This document reports on a study that found functional differences between carcinoma-associated fibroblasts (CAFs) isolated from two different stages of breast cancer in a mouse model. CAFs isolated from stage 2 tumors (CAF-II) exhibited higher expression of immune-suppressive enzymes IDO and TGF-β compared to CAFs from stage 4 tumors (CAF-IV), which exhibited higher expression of iNOS and IL-10. This suggests the tumor microenvironments influenced by CAFs differ between cancer stages, which may contribute to varying responses to cancer therapies depending on the stage. Further research is needed to fully understand how CAF functions change during cancer progression and their potential as therapeutic targets at different stages.

1. Clinics of Oncology
Research Article ISSN: 2640-1037 Volume 4
Functional Disparity of Carcinoma Associated Fibroblasts in Different Stages
Influences Immune Response in Cancer
Langroudi L1
, Hasan ZM*2
, Soleimani M3
and Hashemi SM4
1
Department of Immunology, School of Medicine, Kerman University of Medical Sciences, Iran
2
Department of Immunology, Faculty of Medical Sciences, Tarbiat Modares University, Iran
3
Department of Hematology, Faculty of Medical Sciences Tarbiat Modares University, Iran
4
Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Iran
*
Corresponding author:
Zuhair M Hasan,
Department of Immunology, Faculty of Medical
Sciences, Tarbiat Modares University, Jalal AleAhmad
Highway, Nasr Bridge, Tehran, Iran,
Email: Hasan_zm@modares.ac.ir
Received: 02 Feb 2021
Accepted: 03 Mar 2021
Published: 07 Mar 2021
Keywords:
Carcinoma associated fibroblasts; Breast cancer; IDO;
iNOS; COX-2
Copyright:
©2021 Hasan ZM, et al. This is an open access article dis-
tributed under the terms of the Creative Commons Attribu-
tion License, which permits unrestricted use, distribution,
and build upon your work non-commercially.
Citation:
Hasan ZM, Functional Disparity of Carcinoma Associat-
ed Fibroblasts in Different Stages Influences Immune Re-
sponse in Cancer. Clin Onco. 2021; 4(1): 1-10.
1. Abstract
1.1. Objectives: Carcinoma associated fibroblasts (CAFs) are
known responsible for immune evasion and growth of cancer and
the crosstalk between CAFs and the immune system is still un-
identified.
1.2. Methods: in this study, two stages of breast cancer were de-
scribed in a murine model of MBL-6 cell line. CAFs were isolated
and characterized from MBL-6 tumors in stages 2 and 4. The im-
munomodulatory properties and the phenotype of isolated stage
2 and 4 CAFs were characterized and compared. Cytokine pro-
duction, proliferation and inflammatory enzyme production were
analyzed using ELISA, MTT assay and Real-time PCR.
1.3. Results: Here we show CAFs from two stages of a murine
breast cancer model show different immunomodulatory properties.
Flow cytometry of the surface marker panel showed significantly
higher levels of HLA-DR in CAF-IV. Higher levels of TGF-β and
IL10 was observed in splenocytes co-cultured with CAF-II and
CAF-IV respectively. Gene expression revealed higher expression
of IDO in CAF-II and iNOS in CAF-IV.
1.4. Conclusion: Functional differences shown by their surface
markers, cytokine and inflammatory enzyme production suggests
different microenvironments. The discrepancy observed in can-
cer therapies may be attributed to the influence of CAFs. Further
studies are required to fully elucidate the therapeutic potentials of
CAFs in various stages.
2. Introduction
The cancer microenvironment consists of many cell types includ-
ing endothelial cell, fibroblasts and cells of the immune system.
The supporting microenvironment of cancer has been known re-
sponsible for cancer development, progression, metastasis and
drug resistance [1, 2]. The cancer promoting properties of Car-
cinoma Associated Fibroblasts (CAFs) have been the target of
many studies which have shown the morphological, molecular
and functional alterations compared to their normal counterparts
[3]. These changes include cell signaling and intra- cellular cross-
talk [4], extracellular matrix (ECM) remodeling [5], immune eva-
sion and sustained inflammation [6]. CAFs are the initial barrier
to infiltrating immune cells [7]. CAFs secretory and cell surface
factors including TGF-β1 [8], PGE2 [9], IL-8 [10], IL-6 [11] and
TNF-α [12] influence the immune response leading to immune
suppression and cancer-related inflammation. it has been shown
that normal fibroblasts can inhibit cancer cell growth [13] and the
prevailing view is that cancer has a developmental progression
and the microenvironment evolves with cancer cell demands [14].
In agreement with this premise, the changes in fibroblast function
from anti-tumorigenic to pro-tumorigenic may be the basis for
cancer development and progression. thus, there should be func-
tional differences between CAFs in different stages. In this study
we show that with increasing stage, CAFs significantly upregulate
clinicsofoncology.com 1

2. the production of regulatory cytokine IL-10 and iNOS expression
compared to TGF-β and IDO. Whereas CAFs induce IL-17 and
PGE2 production in both stages. These findings place CAFs as key
regulators of cancer microenvironment and suggest new interven-
tion strategies to restore immune response in cancer and related
inflammation.
3. Material and Methods
3.1. Establishment of Stage 2 and 4 Model
In studies involving mouse models, terms such as “early” and
“late” stages is used to denote various stages of cancer. However,
this terminology is not applicable when translating animal mod-
els into human studies. Therefore, here, we employed the model
of human tumor growth kinetics [61, 62] and the metabolic rate
differences [63] to establish a stage II and stage IV model of tu-
mor growth in Balb/C mice. According to TNM staging of breast
cancer [64], a combination of tumor size, lymph node involvement
and metastasis are used to assign a breast cancer stage. Initially,
tumor size is the first parameter. In stage II a tumor size of 2-5 cm
with/out lymph node involvement and in stage IV, any tumor size
with distant metastasis are the chosen criteria. To translate these
sizes to mouse tumor growth, tumor size was transformed to num-
ber of cancer cells using equation 1.
