positive results. PCA3 can
be detected in blood, collected urine after DRE and standards tests of urine, these PCA3
features make it the best biomarker for early diagnosis of PCa that is invasive (Yogeswaran,
2016).
Typically, PCA3 detection has been carried out using the amplification of RT-Qpcr.
Currently, detecting the PCA3 in the samples of post-DRE urine is part of the progensa test
commercially established and accepted for clinical uses in the USA. The basis of the
progensa assay on detection of both PCA3 and PSA markers through the application of
measurable nucleic acid amplification with high specificity and sensitivity. Though, the test
5. is expensive and time-inefficient. The PCA3 biosensors development for cost-effective,
express and accurate PCa diagnostics is a subject of great significance. Enough progress in
development of biosensors for diagnosis of cancer with the inclusion of prostate cancer has
been so far made. A current electrochemical biosensing advancement which includes nano-
carbon materials such as graphene oxide, graphene, cabon nanotubes, gives allowance to a
substantial improvement in discovery and sensitivity. A detailed review of the current uses
of nano-carbon materials in biosensing showed the detection of a number of cancer
biomarkers in reduced concentrations to the level of fm (Singh, 2018). PSA electrochemical
detection using a LOD of 13 pg/ml has been testified. Though, the PCA3 finding was not
mentioned in this research. Electrochemical biosensors are specifically attractive for
biomedical uses since they have got a combination that is unique low cost, simplicity in
application and high sensitivity.
The PCA3 optical detection at concentrations that are between 200 fm and 5nm through the
use of nanoparticles of graphene-oxide adapted with reduced oligonucleotides particular to
PCA3 sections has been reported. Though, the assessment of that specificity was not done.
Both optical and electrochemical detection of a short PCA3 ssDNA succession which are
similar to the real IncRNA PCA3 sequence was attempted recently. The limits of detection
reported for impedance spectroscopy were 83 pm, 0.9 nm for UV-vis absorption
spectroscopy and 2nm for cyclic voltammograms. Though, the IncRNA PCA3 detection was
only attempted qualitatively. The sensors could differentiate between extracted PCA3 from
various cell lines which have a high, negligible and low PCA3 concentrations (Ozsoz, 2017).
The focus in this research has been emphasized on the further electrochemical sensors
development for the PCa biomarkers detection. One particular challenge of electrochemical
biosensing, that is, the necessity for redox chemicals in the solution tested can be
determined through the application of a redox-labelled apmaters as bioreceptors. Aptemers
are not natural, averagely short RNA or DNA-based constructs which have a specific
sequence of nucleotides designed to stick to particular targets from small inorganic and
organic molecules to molecules that are large in size like proteins. The mixture of high
stability and selectivity with reduced synthesis cost and easily modified with different
functional groups enables aptamers to look attractive for several applications (Pumera,
2017). For instance, labeling aptamers which have redox groups that are active
electromechally enables them to be specifically good-looking for electrochemical
biosensing. The technique is grounded on the tributary structural changes of the aptamer
once it has abided to the molecule targeted. Conformational changes ensure that the redox
label is brought closer towards the electrode which leads to successful increase in the
transfer of charge. This tactic has been adapted effectively for mycotoxins electrochemical
detection, specifically ochratoxin in investigation of food, and it has been used in detecting
heavy metal ions in water and equally detection of in-vitro of dopamine (Alegret & Merkoci,
2017).
In this case, a high affinity novel of CG-3 RNA-based aptamer particular to 277 PCA
6. transcript bases will be applied. The labeling of the aptamer is done with forrocene which
allows the 277 nt fragment detection from the PCA3. The interesting results are for basic
science because the outcomes which result from changes in minor structures of the two
including the aptamer and PCA3 during the outcomes are unknown. The observation in this
study is a step that has been made towards achieving the long-term motive of developing an
accurate, novel, cost effective and simple diagnostic prostate cancer tool (Rinken, 2015).
