SlideShare a Scribd company logo
1 of 18
Download to read offline
Automated	Phenotyping	of	Patient	EMR	Data:
Feature	Extraction	and	Selection
Rolando	Acosta	Nuñez,	William	Artman,	Cassandra	Burdziak
Dr.	Tianxi Cai Laboratory
Department	of	Biostatistics
July	23rd,	2015
GATTACACCGTAAAATACATA
GACGTAAGAGGGGGAATTCCA
GATTAACAGGATTTGACAGGA
TCAGGATCAGGATACCAGTAA
ACGGATACCTACGATCAAGTT
Genetic	Data Computational	
Methods
Personalized
Medicine
Gene-Disease
Association
Phenotype	Data
Percent	of	non-federal	acute	care	hospitals	with	adoption	of	
EHR	Systems	by	level	of	functionality:	2008-2014
Unstructured	Data
Structured	Data
“ICD-9: 714
BMI: 21.5
Medication: Methotrexate, 7.5mg
PO as a single weekly dose”
“….bilateral joint pain and
stiffness. Physical exam
revealed nodules, swelling,
limited range of motion. X-ray
showed soft-tissue swelling and
early erosions. Blood tests
showed presence of rheumatoid
factor and elevated SED rate
….”
develop	disease	classification	model	
for	patient	medical	record	notes
Knowledge	Sources Concept	Collection
EMR	Data	
Collection
Concept Screening:
Statistical	Analysis
Natural
Language	
Processing
Concept	
Mapping
Initial
Screening
Model	
Training
Septic arthritis, also known as infectious arthritis,
may represent a direct invasion of joint space by
various microorganisms, most commonly caused by a
variety of bacteria. However, viruses, mycobacteria,
and fungi have been implicated. Reactive arthritis is a
sterile inflammatory process that usually results from
an extra-articular infectious process. Bacteria are the
most significant pathogens because of their rapidly
destructive nature. For this reason, the current
discussion concentrates on the bacterial septic
arthritides. Failure to recognize and to appropriately
treat septic arthritis results in significant rates of
morbidityand mayeven lead to death …
… Streptococcal species, such as Streptococcus
viridans, S pneumoniae, and group B streptococci,
account for 20% of cases. Aerobic gram-negative rods
are involved in 20-25% of cases. Most of these
infections occur in people who are very young, who
are very old, who are diabetic, who are
immunosuppressed, and who abuse intravenous
drugs.
Septic arthritis, also known as infectious arthritis,
may represent a direct invasion of joint space by
various microorganisms, most commonly caused by a
variety of bacteria. However, viruses, mycobacteria,
and fungi have been implicated. Reactive arthritis is a
sterile inflammatory process that usually results from
an extra-articular infectious process. Bacteria are the
most significant pathogens because of their rapidly
destructive nature. For this reason, the current
discussion concentrates on the bacterial septic
arthritides. Failure to recognize and to appropriately
treat septic arthritis results in significant rates of
morbidityand mayeven lead to death …
… Streptococcal species, such as Streptococcus
viridans, S pneumoniae, and group B streptococci,
account for 20% of cases. Aerobic gram-negative rods
are involved in 20-25% of cases. Most of these
infections occur in people who are very young, who
are very old, who are diabetic, who are
immunosuppressed, and who abuse intravenous
drugs.
Knowledge
Sources
Natural	Language	
Processing
Concept	
Mapping
Concept Unique
Identifier (CUI):
C0085435
reactive	
arthritis
reactive	
arthritides
arthritis	
reactive
Semantic	Type:
Disease	or	Syndrome
Unified	Medical
Language	System
Patient	1 Patient	2 Patient	3
… Patient	200
Note-Level
CUI	Screening:
non-main	CUI	
mentioned	in	>5%	
of	notes	including	
main	CUI
Patient-Level
CUI	Screening:
Spearman’s	Rank	Correlation,	r	>	0
CUI Patient	1 Patient	2 Patient	3 Patient	4 Patient	5
Main	CUI 92 16 44 368 144
C1247884 84 20 59 320 152
C0934556 122 89 153 0 167
r =	1,	p	=	0.017
r	=	-0.10,	p	=	0.95
Disease Number	of	Tests
Obesity 129
Migraine 71
Septic	Arthritis 100
Giant	Cell	Arteritis 93
Osteoarthritis 66
α =	0.05
αi'
Multiple	Testing
Correction
Multiple	Testing	Problem
Benjamini-Hochberg
Bonferroni Correction
Permutation	Test
𝜶′
=
𝟎. 𝟎𝟓
#	𝒐𝒇	𝒕𝒆𝒔𝒕𝒔
CUI P1 P2 P3 P4 P5
Main	CUI 92 16 44 368 144
C1247884 84 20 59 320 152
C0934556 122 89 153 0 167
CUI P1 P2 P3 P4 P5
Main	CUI 16 368 92 144 44
C1247884 84 20 59 320 152
C0934556 122 89 153 0 167
R1
R2
R1*
R2*
polymyalgia	rheumatica r	=	0.59
temporal artery biopsy r = 0.45
Giant	Cell	Arteritiscorrelation
coefficient 0.0005319149 0.03035306 0.0005818897
#	selected:										77																					92																				78
white:	not	
significant
Disease	or	Syndrome
Giant	Cell	Arteritis
Highly	Correlated	Terms	by	Type
Migraine
correlation
coefficient0.000694444 5.029342e-08 0.0006302195
#	selected:										71																					70																				71
Finding
Sign	or	Symptom
Pharmacologic	Substance
Diagnostic	Procedure
Migraine
Highly	Correlated	Terms	by	Type
Obesity
Finding
Disease	or	Syndrome
Pharmacologic	Substance
Diagnostic	Procedure
Biologically	 Active	Substance
Highly	Correlated	Terms	by	Type
Osteoarthritiscorrelation
coefficient0.0007462687 3.527381e-16 0.0005846256
#	selected:										66																					64																				66
Septic	Arthritis correlation
coefficient0.0004950495 0.02149995 0.0004085588
#	selected:										94																				99																				94
Discussion
• Limitations
• Relying	on	quality	of	sources
• Diseases	with	multiple	names	which	
correspond	to	different	CUIs
in	the	UMLS
• Example:	Giant	Cell	Arteritis	and	
Temporal	Arteritis
• Conclusion	and	Future	Directions
Acknowledgements
Cai Lab	and	Collaborators
• Dr.	Tianxi Cai
• Dr.	Sheng	Yu
Summer	Program	in	Biostatistics	
and	Computational	Biology
• Dr.	Rebecca	Betensky
• Tonia	Smith
• Heather	Mattie
• Eleanor	Murray
• Joshua	Barback