Equation 1: transforming tumor size to the number of cells in a
given tumor size
Where D is the tumor diameter and d is the cancer cell diameter
which was assumed as 10 µm. Therefore, a human tumor with a
diameter of 2 cm, has a volume of 4186.67 mm3
and 8×109
number
of cells. Counting in the differences in mouse and human metabol-
ic rate (7:1), a stage II cancer of mouse would have approximately
109
cancer cells and 200 mm3
volume. A stage IV cancer in mouse
would have 2×109
cells and 600 mm3
volume and distant metas-
tasis.
The cell line of choice was MBL-6. isolated from a spontaneous
breast cancer of Balb/C mouse MBL-6 tumors possess similar pa-
thology to human invasive ductal carcinoma [15]. Ten 4-6 weeks
old female Balb/C mice (Pasture Institute, Tehran, Iran) were sub-
cutaneously inoculated with 5×105
MBL-6 cells. When the tumors
reached an approximate size of 200 mm3
(stage II) and 600 mm3
(stage IV) mice were sacrificed. Tissues including tumor, liver,
spleen, lung and lymph nodes were separated aseptically and fixed
in 10% formalin for metastasis analysis.
3.2. CAF Isolation
Tumor tissues were aseptically removed, washed in PBS and
minced with scalpel into 1-3 mm sized fragments. Fragments were
washed in PBS and incubated in an enzyme cocktail consisting
of 0.5% collagenase IV, 0.02% hyaluronidase, 0.25% trypsin and
0.002% DNaseI in DMEM/F12. After 4 hours in 37°C, cell sus-
pensions were fractioned using ficol separation technique. The in-
terface layer of ficol consisted of fibroblast and the pellet consisted
of mostly cancer cells. Fibroblasts were washed in PBS and plat-
ed in DMEM/F12 (GIBCO, USA) supplemented with 30% FBS,
(GIBCO, USA) and 1% penicillin/streptomycin (Biosera, UK) in
flasks coated with 0.1% gelatin (Sigma, Germany). Fibroblastic
colonies were passaged in 10% FBS DMEM/F12. The passage 2
and 3 cells were characterized and used for future evaluations.
3.3. CAF Characterization and Immunostaining
The cell surface expression of CAF markers were analyzed using
the following antibodies: PE conjugated anti-CD29, anti-CD105,
anti-HLA-DR, anti-CD45, anti-CD90 and anti-FAP; FITC con-
jugated anti-CD104a (PDGFRa), anti-Sca-1 (eBioscience). Cells
were divided into aliquots (5 × 105 each), stained with FITC- or
PE-conjugated antibodies. Results were analyzed by BD FACS
flow cytometry and Flowjo software (version 7.6.1). Additionally,
isolated CAFs were stained for expression of FAP-1 using rabbit
anti-FAP-1 and FITC conjugated goat anti-rabbit IgG.
3.4. Colony Forming Unit – Fibroblast
The CFU-F assay was performed using a modification of a de-
scribed protocol. Cells cultured were resuspended in the above
medium in three concentrations of 100, 500 and 1000 viable cells
in 10cm dish. The medium was changed 2 times per week. On
the 14th day, cultures were fixed with 4% PFA and stained with
crystal violet. Fibroblastic colonies with more than 50 cells and
or possessing a diameter greater than 2mm were counted under
an inverted microscope. Three CAFs were evaluated in triplicate.
3.5. Growth Curve
CAFs were cultured in DMEM at an initial density of 5000 per
well in 24 well plates. At 24-hour intervals, MTT assay was per-
formed and the optical density was corrected using a standard cell
curve. The growth curve was evaluated for 13 consecutive days.
3.6. CAFs and the Immune System in Vitro
3.6.1. Proliferation of Splenocytes: The ability of CAF to affect
immune cell proliferation was assessed using MTT proliferation
assay. Triplicates of mitomycin-inactivated CAFs or MBL-6 and
splenocytes were co-cultured in contact or with Conditioned Me-
dia (CM), in a 96-well plate (TPP) at four ratios of 1:10, 1:50,
1:100 and 1:250 in 200µL of RPMI supplemented with 10% FBS,
penicillin/streptomycin (100 mg/mL) and amphotericin B (2.5 ng/
mL) at 37°C in a humid atmosphere containing 5% CO2
. PHA
was added to stimulate splenocytes. After 72 hours, splenocyte
proliferation was assessed using MTT assay. As a positive con-
trol, splenocytes were activated by 5µg/ mL PHA (Baharafshan,
Teahran, Iran) and the negative control was untreated splenocytes.
clinicsofoncology.com 2
Volume 4 Issue 1 -2021 Research Article

3. Proliferation of treated splenocytes was calculated and expressed
as stimulation index.
3.6.2. Cytokine Production: Splenocytes were co-cultured in
contact or with conditioned medium of Mitomycin-inactivated
CAF and MBL-6 cell line in a 24-well plate (TPP) at 1:10 ratio
in 1 mL of RPMI supplemented with 10% FBS, (100 units/mL)
penicillin/(100 mg/mL) streptomycin at 37°C in a humid atmo-
sphere containing 5% CO2
. PHAwas added andAfter 72 hours, the
supernatant was collected and the level of IL-10, IL-17, TGF-β1,
and Prostaglandin E2 was assessed by ELISA (DuoSet ELISA De-
velopment kit, R&D systems, Minneapolis, MN, USA). All pro-
cedures were followed according to the manufacturer’s protocol.
3.7. Nitric Oxide Production
NO levels (nmol/ml) were measured in culture supernatants by
the Griess reaction. Briefly, nitrite was measured by adding equal
volumes of Griess reagent (1% sulphanilamide and 0.1% naphth-
ylenediamine in 5% phosphoric acid) to conditioned media sam-
ples. The optical density at 550 nm was measured by using a mi-
croplate reader. Varying concentration solutions of sodium nitrite
prepared in the culture medium were used for standard curve cal-
culations. Fresh medium was used as blank for background absor-
bance of NO production. All chemicals were obtained from Merck
(Darmstadt, Germany).
