SlideShare a Scribd company logo
University of Debrecen
 Centre for Agricultural and Applied
          Economics Science
 Faculty of Agricultural and Food Sciences and
         Environmental Management




 Effect of Stearoyl-COA desaturase gene
polymorphism on milk production traits of
    Hungarian Holstein Friesian cows
         By :
 Tegegn Gudeta, Jaleta (MSc thesis)

                Debrecen , Hungary,
                                       May 2012
Introduction
Marker Assisted selection in modern dairy
Number of studies     conducted in large scale on
 candidate genes in dairy breeding
SCD is hypothesiszed candidate gene
    It catalyze Cis∆-9 desaturation

    Mapped to chromosome 26 in bovine

    SCD 1 and SCD5

    Associated with milk fatty acid composition

Studies of SCD gene not conducted in HHF
Objectives of the study

To estimating allele and genotype frequencies of
 SCD gene polymorphism(878 C/T)

To   determining the effect of SCD gene
 polymorphism on cows milk production traits
Materials and Methods
1) Animals and Milk data
 Hair root samples (8-10) were collected from 277 HHF
  in Tedej Dairy Farm located 15 km north of Debrecen
 One lactation milk record data were collected for 277
  HHF cows-305 day average milk yield (kg), fat yield
  (kg), fat percentage(%), protein yield (kg), protein
  percentage (%) and SCC (10,000 cell/ml)
2) Study Methods
 Molecular Laboratory of UD
 DNA isolation from Hair root
   3-5 hair root+ 100 µL Lysis buffer+1.5 ProteinK
   Water bath for 60 min at 60 0c , for 20 min at 95 oc water
    bath, stored at -20 oc
 Spectrophotometrical Analysis-Nanodrop




                                     Spectrophotometer
       RT-PCR 7300
3) DNA Amplification and Sequencing
 7300 RT-PCR machine (Applied Biosystem)
 Reaction mix(10µL): 1µl DNA, 5µl 1xTaqMan
  MasterMix (PN 4371355, USA), 0.25µl 1xSNP probe and
  3.75µl dH2O.
 TaqMan probe sequence:
   The fluorescent probe VIC: ACTTACCCACAGCTCC
   The fluorescent probe FAM: TTACCCGCAGCTCC




 SCD Primers (625µl 40x mix, Warington, UK,
 WA37PB):
 Forward Primer: CCCCGAGAGAATATTCTGGTTTCC
 Reverse primer : CCACTAGACGTGGTCTTGCT
 Amplification and Sequencing protocol
   Initial steps: Activation at 950C for 10 minutes
    (AmpliTaq Gold DNA polymerase), Melting for 15
    sec at 920C, Annealing/Extension at 600C for 1
    minute (40 cycles).
 The SNP 878 C/T was used in this study and the
  nucleotide substitution was identified according to
  Tanguichi et al., (2004).
4.) Data Analysis

a)Descriptive Statistics using R software (Version: R-
   2.14.2)
b)Hardy-Weinberg Equation
c) Analysis of Variance (ANOVA) using R software
   (Version: R-2.14.2)
Results and Discussion
1. Genotypes and Allele Frequencies of SCD gene
   Polymorphisms




      Amplification   curve   for   CC(left)   and   CT(right)
       genotypes
Result of amplification curve for TT genotype
 (Green line)
Allelic discrimination of SCD genotypes (Blue-CC,
 Green-CT, and Red-TT)
Genotype and allele frequencyy of the SCD gene in the investigated
 Hungarian Holsteins cow population

            No of Animals (Genotype       SCD         P value    X2
                     Frequencies in %)    Allele %


            CC         CT       TT
                                                      0.04695    3.947
Observed    94(34)     148(53) 35(13)     C(0.61)

Expected    102(37)    132(48) 43(15)     T(0.39)
2. Effects of SCD Genotypes on Recorded Milk Production Traits

   Parameter                              Genotype
                         CC          CT              TT            P value
   Fat (%)             3.76±0.41     3.8±0.43        3.7±0.38      0.2272
   Protein (%)         3.22±0.178    3.22±0.178      3.23±0.14     0.998

   SCC(X103 cell/ml)   136±106.4     116±70.2        119±72.7      0.2264
   305 MY (kg)         8277.5±1301   8468.5±1542     8463.4±1294   0.5805


   305 FY (kg)         310.6±52.4    321.9±55.2      313±50.6      0.2505


   305 PY (kg)         266.1±38.5    272.1±45.8      272.3±36.2    0.5315


Mean and standard deviation of milk production traits and its association with
SCD genotypes.
Conclussions
 Higher C allele(0.61) frequency and lower T allele
  (0.39) frequency was reported in this study
 The SCD genotypes frequency in HHF herds under this
  study were not in Hardy-Weinberg equilibrium, the
  possible reason for this result may be small numbers of
  animals included in this study and indicating the herds
  were not in a random mating system
 SCD-878 C/T locus cannot be considered as candidate
  gene in milk production traits
 Further studies will be necessary on large number of
  animals to confirm the current result