Progress Made In Practical Work
Measurements Of The CV
Typical recorded CVs in electrodes which had immovable aptamers exposed to various
PCA3 concentrations are explained in figure shown in 3a. Distinguishing peaks of anodic
current (at around 0.15–0.2 V) and cathodic current (at around 0.25–0.3 V) can be related
with the redox activity on the label of the forrecene aptamer. These results are the same as
those of the CVs that were observed in the early research comprising aptamers labeled with
ferrocene. Furthermore, aptamers that were not labeled did not indicate that
electrochemical behavior. The amplitudes of both currents of cathodes and anodes can be
seen to be going up with the rise of PCA3 concentrations as shown I figure ).
Figure 3a, showing a typically set of cyclic voltammograms(CV) for various PCA3
concentrations. Figure 3b shows a concentration reliability on the changes on the
currents of the cathodes and anodes and also LOD evaluation.
In figure 2b, there is a shown dependency of average changes of both currents of cathodes
and anodes on the concentration of the PCA3, that can be applied as calibration curves. For
zero concentration the CV curve of the PCA3 was applied as the reference. The noise level in
the measurements of the CV was approximated to be 5 percent of the level of the signal. The
increase observed in the current that was correlating with the concentration of PCA3
increase can be defined by the charge transfer improvement between the labels of ferrocene
and the electrode as a result of the changes in the secondary structure of the aptamer on
binding to the 277 nt fragment of lncRNA PCA3 (Pujadó, 2019). The process is shown in
figure 2e. As it can be seen, there is no linearity in the calibration curves, and most probably,
they symbolize the lower part of the standard sigmoid curve. Within the concentration
range applied in this case, saturation was not attained. The detection limit can be observed
to be lower than the lowermost concentration of the PCA3, at 0.1 g/ml applied in the tests.
The values of the LOD were approximated through linear extrapolation of the curves of
calibration to be thrice the level of noise, for example 0.015 in average changes. It can be
observed that the recent measurements of the cathode were seen to be a bit sensitive (LOD
≈ 0.04 ng/mL) in comparison to the current of the anode, (LOD ≈ 0.08 ng/mL). in the two
cases, there is a very high sensitivity and impending levels of ppt. The high sensitivity is
attained here through detection of PCA3 which is the same as the sensitivities of other
earlier reported electrochemical aptasensors. Negative controls test on binding BSA to anti-
7. PCA3 aptamers were conducted but there was no response shown (Bollella & Katz, 2017).
Measurements Of EIS
Typical electrochemical impedance spectroscopy results are presented in the figure4a as
reliabilties of the total value of the invented part impendence against the real part, which is
referred as Nyguist plots. The points of data in every curve correspond to various AC signal
frequencies, the arrows showing the increase of frequency from 0.1 Hz to 1 MHz. the almost
real observed semi-circular pattern is real for systems without limiting diffusion in receptor
analyte interactions, which have been used in the samples including a monolayer aptamers
which are immobilized on the gold electrodes surface. Thus, the simplified same circuit
model with no diffusion impedance is shown as a figure 4a inset. This can be applied in
modeling the measurements of EIS results. The Z impedance of the simplified equivalent
circuit circulation is shown below (Bollella & Katz, 2017):
In the above circulation, Z0 and Z00 are real and imaginary impedance parts respectively.
RDL and CDL are the resistance and capacitance of a two layered electrode surface
respectively and RS is the solution of the bulk resistance. At minimum frequencies,
Thus, the featured interest parameter, for example, a double layer resistance RDL, can be
worked out without calculating the data of EIS fitting as follows:
In practice, both Z0 and Z00 represents the real z values at lowest, which is at 0.1 Hz and
the highest, which is at 1 MHz frequencies in that order. The RDL dependence on the
concentration of the PCA3 is shown in figure 4b (Cosnier, 2017). The reduction in RDL with
the rise in the concentration of PCA3 relates well with the current rise of the DC in the
measuremnts of the CV and approves the electrochemical apta-sensing concept shown in
figure 2e. A significant reduction in RDL in the measurements of EIS which resulted from
the binding of PCA3 aptamer compared with somehow little changes on both currents of the
anode and the cathode in the measurements of the CV resulted to the decision that the
measurements of the EIS are more profound in comparison to the measurements of the CV.