3.8. Gene Expression Analysis Using qRT-PCR
Gene Expression was assessed using Real-Time PCR. After CAF
isolation, total cellular RNA was extracted using Trizol (Gib-
co-BRL, Life Technologies, MD). Random hexamer-primed
reverse transcription (Metabion) was performed on aliquots (1
µg) of total RNA as a template. The resulting cDNA was used
for Real-Time PCR amplification. Primers for cycloxygenase 2
(COX-2), inducible Nitric Oxide Synthetase (iNOS), Indolamine
Deoxygenase (IDO), Matrix Metalloproteinase 2 (MMP2) and 9
(MMP9) and beta-actin were synthesized based on the reported
sequences as follows:
• COX-2 (145 bp) forward: AGACAGATCATAAGCGAGGAC,
reverse: CCACCAATGACCTGATATTTC;
• INOS (142 bp): forward: TGTGCGAAGTGTCAGTGG, re-
verse: TCCTTTGAGCCCTTTGTG;
• IDO (168 bp): forward: GGATGCGTGACTTTGTGG, reverse:
TGGAAGATGCTGCTCTGG;
• MMP2 (150 bp): forward: AGACAAGTTCTGGAGATA-
CAATG, reverse: GCACCCTTGAAGAAGTAGC;
• MMP9 (136 bp): forward: GGCGTGTCTGGAGATTCG, re-
verse: TGGCAGAAATAGGCTTTGTC
Real-time PCR reaction mixtures (final volume of 30 ul) contained
1 µl cDNA, 30 pmol of each primer, 3 µl of 200 µM dNTP, and
1U Taq-DNA polymerase (MBI Fermentas Inc., Burlington, ON).
Amplification conditions were as follows: 25 cycles of 94°C for 30
s; 55°C for 60 s; and 72°C for 1 min, followed by 72°C incubation
for 10 min (Corbett cycler). The results of primer amplification
were analyzed using Rotor-Gene 6000 and REST software.
4. Statistical Analysis
All data is presented as mean±SEM otherwise stated. Data was
analyzed by SPSS v.19 software and GraphPad Prism v. 8. The rel-
ative expressions and heatmap demonstration were analyzed using
REST software and R studio respectively. A P-value less than 0.05
was considered as statistical significance.
5. Results
5.1. Two Pathological Stages Were Successfully Established in
Tumor Bearing Balb/C Mice
MBL-6 is a cell line isolated from a spontaneous invasive duc-
tal carcinoma of mammary glands of Balb/C mouse. This tumor
was preserved using SC transplantations [15]. This model has the
advantage of long in situ growth prior to metastasis formation,
permitting various evaluations. Subcutaneous growth of cell line
was measured with a digital vernier caliper (Mitutoyo, Japan) and
tumor volume was converted to cell number. When the number of
estimated cells reached 1×109
or 2×109
cells, mice were grouped
as stage II and IV respectively. after tumors became palpable, they
were measured daily. As seen in Figure 1a, after ten days, they
reached stage II. after 1 week they reached stage IV. At this time
point metastasis was evaluated using H&E staining of various tis-
sues. As shown in figure 1b in stage-II none of the resected tissues
showed traces of metastasis where as in stage-IV all the tissues
showed cancer cell growths.
5.2. Stage II CAFs Show Higher Proliferation Capacities
Isolated fibroblasts were evaluated for their surface marker expres-
sion (figure 1c). CD29, CD90, CD105, FAP-1, HLA-DR, CD45,
CD11b and SCA-1 comparison showed that stage-II and -IV CAFs
have similar marker expression. However, the expression of HLA-
DR was higher in stage IV CAFs (P<0.05) (figure 1d). Additional-
ly, immune staining of CAFS in culture showed FAP-1 expression
in stage-II and -IV CAFs (figure 2a). these results confirm that the
isolation technique was able to efficiently isolate carcinoma asso-
ciated fibroblasts from two different stages.
Growth curve of isolated CAFs was evaluated for 13 consecutive
days. Each day, proliferation of 5000 seeded cells were evaluat-
ed using MTT assay. The optical density was corrected using a
MTT-cell standard curve. As shown in figure 2b CAFs growth
curve was similar until day 8 from which stage IV CAFs showed
lower proliferation capacity. Statistical analysis showed that from
day 11 the growth of CAF-II was significantly higher compared
to CAF-IV. Curve equation evaluations calculated the doubling
time of CAF-II as 2.891 and CAF-IV as 1.607 days. The ability
of CAFs to form fibroblastic colonies was evaluated using CFU-F
assay. figure 2c depicts the number of CFU-F cells obtained at
passage 3. CFU-F assay was performed in three concentrations;
clinicsofoncology.com 3
Volume 4 Issue 1 -2021 Research Article

4. 1000, 500,100. Number of colonies was counted in three repeats
for three separate isolated CAF. Statistical analysis showed signif-
icant difference between the numbers of colonies CAF-II was able
to launch (p-value< 0.001). the number of colonies were lower in
CAFs derived from stage IV.
Figure 1. (a) In vivo tumor growth curve of MBL-6 in Balb/C mice showed 100% engraftment. After 10-12 days, tumors reached 109 cells. These mice were grouped as
stage-II. After 4 weeks of inoculation they reached 2×109 cells which were grouped as stage-IV. (b) Metastasis growth in the liver, spleen, lung and lymph node of stage
II and IV of tumor bearing mice compared to healthy tissues. The H&E staining of tissue sections revealed that mice in stage II had minor metastasis to lymph node and
liver (n=1 in 5) and mice in stage IV showed signs of metastasis in all the tissues evaluated (n=5). (c) Flow cytometry was used for comparison of CAFs’ surface markers.
Expression of CD29, CD90, CD105, FAP-1, HLA-DR, CD45, CD11b and SCA-1 was evaluated and data revealed that expression of HLA-DR was higher in stage 4
CAFs (P-value <0.001).