More Related Content

What's hot

Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010
Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010
Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010The Spittoon
 
tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...
tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...
tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...David Peyruc
 
The molecular times
The molecular timesThe molecular times
The molecular timesjonyfive5
 
BMJ Open-2016-Conway Morris--2
BMJ Open-2016-Conway Morris--2BMJ Open-2016-Conway Morris--2
BMJ Open-2016-Conway Morris--2Tracey Mare
 
Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...
Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...
Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...Premier Publishers
 
Biometric identification in the healthcare sector
Biometric identification in the healthcare sectorBiometric identification in the healthcare sector
Biometric identification in the healthcare sectorFatima Aftab
 
ClinicalCodes.org: An online repository of clinical code lists for primary ca...
ClinicalCodes.org: An online repository of clinical code lists for primary ca...ClinicalCodes.org: An online repository of clinical code lists for primary ca...
ClinicalCodes.org: An online repository of clinical code lists for primary ca...David Springate
 
Salud y medicina ares pdf
Salud y medicina ares pdfSalud y medicina ares pdf
Salud y medicina ares pdftamara celemín
 
Using primary care databases to evaluate drug benefits and harms: are the res...
Using primary care databases to evaluate drug benefits and harms: are the res...Using primary care databases to evaluate drug benefits and harms: are the res...
Using primary care databases to evaluate drug benefits and harms: are the res...David Springate
 
Triple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. Marín
Triple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. MarínTriple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. Marín
Triple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. MarínSociedad Española de Cardiología
 
GetPersonalized! Estonian approach - from biobanking to precision medicine, A...
GetPersonalized! Estonian approach - from biobanking to precision medicine, A...GetPersonalized! Estonian approach - from biobanking to precision medicine, A...
GetPersonalized! Estonian approach - from biobanking to precision medicine, A...Sitra / Hyvinvointi
 