The reduced limit of detecting the EIS technique could be approximated through plotting 1
/RDL against the PCA3 concentration. The graph is shown in figure 4b as an insert. The
measurements of EIS gave allowance to evaluating RDL with an accurateness of around 1 ?.
Applying the RDL ≈ 1 k ? value at zero PCA3 concentration as a locus, The level of noise can
be approximated to be ?(1/RDL) = ?RDL R 2 DL = 10−5 (S) or 0.01 mS, which as at zero level
practically. The linear estimation intercept of 1/RDL vs. CPCA3 graph at minimum
concentration results to the value of LOD at 0.03 ng/ml. The data in this case shows that the
EIS technique is more sensitive in comparison to the CV technique (Alegret & Merkoci,
8. 2017).
Results Of The Study
Figure 4a, showing a typically set Nyquist plots for various PCA3 concentrations. Figure 4b
shows concentration dependence of the resistance of a double layer. Inset demonstrates the
LOD evaluation.
The kinetics of binding PCA3 lncRNA to the aptamer layer on the surface of the gold
electrode was examined by recording time dependencies of cathodic current at a −0.2 V
fixed potential over various aptamer concentrations. Typical time dependencies of absolute
values of changes in cathodic current |?Ic| = Ic − I re f c for various PCA3 concentrations
are demonstrated in figure 5 (Moretto & Kalcher, 2016). The fitting of the data recorded to
the increasing exponential function gave allowance to the time constant (τ) evaluation at
diverse PCA3 concentrations. These data were applied in the further analysis of quantifying
the aptamer affinity- binding of the PCA3.
Figure 5, showing a typical kinetics PCA3 binding of various concentrations to the aptamer.
Inset shows the aptamer evaluation of the binding affinity of the PCA3.
A different equation describes the PCA3 aptamer binding for absorption, that is good in the
case here, of analyte molecules adsorption on a monolayer of binding centers (Cosnier,
2017):
The first term of the equation above defines the adsorption of analyte molecules of
concentration C[M] on the sites of binding available with the N-N concentration, where N
defines the sites of binding concentration on the surface and the adsorption rate is ka mol-1
s-1, whereas the second term in the above equation defines the desorption of the molecules
of analyte which is equal to the adsorbed molecules concentration (n) and the desorption
rate is kd- s-1. Another estimation applied in the analysis of binding kinetics is the
application of a single binding site assumption tto the process of binding that is comlex in
between the PCA3 and the aptamer, which includes interactions between a numbers of
nucleotides. Though, the approach proposed has been applied successfully in the same
complex antibody-antigen systems of interactions, and in the previous work on aptamer-
based biosensors. The above equation’s solution is a rising exponential function which
is (Kim, 2021):
9. The values of the desorption and adsorption rates kd and ka) can be gotten as the intercept
and gradient of 1/τ (C) dependence. Therefore, the association constant can be worked out
as KA molar−1 = ka/kd, whereas the affinity constant KD[M] = 1/KA = kd/ka. Calculations of
this kind were carried out for the kinetics curves in figure number 5 and the linear plot of
1/τ vs. C is given as an inset in together with the parameters evaluated. The resulting
association values and the affinity binding constant for the PCA3 to the aptamer KA≈
2.5·109 M−1 and KD ≈ 4·10−10 M, respectively, indicating on this reaction a very high
specificity. The binding strength means that practically, it is irreversible because the PCA3
binding probability is 2.5·109 higher than the desorption probability. The values obtained
for the KA and KD are the same as those of the other aptamers in the PCA3-specific
aptamer (Luo, 2014).