Figure 2: (a) immunocytochemistry of stage IV CAFs stained with rabbit anti-FAP-1 and secondary FITC conjugated goat anti-rabbit IgG. (b) growth curve comparison
of stage II and stage IV CAFs demonstrated higher proliferation capacities of CAF-II cells. (c) CFU-F assay of isolated CAFs revealed significantly higher proliferation
potential in CAF-II cells. Stimulation index of splenocytes in co-culture with (d)CAF-IV (e) MBL-6 and (f) CAF-II cells and their respective conditioned media (CAF2c,
CAF4c and MBL-6c) was performed in four ratios. Coculture with stage-II CAFS (f) significantly augmented splenocyte proliferation in a cell contact dose dependent
manner. The same pattern was observed with stage-IV CAFs however the increase in splenocyte proliferation was significantly higher in stage-II cultures (P value <.000).
Coculture with MBL-6 or its CM suppressed splenocyte proliferation which was greater in the highest ratio (P value >.05 for in group comparisons and CAF-IV, p value
< 0.00 with CAF-II).
clinicsofoncology.com 4
Volume 4 Issue 1 -2021 Research Article

5. 5.3. Stage II and IV CAFs Utilize Different Mechanisms of Im-
mune Suppression
MTT assay was used to measure the proliferation of splenocytes
co-cultured with Triplicates of mitomycin-inactivated CAFs in cell
contact or conditioned media at four ratios. Results showed that the
presence of stage-II CAFs (figure 2f) induced the proliferation of
splenocytes in a cell contact dose dependent manner. On the other
hand, CAF-II secretome had inhibitory properties. The greatest SI
was seen in co-culture of 1:10 ratio of CAFs-II (P value=.000) and
the SI decreased with lowering ratio. What causes the inhibitory
properties of CAF-II secretome? Inhibitory cytokines include IL-
10 and TGF-β. Evaluation of cytokines revealed that CAF-II pro-
duced= copious amounts of TGF-β but negligible levels of IL-10
(figure 3a). However, they were able to induce IL-10 in activated
splenocytes. Therefore, the inhibition of splenocyte proliferation
were due to TGF-β and possibly regulatory T cell differentiation
indicated by IL-10 production. the same result was not observed
in co-cultures with CAF-IV and MBL-6 which suppressed sple-
nocyte proliferation through cellular contact and their secretome.
CAF-IV and MBL-6 did not produce IL-10 or TGF-β but were
able to induce IL-10 in activated splenocytes which efficiently
halts splenocyte proliferation.
Results indicated that IL10 production was limited to splenocytes
and either activated with PHA or not stimulated, the production
of IL10 by splenocytes alone was significantly lower than other
cocultures. CAFs and MBL-6 cell line did not produce IL10 even
under PHA stimulation (figure 3a). Therefore, in cocultures it can
be assumed that the IL10 is of splenocyte origin. Spontaneous pro-
duction of TGF-β1 was seen in activated and not activated sple-
nocytes, however not significantly different. Additionally, Produc-
tion of TGF-β1 in other cocultures was not statistically significant
compared to splenocytes. However, production of TGF-β1 was
highest in stage 2 CAFs. In this case TGF-β1 was produced main-
ly by CAF-II cells. Therefore, its expression in splenocytes needs
further investigation.
5.4. Inflammatory Status of CAFs are Similar in Both Stages
but Different Suppression Mechanisms are Employed
IL-17 is an inflammatory cytokine with both pro- and anti-tumor
functions. Spontaneous production of Splenocytes with/out PHA
was not significant figure 3a and resembled that of media and
CAFs. Therefore, it can be assumed that IL-17 is only produced
from slpenocytes. in the presence of CAFs, splenocytes produced
copious amounts of IL17 (figure 3a). Production of IL17 was in-
duced only in the presence of PHA and in cellular contact with
CAFs (P value < .000). Both stages of CAFs were able to induce
IL17 (P value >.05). The importance of cellular contact for induc-
tion of IL17 indicates involvement of CAFs’ surface molecules
and secretory factors are not able to induce IL17 alone. cell line or
secretome of CAFs did not affect the production of IL17 compara-
ble to spontaneous production of splenocytes.
Figure 3: (a) cytokine pattern of CAFs, MBL-6 and their corresponding cocultures (CC) or with conditioned media (CM), with/out PHA (P) stimulation of splenocytes
(SPL) in vitro were evaluated with ELISA. Similar patterns of IL-10, IL-17 and PGE2 production was observed however the expression of TGF-β1 was significantly
higher in stage 2 CAFs (P<.000). (b) study design included (step 1) initial stage establishment and (step 2) CAF isolation. Afterwards (step 3) CAFs were characterized
using surface marker expression, growth curve and CFU-F assay. in step 4 we evaluated the immunomodulatory properties using splenocyte proliferation and cytokine
profiling of CAFs and in coculture with splenocytes. Step 5, Inflammatory enzymes and mediators were evaluated using real-time qPCR.
Gene expression and ELISA revealed that Both stage 2 and stage
4 CAFs express COX-2 and produce PGE2 and splenocytes, ei-
ther activated or not, and the cell line do not produce any PGE2
(P>0.05). in co cultures of CAFs and splenocytes the production
of PGE2 was significantly higher compared to CM cultures, which
indicates cellular interactions are involved (Figure 4a). The origin
of this PGE2 is not clear however it can be an indication of in-
creased inflammatory milieu in the tumor microenvironment.
clinicsofoncology.com 5
Volume 4 Issue 1 -2021 Research Article

6. Nonspecific production of NO was seen in splenocytes, with/
out PHA stimulation (figure 4). However, production of NO was
augmented when CAF-IV or cell line or their CM was present.
As shown in figure 4b, MBL-6 had no production of NO, but in
cellular contact with splenocytes, increased amount of NO was
observed. Highest amount of NO was observed from CAF-IV
cultures (P value = .009) and in coculture with splenocytes, the
amount of NO was not significantly altered (P value > .05). Inter-
estingly, significantly low amount of NO was seen in CAF-II and
their cocultures with splenocytes (P value < .001). gene expression
analysis showed that the level of IDO mRNA was higher in stage
2 CAFs by a mean factor of 182.9 (P< .000) and iNOS was signifi-
cantly higher in stage 4 CAFs by a mean factor of 0.490 (P<.000).