The Value of Multimedia-Enhanced Radiology Reporting
The Value of Multimedia-Enhanced Radiology ReportingThe Value of Multimedia-Enhanced Radiology Reporting
The Value of Multimedia-Enhanced Radiology ReportingCarestream
 
Engineering better Health
Engineering better HealthEngineering better Health
Engineering better Health3GDR
 
EWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patients
EWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patientsEWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patients
EWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patientsEWMAConference
 
EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...
EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...
EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...EWMA
 
Experimental Melanoma Vaccine Shows Early Promise
Experimental Melanoma Vaccine Shows Early PromiseExperimental Melanoma Vaccine Shows Early Promise
Experimental Melanoma Vaccine Shows Early Promisefortunatequilt157
 

What's hot (20)

Dreyfuss.berkeley.2010
Dreyfuss.berkeley.2010Dreyfuss.berkeley.2010
Dreyfuss.berkeley.2010
 
The State of Play in Diagnosis
The State of Play in DiagnosisThe State of Play in Diagnosis
The State of Play in Diagnosis
 
Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010
Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010
Anne Wojcicki of 23andMe at FDA Public Meeting on LDTs, July 20, 2010
 
tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...
tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...
tranSMART Community Meeting 5-7 Nov 13 - Session 2: Creating a Comprehensive ...
 
The molecular times
The molecular timesThe molecular times
The molecular times
 
BMJ Open-2016-Conway Morris--2
BMJ Open-2016-Conway Morris--2BMJ Open-2016-Conway Morris--2
BMJ Open-2016-Conway Morris--2
 
Saticovid Study 2021 - Articulo Completo
Saticovid Study 2021 - Articulo CompletoSaticovid Study 2021 - Articulo Completo
Saticovid Study 2021 - Articulo Completo
 
Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...
Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...
Antibiogram of Bacteria Isolated from Wounds of Diabetic Patients on Admissio...
 
Biometric identification in the healthcare sector
Biometric identification in the healthcare sectorBiometric identification in the healthcare sector
Biometric identification in the healthcare sector
 
PJI Abstract
PJI AbstractPJI Abstract
PJI Abstract
 
ClinicalCodes.org: An online repository of clinical code lists for primary ca...
ClinicalCodes.org: An online repository of clinical code lists for primary ca...ClinicalCodes.org: An online repository of clinical code lists for primary ca...
ClinicalCodes.org: An online repository of clinical code lists for primary ca...
 
Salud y medicina ares pdf
Salud y medicina ares pdfSalud y medicina ares pdf
Salud y medicina ares pdf
 
Using primary care databases to evaluate drug benefits and harms: are the res...
Using primary care databases to evaluate drug benefits and harms: are the res...Using primary care databases to evaluate drug benefits and harms: are the res...
Using primary care databases to evaluate drug benefits and harms: are the res...
 
Triple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. Marín
Triple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. MarínTriple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. Marín
Triple Antithrombotic Therapy in AF Patients Undergoing PCI - Dr. Marín
 
GetPersonalized! Estonian approach - from biobanking to precision medicine, A...
GetPersonalized! Estonian approach - from biobanking to precision medicine, A...GetPersonalized! Estonian approach - from biobanking to precision medicine, A...
GetPersonalized! Estonian approach - from biobanking to precision medicine, A...
 
The Value of Multimedia-Enhanced Radiology Reporting
The Value of Multimedia-Enhanced Radiology ReportingThe Value of Multimedia-Enhanced Radiology Reporting
The Value of Multimedia-Enhanced Radiology Reporting
 
Engineering better Health
Engineering better HealthEngineering better Health
Engineering better Health
 
EWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patients
EWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patientsEWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patients
EWMA 2013 - Ep534 - Prevention of pressure ulcers in cardiac surgery patients
 
EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...
EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...
EWMA 2013 - Ep543 - Evidence based wound conversation algorithm utilizing the...
 