Conclusion
The feasibility learning results of the electrochemical detection of lncRNA PCA3 prostate
cancer marker in buffer solution through the application of specific redox-labelled aptamer
are promising. It proves that the electrochemical aptasensing simple idea based on
alterations in the transfer of charge between the aptamer redox label and the electrode
when the aptamer-totarget binding can be used in the detection of large biomolecules like
PCA3. Both the methods of impedance spectroscopy and the cyclic voltammograms gave
allowance in detecting the PCA in from 1 µg/mL down to 0.1 ng/mL concentrations. The
sensitivity of detection is high, with the LOD values for EIS method at 0.03 ng/ml and for the
CV technique, at 0.04-0.09 ng/ml. These results are the same as the 0.26 pm and 0.35-0.78
pm in that order, with an assumption that the PCA3 fragment size of 277nt is estimated at
87 kda. The kinetic research of binding PCA3 to our aptamer gave allowance for the
examination of the affinity constant at 4.10-10 molar which indicates that there is a high
specific binding reaction like the one noticed between antigen to antibody interactions.
There was no response in the negative control experiments.
References
Afsarimanesh, N. (2019). Electrochemical Biosensor: Point-of-Care for Early Detection of
Bone Loss. Texas: Springer.
Alegret, S., & Merkoci, A. (2017). Electrochemical Sensor Analysis. London: Elsevier.
Bollella, P., & Katz, E. (2017). Biosensors – Recent Advances and Future Challenges. Texas:
MDPI.
Carneiro, P., & Leonardo. (2018). Development of an Electrochemical Biosensor Platform
and a Suitable Low-Impedance Surface Modification Strategy. Texas: KIT Scientific
10. Publishing.
Cosnier, S. (2017). Electrochemical Biosensors. London : CRC Press.
Costa, G., & Miertus, S. (2015). Trends In Electrochemical Biosensors - Proceedings Of The
Conference. London : World Scientific.
Gu, M. B., & Kim, H.-S. (2016). Biosensors Based on Aptamers and Enzymes. Texas: Springer.
Kim, T. H. (2021). Advanced Electrochemical Biosensors. Texas: MDPI.
Kumar, H. (2018). Current Progress in Electrochemical Biosensors. London : AVID SCIENCE.
Luo, Y. (2014). Functional Nucleic Acid Based Biosensors for Food Safety Detection. Texas:
Springer.
Moretto, L. M., & Kalcher, K. (2016). Environmental Analysis by Electrochemical Sensors
and Biosensors. London: Springer.
Ozsoz, M. S. (2017). Electrochemical DNA Biosensors. London: CRC Press.
Pujadó, M. P. (2019). Carbon Nanotubes as Platforms for Biosensors with Electrochemical
and Electronic Transduction. London : Springer Science & Business Media.
Pumera, M. (2017). Nanomaterials for Electrochemical Sensing and Biosensing. London :
CRC Press.
Rafat, N. (2017). Theoretical and Experimental Studies of Multistep Electrochemical
Biosensors. Texas : Michigan State University. Chemical Engineering.
Rinken, T. (2015). Biosensors: Micro and Nanoscale Applications. London: BoD – Books on
Demand.
Singh, P. (2018). Electrochemical Biosensors: Applications in Diagnostics, Therapeutics,
Environment, and Food Management. Texas: Elsevier Science.
Sun, A. C. (2019). Point-of-Care and High-Density Array Electrochemical Biosensors. Texas:
University of California, San Diego.
Yogeswaran, U. (2016). Nanostructured Materials for Electrochemical Biosensors. London:
Nova Science Publishers.
11. Zhang, X., & Wang, H. J. (2017). Electrochemical Sensors, Biosensors and their Biomedical
Applications. Texas.