The expression of matrix metalloproteinase 2 and 9 were analyzed
by qPCR. The relative mRNA expression, heatmap comparison
and volcano plots are shown in figure 4 c-e. The relative expres-
sions and heatmap demonstration were analyzed using REST soft-
ware and R studio respectively. Real-time PCR analysis revealed
that the expression of MMP2 and MMP9 was similar in both CAFs
(P>.05). however not significant but MMP2 was higher in CAF-II
and MMP9 was higher in CAF-IV.
Figure 4: a production of PGE2 in CAFs, MBL-6 and their corresponding cocultures with splenocytes in vitro was evaluated with ELISA. b Nitric oxide production was
evaluated using Griess reagent. Data revealed that highest amount of NO was produced by stage 4 CAFs (P<.000) and stage 2 CAFs produced very low amounts of NO.
With no production of NO itself, MBL-6 was able to induce NO in splenocytes with higher production in cell-cell contact. relative gene expression analysis (c), heatmap
comparison (d) and volcano plot (d) of MMP2, MMP9, COX-2, IDO, and iNOS expression. mRNAs were extracted from CAFs in passage 2. cDNA was synthesized and
Real-time PCR was used to compare gene expressions. CAF-IV was used as Control and CAF-II as the Target in REST analysis. Significant increase in IDO expression
was observed in CAF-II and iNOS expression was significantly higher in CAF-IV. (***: P<.000)
6. Discussion
Cellular communications can be done through cell to cell or
through molecule to molecule. The immune system employs both
and to fully clarify the interactions influencing the immune re-
sponse in tumors, numerous molecules must be investigated. Ad-
ditionally, the inflammatory milieu of cancer microenvironment is
more divergent, aiding tumor growth and progression. Therefore,
in this study, we investigated the level of cytokines and inflamma-
tory enzymes in cocultures of carcinoma associated fibroblasts and
splenocytes.
The MBL-6 cell line is isolated from a spontaneous tumor in bal-
b/c mice and was able to form stable growing tumors in Balb/C
mice [15]. Using tumor kinetics and metabolic differences, we
were able to correctly predict the time of each stage. This allows
for closer observation of tumor progression and opens the possi-
bility for comparison of different aspects of tumor biology and
treatment in various stages in animal models. In addition, the rela-
tively moderate growth rate in vivo, this line can provide increased
accuracy of experimental settings. Accordingly, a tangible stroma
is provided by this model, which permits tumor microenvironment
assessments. Activated stroma is observed in many cancers [16,
17] and carcinoma associated fibroblasts represent the supporting
stroma.
clinicsofoncology.com 6
Volume 4 Issue 1 -2021 Research Article

7. From both stage II and stage IV tumor tissue, CAFs were isolat-
ed and characterized which showed similar phenotypes. Although
other researches have reported that CAFs do not express HLA-DR
[18, 19], our study showed increased expression of HLA-DR on
stage IV CAFs which can be the result of inflammatory micro-
environment [20, 21]. This variance can be due to evaluations in
different stages in different studies. In the absence of co-stimula-
tion CAFs can induce anergy in activated T cells [22], which was
evident as lower stimulation index in stage IV co-cultures. Similar
study by Peng et. al. showed lower proliferation of T cells in re-
sponse to dendritic cells pre-treated with HCC isolated CAFs [23].
It has been shown that in inflammatory states, fibroblasts are able
to express HLA-DR [24-27] and in some cases antigen presenta-
tion was observed [27, 28]. Therefore, CAFs are not merely mod-
ulators of immune response in the tumor microenvironment, they
can actively alter the response by direct engagement with activated
T cells. In cellular contact, Stage-II CAFs, showed stimulating
properties with significant increase in splenocyte proliferation. As
they express lower levels of HLA-DR, the cytokine milieu may
promote T cell survival [29], albeit, our study revealed that CAF-
II conditioned media suppressed splenocyte proliferation in a dose
dependent manner. studies have shown that interaction of immune
cells and CAFs promote expression of co-inhibitory markers such
as TIM-3, PD-1, CTLA-4 and LAG-3 in proliferating CD4+ and
CD8+ T-cells 18, which indicates Treg differentiation
Cytokines are potent drivers of immune responses and are ex-
pressed not only by immune cells but various cell types are able
to produce cytokines in response to microenvironment stimuli. Al-
though CAFs are not responsible for IL-10 production, they were
able to induce IL-10 production in splenocyte. Looking into the
cause, production of PGE2 in the presence of TGF-β1 increases
the production of IL-10 and inhibits IL-12 [30, 31]. Therefore, the
increased expression of COX-2 in CAFs and TGF-β1 production
could lead to Treg differentiation and IL-10 production in activated
T cells. In addition, nitric oxide also interferes with IL-2 signaling
required for T cell proliferation [32] which is increased in stage-IV
CAFs. Therefore, CAF-IV inhibited immune cell proliferation via
multiple routes and alter their differentiation.
IL-17 is known for its pro-tumorigenic and angiogenic properties
[33-35]. It is shown that PGE2 promotes IL-17 production 36 and
Treg differentiation via PGE2/COX-2 pathway [37, 38]. Our re-
sults showed that IL-17 is produced in both stages, only in cellular
contact and requires PHA stimulation. Studies have shown that
TH17 differentiation and IL-17 production increases with gastric
cancer stage [39] and is involved in promoting metastasis [40].
Other studies have shown the elevated levels of TGF-β1 in stromal
cells of cancerous tissues [41], however the stage in which the
expression was evaluated was not defined. It is noteworthy that
in cocultures with MBL-6 no significant amount of differentiation
cytokine was produced. Although this cannot be extrapolated to
other cell lines, but it can be presumed that the role of CAFs in
immunosuppression is superior to cancer cells.