Experimental Melanoma Vaccine Shows Early Promise
Experimental Melanoma Vaccine Shows Early PromiseExperimental Melanoma Vaccine Shows Early Promise
Experimental Melanoma Vaccine Shows Early Promise
 

Viewers also liked

Resume Suki Marek-Chauncy (1)
Resume Suki Marek-Chauncy (1)Resume Suki Marek-Chauncy (1)
Resume Suki Marek-Chauncy (1)Suki Marek
 
2016 Awards Shortlists - Investor Relations Society
2016 Awards Shortlists - Investor Relations Society2016 Awards Shortlists - Investor Relations Society
2016 Awards Shortlists - Investor Relations SocietyDamien Donlon
 
Alfredo luncheon 2 Bryant Cafe 2015 copy
Alfredo luncheon 2 Bryant Cafe 2015 copyAlfredo luncheon 2 Bryant Cafe 2015 copy
Alfredo luncheon 2 Bryant Cafe 2015 copyAlfredo Arreguin
 
PIIP_專案業務簡介_20160920_中文
PIIP_專案業務簡介_20160920_中文PIIP_專案業務簡介_20160920_中文
PIIP_專案業務簡介_20160920_中文YiTien Liao
 
Glass menagerie scene 6
Glass menagerie scene 6Glass menagerie scene 6
Glass menagerie scene 6Anto Henry
 
SPE JPT MAY 2016
SPE JPT MAY 2016SPE JPT MAY 2016
SPE JPT MAY 2016Henry Malm
 

Viewers also liked (9)

Resume Suki Marek-Chauncy (1)
Resume Suki Marek-Chauncy (1)Resume Suki Marek-Chauncy (1)
Resume Suki Marek-Chauncy (1)
 
Aeij
AeijAeij
Aeij
 
2016 Awards Shortlists - Investor Relations Society
2016 Awards Shortlists - Investor Relations Society2016 Awards Shortlists - Investor Relations Society
2016 Awards Shortlists - Investor Relations Society
 
Alfredo luncheon 2 Bryant Cafe 2015 copy
Alfredo luncheon 2 Bryant Cafe 2015 copyAlfredo luncheon 2 Bryant Cafe 2015 copy
Alfredo luncheon 2 Bryant Cafe 2015 copy
 
Qué es excel
Qué es excelQué es excel
Qué es excel
 
Intership Report
Intership ReportIntership Report
Intership Report
 
PIIP_專案業務簡介_20160920_中文
PIIP_專案業務簡介_20160920_中文PIIP_專案業務簡介_20160920_中文
PIIP_專案業務簡介_20160920_中文
 
Glass menagerie scene 6
Glass menagerie scene 6Glass menagerie scene 6
Glass menagerie scene 6
 
SPE JPT MAY 2016
SPE JPT MAY 2016SPE JPT MAY 2016
SPE JPT MAY 2016
 

Similar to HSPHSI

Immunopatologi Sepsis
Immunopatologi SepsisImmunopatologi Sepsis
Immunopatologi SepsisDoroteaNina1
 
How predictive analytics can help find the rare disease patient
How predictive analytics can help find the rare disease patientHow predictive analytics can help find the rare disease patient
How predictive analytics can help find the rare disease patientIMSHealthRWES
 
The future of the emergency room | Jean-Louis Vincent at TBS23
The future of the emergency room | Jean-Louis Vincent at TBS23The future of the emergency room | Jean-Louis Vincent at TBS23
The future of the emergency room | Jean-Louis Vincent at TBS23scanFOAM
 
What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...
What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...
What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...Charles Harless, MPH, SASM, POPM
 
A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...
A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...
A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...dbpublications
 
Wound dehiscence in surgical procedures and its relationship to increased mor...
Wound dehiscence in surgical procedures and its relationship to increased mor...Wound dehiscence in surgical procedures and its relationship to increased mor...
Wound dehiscence in surgical procedures and its relationship to increased mor...AI Publications
 
EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)
EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)
EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)shelley bowers
 
Start impaact june 7 2011
Start impaact june 7 2011Start impaact june 7 2011
Start impaact june 7 2011Phil Boehmer
 
Start impaact june 7 2011
Start impaact june 7 2011Start impaact june 7 2011
Start impaact june 7 2011Phil Boehmer
 
Antibiotic prophylaxis in sever Acute Panceriatitis
Antibiotic prophylaxis in sever Acute PanceriatitisAntibiotic prophylaxis in sever Acute Panceriatitis
Antibiotic prophylaxis in sever Acute PanceriatitisSaeed Al-Shomimi
 