IDO is a wound healing enzyme [42, 43] and is induced by IFN-γ
[44], IL-12 and IL-18 [45] and PGE2 which requires additional
signaling from other cytokines such as TNF-α [46]. IDO plays an
important role in the immune response by catalyzing the oxidative
degradation of l-tryptophan that contributes to immune-suppres-
sion [47]. In response to TGF-β1, pDCs express IDO and show
tolergenic properties and has a tonic, nonenzymic function that
contributes to TGF-b-driven tolerance [48]. However, IDO is sen-
sitive to NO [49-51], therefore as seen in our results and other
studies, with advancing stage in which iNOS is increasingly ex-
pressed, IDO declines. In a study by Jian-Pei Feng, a cross-regu-
latory pathway was shown between the IDO and NO pathways, in
which the inhibition of IDO stimulated the iNOS pathway and vice
versa [52]. In this study it was shown that only when both path-
ways were inhibited tolerance was abrogated. Thus, both pathways
are involved in tolerance. Hence when considering immune activa-
tion in cancer therapies, numerous pathways must be considered.
In conclusion, the main difference between the CAFs, was the ex-
pression of TGF-β1 and IL-10. TGF-β1 and PGE2 induce IL-10
production [53-55], Additionally, IL-10 inhibits IL-17 and PGE2
production [56-59]. Therefore, increased expression of IL-10 in
stage-IV could be an attempt to control inflammation. There are
differences between TGF-β1 and IL-10 suppression. TGF-β1 sup-
pression is at translational level and consist of 12-16 hours and IL-
10 suppression increases mRNA degradation and take in 3 hours
[60]. Considering these differences, stage-II cancer can be con-
sidered a transforming stage with acute inflammation profile and
stage-IV has an immunosuppressive chronic inflammation profile
(Figure 5). There are many queries regarding the tumor microenvi-
ronment and additional studies are required. In view of our results,
when considering an immunotherapy regiment, it is advisable to
investigate the microenvironment and whether it is compliant to
the type of intended treatment, thereby increasing the probability
of successful therapy.
clinicsofoncology.com 7
Volume 4 Issue 1 -2021 Research Article

8. Figure 5: comparison of different immune suppression mechanisms in stage-II and sage-IV microenvironments. In stage II CAFs produce IDO and COX-2 which in
conjugation with TGF-β induce IL-17 and VEGF and consequently tumor growth and progression. In stage IV, CAFs produce NO and COX-2 leading to Treg cell
differentiation, MMP9 production and EMT.
References
1. Valkenburg KC, de Groot AE, Pienta KJ. Targeting the tumour stro-
ma to improve cancer therapy. Nat Rev Clin Oncol. 2018; 15: 366-
81.
2. Bremnes RM, Dønnem T, Al-Saad S, et al. The Role of Tumor Stro-
ma in Cancer Progression and Prognosis: Emphasis on Carcino-
ma-Associated Fibroblasts and Non-small Cell Lung Cancer. Jour-
nal of Thoracic Oncology. 2011; 6: 209-17.
3. Räsänen K, Vaheri A. Activation of fibroblasts in cancer stroma. Ex-
perimental cell research. 2010; 316: 2713-22.
4. Erez N, Truitt M, Olson P, Hanahan D. Cancer-associated fibroblasts
are activated in incipient neoplasia to orchestrate tumor-promoting
inflammation in an NF-κB-dependent manner. Cancer cell. 2010;
17: 135-47.
5. Erdogan B, Webb DJ. Cancer-associated fibroblasts modulate
growth factor signaling and extracellular matrix remodeling to regu-
late tumor metastasis. Biochemical Society Transactions. 2017; 45:
229-36.
6. Servais C, Erez N. From sentinel cells to inflammatory culprits:
cancer-associated fibroblasts in tumour-related inflammation. The
Journal of pathology. 2013; 229: 198-207.
7. Nielsen MFB, Mortensen MB, Detlefsen S. Key players in pancre-
atic cancer-stroma interaction: Cancer-associated fibroblasts, endo-
thelial and inflammatory cells. World journal of gastroenterology.
2016; 22: 2678.
8. Hawinkels L, Paauwe M, Verspaget H, et al. Interaction with colon
cancer cells hyperactivates TGF-β signaling in cancer-associated fi-
broblasts. Oncogene. 2014; 33: 97-107.
9. Li T, Yang Y, Hua X, et al. Hepatocellular carcinoma-associated fi-
broblasts trigger NK cell dysfunction via PGE2 and IDO. Cancer
letters. 2012; 318: 154-61.
10. Zhai J, Shen J, Xie G, et al. Cancer-associated fibroblasts-derived
IL-8 mediates resistance to cisplatin in human gastric cancer. Cancer
letters. 2019; 454: 37-43.
11. Nagasaki T, Hara M, Nakanishi H, Takahashi H, Sato M, Takeyama
H. Interleukin-6 released by colon cancer-associated fibroblasts is
critical for tumour angiogenesis: anti-interleukin-6 receptor anti-
body suppressed angiogenesis and inhibited tumour–stroma interac-
tion. British journal of cancer. 2014; 110: 469-78.
12. Zhou Q, Wu X, Wang X, et al. The reciprocal interaction between tu-
mor cells and activated fibroblasts mediated by TNF-α/IL-33/ST2L
signaling promotes gastric cancer metastasis. Oncogene. 2020; 39:
1414-1428.
13. Tsellou E, Kiaris H. Fibroblast independency in tumors: implica-
tions in cancer therapy. 2008.
14. Räsänen K, Virtanen I, Salmenperä P, Grenman R, Vaheri A. Dif-
ferences in the nemosis response of normal and cancer-associated
fibroblasts from patients with oral squamous cell carcinoma. PLoS
One. 2009; 4: e6879.
15. Langroudi L, Hasan ZM, Ardeshirylajimi A, Soleimani M. Isola-
tion and characterization of a new cell line from spontaneous mouse
mammary tumour, MBL-6, for in vivo cancer studies. Veterinary
Science Development. 2017; 7.
16. De Wever O, Mareel M. Role of tissue stroma in cancer cell inva-
sion. The Journal of Pathology: A Journal of the Pathological Soci-
ety of Great Britain and Ireland. 2003; 200: 429-47.
clinicsofoncology.com 8
Volume 4 Issue 1 -2021 Research Article

9. 17. Shimoda M, Mellody KT, Orimo A. Carcinoma-associated fibro-
blasts are a rate-limiting determinant for tumour progression. Semi-
nars in Cell & Developmental Biology. 2010; 21: 19-25.
18. Gorchs L, Fernández Moro C, Bankhead P, et al. Human pancreatic
carcinoma-associated fibroblasts promote expression of co-inhibi-
tory markers on CD4+ and CD8+ T-cells. Frontiers in immunology.
2019; 10: 847.
19. Gunaydin G, Kesikli SA, Guc D. Cancer associated fibroblasts have
phenotypic and functional characteristics similar to the fibrocytes
that represent a novel MDSC subset. 2015; 4(9): e1034918.
20. Epstein SP, Gadaria-Rathod N, Wei Y, Maguire MG, Asbell PA.
HLA-DR expression as a biomarker of inflammation for multicenter
clinical trials of ocular surface disease. Exp Eye Res. 2013; 111:
95-104.
21. Newman PJ. The biology of PECAM-1. The Journal of clinical in-
vestigation. 1997; 99: 3-8.
22. Wang S-F, Fouquet S, Chapon M, et al. Early T cell signalling is re-
versibly altered in PD-1+ T lymphocytes infiltrating human tumors.
PloS one. 2011; 6: e17621.
23. Cheng J, Deng Y, Yi H, et al. Hepatic carcinoma-associated fibro-
blasts induce IDO-producing regulatory dendritic cells through
IL-6-mediated STAT3 activation. Oncogenesis. 2016; 5: e198-e198.
24. Boots A, Wimmers-Bertens A, Rijnders A. Antigen-presenting ca-
pacity of rheumatoid synovial fibroblasts. Immunology. 1994; 82:
268.
25. Olsson M, Rosenqvist M, Nilsson J. Expression of HLA-DR an-
tigen and smooth muscle cell differentiation markers by valvular
fibroblasts in degenerative aortic stenosis. Journal of the American
College of Cardiology. 1994; 24: 1664-71.
26. Lochhead RB, Ordoñez D, Arvikar SL, et al. Interferon-gamma pro-
duction in Lyme arthritis synovial tissue promotes differentiation
of fibroblast-like synoviocytes into immune effector cells. Cellular
microbiology. 2019; 21: e12992.
27. Hutton AJ, Polak ME, Spalluto CM, et al. Human lung fibroblasts
present bacterial antigens to autologous lung Th cells. The Journal
of Immunology. 2017; 198: 110-8.
28. Elyada E, Bolisetty M, Laise P, et al. Cross-species single-cell anal-
ysis of pancreatic ductal adenocarcinoma reveals antigen-presenting
cancer-associated fibroblasts. Cancer discovery. 2019; 9: 1102-23.
29. Scott S, Pandolfi F, Kurnick JT. Fibroblasts mediate T cell survival:
a proposed mechanism for retention of primed T cells. The Journal
of experimental medicine. 1990; 172: 1873-6.
30. Van der Pouw Kraan T, Boeije L, Smeenk R, Wijdenes J, Aarden
LA. Prostaglandin-E2 is a potent inhibitor of human interleukin 12
production. The Journal of experimental medicine. 1995; 181: 775-
9.
31. Yao G, Wang S, Sun L. Thu0226 Mesenchymal Stem Cell Trans-
plantation Ameliorates Experimental Sjögren’s Syndrome by
Downregualting Mdscs Via Cox2/Pge2 Pathway. BMJ Publishing
Group Ltd; 2020.
32. Sato K, Ozaki K, Oh I, et al. Nitric oxide plays a critical role in sup-
pression of T-cell proliferation by mesenchymal stem cells. Blood.
2007; 109: 228-234.
33. Wu X, Yang T, Liu X, et al. IL-17 promotes tumor angiogenesis
through Stat3 pathway mediated upregulation of VEGF in gastric
cancer. Tumor Biology. 2016; 37: 5493-501.
34. Li T-J, Jiang Y-M, Hu Y-F, et al. Interleukin-17–producing neutro-
phils link inflammatory stimuli to disease progression by promoting
angiogenesis in gastric cancer. Clinical Cancer Research. 2017; 23:
1575-85.
35. Huang Q, Qian X, Fan J, et al. IL-17 promotes angiogenic factors
IL-6, IL-8, and Vegf production via Stat1 in lung adenocarcinoma.
Scientific reports. 2016; 6: 36551.
36. Du B, Zhu M, Li Y, Li G, Xi X. The prostaglandin E2 increases the
production of IL‐17 and the expression of costimulatory molecules
on γδ T cells in rheumatoid arthritis. Scandinavian Journal of Immu-
nology. 2020; 91: e12872.
37. Bai M, Zhang L, Fu B, et al. IL-17Aimproves the efficacy of mesen-
chymal stem cells in ischemic-reperfusion renal injury by increasing
Treg percentages by the COX-2/PGE2 pathway. Kidney Interna-
tional. 2018; 93: 814-25.
38. Paulissen SM, van Hamburg JP, Davelaar N, Asmawidjaja PS,
Hazes JM, Lubberts E. Synovial fibroblasts directly induce Th17
pathogenicity via the cyclooxygenase/prostaglandin E2 pathway, in-
dependent of IL-23. The Journal of Immunology. 2013; 191: 1364-
1372.
39. Zhang B, Rong G, Wei H, et al. The prevalence of Th17 cells in
patients with gastric cancer. Biochemical and biophysical research
communications. 2008; 374: 533-7.
40. Li Q, Han Y, Fei G, Guo Z, Ren T, Liu Z. IL-17 promoted metastasis
of non-small-cell lung cancer cells. Immunology letters. 2012; 148:
144-50.