Hospital-acquired bloodstream infections in Hungary, 2011
Hospital-acquired bloodstream infections in Hungary, 2011Hospital-acquired bloodstream infections in Hungary, 2011
Hospital-acquired bloodstream infections in Hungary, 2011Rita Szabó
 
Research proposal focus cardiovascular and other disease biology - Pubrica ...
Research proposal focus cardiovascular and other disease biology - Pubrica   ...Research proposal focus cardiovascular and other disease biology - Pubrica   ...
Research proposal focus cardiovascular and other disease biology - Pubrica ...Pubrica
 
Using real-world evidence to investigate clinical research questions
Using real-world evidence to investigate clinical research questionsUsing real-world evidence to investigate clinical research questions
Using real-world evidence to investigate clinical research questionsKarin Verspoor
 
EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...
EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...
EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...EWMAConference
 
Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...
Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...
Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...Rita Szabó
 
Adverse event reporting ppt
Adverse event reporting pptAdverse event reporting ppt
Adverse event reporting pptRebecka David
 
Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...
Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...
Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...Ahmad Ozair
 
Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...
Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...
Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...CLOVE Dental OMNI Hospitals Andhra Hospital
 

Similar to HSPHSI (20)

Immunopatologi Sepsis
Immunopatologi SepsisImmunopatologi Sepsis
Immunopatologi Sepsis
 
How predictive analytics can help find the rare disease patient
How predictive analytics can help find the rare disease patientHow predictive analytics can help find the rare disease patient
How predictive analytics can help find the rare disease patient
 
The future of the emergency room | Jean-Louis Vincent at TBS23
The future of the emergency room | Jean-Louis Vincent at TBS23The future of the emergency room | Jean-Louis Vincent at TBS23
The future of the emergency room | Jean-Louis Vincent at TBS23
 
What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...
What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...
What is the Rate of Antibiotic Prescribing by Emergency Department Providers ...
 
Orientation to Surveillance
Orientation to SurveillanceOrientation to Surveillance
Orientation to Surveillance
 
A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...
A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...
A Study On Clinical Profile Of Sepsis Patients In Intensive Care Unit Of A Te...
 
Wound dehiscence in surgical procedures and its relationship to increased mor...
Wound dehiscence in surgical procedures and its relationship to increased mor...Wound dehiscence in surgical procedures and its relationship to increased mor...
Wound dehiscence in surgical procedures and its relationship to increased mor...
 
EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)
EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)
EPC_June-15_pp.52-55 (EPC Industry Advisor) (1)
 
Start impaact june 7 2011
Start impaact june 7 2011Start impaact june 7 2011
Start impaact june 7 2011
 
Start impaact june 7 2011
Start impaact june 7 2011Start impaact june 7 2011
Start impaact june 7 2011
 
Antibiotic prophylaxis in sever Acute Panceriatitis
Antibiotic prophylaxis in sever Acute PanceriatitisAntibiotic prophylaxis in sever Acute Panceriatitis
Antibiotic prophylaxis in sever Acute Panceriatitis
 
Hospital-acquired bloodstream infections in Hungary, 2011
Hospital-acquired bloodstream infections in Hungary, 2011Hospital-acquired bloodstream infections in Hungary, 2011
Hospital-acquired bloodstream infections in Hungary, 2011
 
"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin
"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin
"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin
 
Research proposal focus cardiovascular and other disease biology - Pubrica ...
Research proposal focus cardiovascular and other disease biology - Pubrica   ...Research proposal focus cardiovascular and other disease biology - Pubrica   ...
Research proposal focus cardiovascular and other disease biology - Pubrica ...
 
Using real-world evidence to investigate clinical research questions
Using real-world evidence to investigate clinical research questionsUsing real-world evidence to investigate clinical research questions
Using real-world evidence to investigate clinical research questions
 
EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...
EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...
EWMA 2013 - Ep543 - Evidence Based Wound Conversion Algorithm for University ...
 
Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...
Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...
Hospital-acquired bloodstream infections in Intensive Care Units in Hungary, ...
 
Adverse event reporting ppt
Adverse event reporting pptAdverse event reporting ppt
Adverse event reporting ppt
 
Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...
Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...
Epidemiology and outcomes of hospital-acquired bloodstream infections in inte...
 
Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...
Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...
Dr. Rahul VC Tiwari - Fellowship In Orthognathic Surgery - Jubilee Mission Me...
 

HSPHSI