41. Rosenthal E, McCrory A, Talbert M, Young G, Murphy-Ullrich J,
Gladson C. Elevated expression of TGF-β1 in head and neck can-
cer–associated fibroblasts. Molecular Carcinogenesis: Published
in cooperation with the University of Texas MD Anderson Cancer
Center. 2004; 40: 116-21.
42. Bandeira LG, Bortolot BS, Cecatto MJ, Monte-Alto-Costa A, Ro-
mana-Souza B. Exogenous tryptophan promotes cutaneous wound
healing of chronically stressed mice through inhibition of TNF-α
and IDO activation. PloS one 2015; 10: e0128439.
43. Ito H, Ando T, Ogiso H, Arioka Y, Saito K, Seishima M. Inhibition
of indoleamine 2, 3-dioxygenase activity accelerates skin wound
healing. Biomaterials. 2015; 53: 221-8.
44. Pereiro P, FiguerasA, Novoa B. Insights into teleost interferon-gam-
ma biology: An update. Fish & Shellfish Immunology. 2019; 90:
150-64.
45. Liebau C, Baltzer A, Schmidt S, et al. Interleukin-12 and interleu-
kin-18 induce indoleamine 2, 3-dioxygenase (IDO) activity in hu-
man osteosarcoma cell lines independently from interferon-gamma.
clinicsofoncology.com 9
Volume 4 Issue 1 -2021 Research Article

10. Anticancer research. 2002; 22: 931-6.
46. Braun D, Longman RS, Albert ML. A two-step induction of in-
doleamine 2, 3 dioxygenase (IDO) activity during dendritic-cell
maturation. Blood. 2005; 106: 2375-81.
47. Hornyák L, Dobos N, Koncz G, et al. The role of indoleamine-2,
3-dioxygenase in cancer development, diagnostics, and therapy.
Frontiers in immunology. 2018; 9: 151.
48. Pallotta MT, Orabona C, Volpi C, et al. Indoleamine 2, 3-dioxygen-
ase is a signaling protein in long-term tolerance by dendritic cells.
Nature immunology. 2011; 12: 870-8.
49. Thomas SR, Mohr D, Stocker R. Nitric oxide inhibits indoleamine
2, 3-dioxygenase activity in interferon-gamma primed mononuclear
phagocytes. Journal of Biological Chemistry. 1994; 269: 14457-64.
50. Hucke C, MacKenzie CR, Adjogble KD, Takikawa O, Däubener
W. Nitric oxide-mediated regulation of gamma interferon-induced
bacteriostasis: inhibition and degradation of human indoleamine 2,
3-dioxygenase. Infection and immunity. 2004; 72: 2723-30.
51. López AS, Alegre E, Díaz A, Mugueta C, González A. Bimodal ef-
fect of nitric oxide in the enzymatic activity of indoleamine 2, 3-di-
oxygenase in human monocytic cells. Immunology letters. 2006;
106: 163-71.
52. Ye QX, Xu LH, Shi PJ, Xia T, Fang JP. Indoleamine 2,3-dioxygen-
ase and inducible nitric oxide synthase mediate immune tolerance
induced by CTLA4Ig and anti-CD154 hematopoietic stem cell trans-
plantation in a sensitized mouse model. Exp Ther Med. 2017; 14:
1884-91.
53. MacKenzie KF, Clark K, Naqvi S, et al. PGE2 induces macrophage
IL-10 production and a regulatory-like phenotype via a protein ki-
nase A–SIK–CRTC3 pathway. The Journal of Immunology. 2013;
190: 565-77.
54. Alvarez Y, Municio C, Alonso S, Crespo MS, Fernández N. The in-
duction of IL-10 by zymosan in dendritic cells depends on CREB ac-
tivation by the coactivators CREB-binding protein and TORC2 and
autocrine PGE2. The Journal of Immunology. 2009; 183: 1471-9.
55. Maeda H, Kuwahara H, Ichimura Y, Ohtsuki M, Kurakata S, Shirai-
shi A. TGF-beta enhances macrophage ability to produce IL-10 in
normal and tumor-bearing mice. The Journal of Immunology. 1995;
155: 4926-32.
56. Niiro H, Otsuka T, Kuga S, et al. IL-10 inhibits prostaglandin E2
production by lipopolysaccharide-stimulated monocytes. Interna-
tional immunology. 1994; 6: 661-4.
57. Liu B, Tonkonogy SL, Sartor RB. Antigen-presenting cell produc-
tion of IL-10 inhibits T-helper 1 and 17 cell responses and suppresses
colitis in mice. Gastroenterology. 2011; 141: 653-62. e654.
58. Gu Y, Yang J, Ouyang X, et al. Interleukin 10 suppresses Th17 cy-
tokines secreted by macrophages and T cells. European journal of
immunology. 2008; 38: 1807-13.
59. Wang P-L, Shirasu S, Shinohar M, et al. IL-10 inhibits Porphyro-
monas gingivalis LPS-stimulated human gingival fibroblasts pro-
duction of IL-6. Biochemical and biophysical research communica-
tions. 1999; 263: 372-7.
60. Bogdan C, Paik J, Vodovotz Y, Nathan C. Contrasting mechanisms
for suppression of macrophage cytokine release by transforming
growth factor-beta and interleukin-10. Journal of Biological Chem-
istry. 1992; 267: 23301-8.
61. Bajzer Ž, Vuk-Pavlović S, Huzak M. Mathematical modeling of tu-
mor growth kinetics. A Survey of Models for Tumor-Immune Sys-
tem Dynamics: Springer 1997; 89-133.
62. Edelstein-Keshet L. Mathematical models in biology. SIAM, 2005.
63. Terpstra A. Differences between humans and mice in efficacy of the
body fat lowering effect of conjugated linoleic acid: role of metabol-
ic rate. The Journal of nutrition. 2001; 131: 2067-8.
64. Cserni G, Chmielik E, Cserni B, Tot T. The new TNM-based staging
of breast cancer. Virchows Archiv. 2018; 472: 697-703.
clinicsofoncology.com 10
Volume 4 Issue 1 -2021 Research Article