More Related Content

What's hot

Crossbreeding for the production of market hogs
Crossbreeding for the production of market hogsCrossbreeding for the production of market hogs
Crossbreeding for the production of market hogs
Deterala Algeron
 
Monitoring, evaluation and learning and summary of baselines for the LIVES pr...
Monitoring, evaluation and learning and summary of baselines for the LIVES pr...Monitoring, evaluation and learning and summary of baselines for the LIVES pr...
Monitoring, evaluation and learning and summary of baselines for the LIVES pr...
ILRI
 
CRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatCRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To Wheat
Fabio Caligaris
 
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
CGIAR Generation Challenge Programme
 
Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...
Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...
Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...
apaari
 
Striving for excellence in yam breeding using genomics tools
Striving for excellence in yam breeding using genomics toolsStriving for excellence in yam breeding using genomics tools
Striving for excellence in yam breeding using genomics tools
International Institute of Tropical Agriculture
 
GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...
GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...
GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...
CGIAR Generation Challenge Programme
 
2017 BDSRA Trometer, Potier, Cournoyer, and Schermer
2017 BDSRA Trometer, Potier, Cournoyer, and Schermer2017 BDSRA Trometer, Potier, Cournoyer, and Schermer
2017 BDSRA Trometer, Potier, Cournoyer, and Schermer
Batten Disease Support and Research Association
 
GRM 2013: Improve common bean productivity for marginal environments in sub-S...
GRM 2013: Improve common bean productivity for marginal environments in sub-S...GRM 2013: Improve common bean productivity for marginal environments in sub-S...
GRM 2013: Improve common bean productivity for marginal environments in sub-S...
CGIAR Generation Challenge Programme
 

What's hot (9)

Crossbreeding for the production of market hogs
Crossbreeding for the production of market hogsCrossbreeding for the production of market hogs
Crossbreeding for the production of market hogs
 
Monitoring, evaluation and learning and summary of baselines for the LIVES pr...
Monitoring, evaluation and learning and summary of baselines for the LIVES pr...Monitoring, evaluation and learning and summary of baselines for the LIVES pr...
Monitoring, evaluation and learning and summary of baselines for the LIVES pr...
 
CRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatCRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To Wheat
 
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
 
Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...
Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...
Does Cryopreservation Stress Impact Genotype Integrity? A Case Study with Ger...
 
Striving for excellence in yam breeding using genomics tools
Striving for excellence in yam breeding using genomics toolsStriving for excellence in yam breeding using genomics tools
Striving for excellence in yam breeding using genomics tools
 
GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...
GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...
GRM 2013: Improving and deploying markers for biotic stresses in cassava -- C...
 
2017 BDSRA Trometer, Potier, Cournoyer, and Schermer
2017 BDSRA Trometer, Potier, Cournoyer, and Schermer2017 BDSRA Trometer, Potier, Cournoyer, and Schermer
2017 BDSRA Trometer, Potier, Cournoyer, and Schermer
 
GRM 2013: Improve common bean productivity for marginal environments in sub-S...
GRM 2013: Improve common bean productivity for marginal environments in sub-S...GRM 2013: Improve common bean productivity for marginal environments in sub-S...
GRM 2013: Improve common bean productivity for marginal environments in sub-S...
 

Similar to Effect of scd gene on milk production

Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Thermo Fisher Scientific
 
Tej alvadás elmélet
Tej alvadás elméletTej alvadás elmélet
Tej alvadás elmélet
Paul Agoston
 
Pulse Genomics Comes of Age
Pulse Genomics Comes of AgePulse Genomics Comes of Age
Pulse Genomics Comes of Age
ICARDA
 
Improved DNA Extraction Method for Porcine Contaminants
Improved DNA Extraction Method for Porcine ContaminantsImproved DNA Extraction Method for Porcine Contaminants
Improved DNA Extraction Method for Porcine Contaminants
Islamic_Finance
 
Characterization of Novel ctDNA Reference Materials Developed using the Genom...
Characterization of Novel ctDNA Reference Materials Developed using the Genom...Characterization of Novel ctDNA Reference Materials Developed using the Genom...
Characterization of Novel ctDNA Reference Materials Developed using the Genom...
Thermo Fisher Scientific
 
SAB presentation to Jim narrated
SAB presentation to Jim narratedSAB presentation to Jim narrated
SAB presentation to Jim narrated
guestba7bf7
 
Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...
Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...
Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...
Asif Shaikh
 
Upfront Transplant Strategies in Aplastic Anemia
Upfront Transplant Strategies in Aplastic AnemiaUpfront Transplant Strategies in Aplastic Anemia
Upfront Transplant Strategies in Aplastic Anemia
spa718
 
Pp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-en
Pp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-enPp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-en
Pp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-en
Alexander Boichenko
 
Detection of transgenic canola (Roundup Ready® - Monsanto)
Detection of transgenic canola (Roundup Ready® - Monsanto)Detection of transgenic canola (Roundup Ready® - Monsanto)
Detection of transgenic canola (Roundup Ready® - Monsanto)
claudio iannetta
 
Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...
Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...
Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...
Irta
 
Tfpcr array poster
Tfpcr array posterTfpcr array poster
Tfpcr array poster
Elsa von Licy
 
Seminar-Kobe-Veleva
Seminar-Kobe-VelevaSeminar-Kobe-Veleva
Seminar-Kobe-Veleva
Petya Veleva
 
Digiwest journa club presentation_18.10.2016
Digiwest journa club presentation_18.10.2016Digiwest journa club presentation_18.10.2016
Digiwest journa club presentation_18.10.2016
Dhirend N. Singh
 
Organizational Heterogeneity of Human Genome
Organizational Heterogeneity of Human GenomeOrganizational Heterogeneity of Human Genome
Organizational Heterogeneity of Human Genome
Svetlana Frenkel
 
Q pcr symposium2007-pcrarray
Q pcr symposium2007-pcrarrayQ pcr symposium2007-pcrarray
Q pcr symposium2007-pcrarray
Elsa von Licy
 
Nucleic Acid Therapy Purity Methods by Capillary Gel Electrophoresis
Nucleic Acid Therapy Purity Methods by Capillary Gel ElectrophoresisNucleic Acid Therapy Purity Methods by Capillary Gel Electrophoresis
Nucleic Acid Therapy Purity Methods by Capillary Gel Electrophoresis
Covance
 
Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...
Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...
Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...
ILRI
 
Principle, Procedure and applications of Digital PCR.pptx
Principle, Procedure  and applications of Digital PCR.pptxPrinciple, Procedure  and applications of Digital PCR.pptx
Principle, Procedure and applications of Digital PCR.pptx
Vikramadityaupmanyu
 
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...
Copenhagenomics
 

Similar to Effect of scd gene on milk production (20)

Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
Evaluation of ctDNA extraction methods and amplifiable copy number yield usin...
 
Tej alvadás elmélet
Tej alvadás elméletTej alvadás elmélet
Tej alvadás elmélet
 
Pulse Genomics Comes of Age
Pulse Genomics Comes of AgePulse Genomics Comes of Age
Pulse Genomics Comes of Age
 
Improved DNA Extraction Method for Porcine Contaminants
Improved DNA Extraction Method for Porcine ContaminantsImproved DNA Extraction Method for Porcine Contaminants
Improved DNA Extraction Method for Porcine Contaminants
 
Characterization of Novel ctDNA Reference Materials Developed using the Genom...
Characterization of Novel ctDNA Reference Materials Developed using the Genom...Characterization of Novel ctDNA Reference Materials Developed using the Genom...
Characterization of Novel ctDNA Reference Materials Developed using the Genom...
 
SAB presentation to Jim narrated
SAB presentation to Jim narratedSAB presentation to Jim narrated
SAB presentation to Jim narrated
 
Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...
Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...
Assessment of Genetic Diversity in Wheat Genotypes by using ISSR Molecular Ma...
 
Upfront Transplant Strategies in Aplastic Anemia
Upfront Transplant Strategies in Aplastic AnemiaUpfront Transplant Strategies in Aplastic Anemia
Upfront Transplant Strategies in Aplastic Anemia
 
Pp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-en
Pp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-enPp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-en
Pp 90505-lc-ms-serum-profiling-biomarker-msacleu2019-pp90505-en
 
Detection of transgenic canola (Roundup Ready® - Monsanto)
Detection of transgenic canola (Roundup Ready® - Monsanto)Detection of transgenic canola (Roundup Ready® - Monsanto)
Detection of transgenic canola (Roundup Ready® - Monsanto)
 
Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...
Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...
Sponsor Day on animal feeding: Ruminants and sustainability: The main improve...
 
Tfpcr array poster
Tfpcr array posterTfpcr array poster
Tfpcr array poster
 
Seminar-Kobe-Veleva
Seminar-Kobe-VelevaSeminar-Kobe-Veleva
Seminar-Kobe-Veleva
 
Digiwest journa club presentation_18.10.2016
Digiwest journa club presentation_18.10.2016Digiwest journa club presentation_18.10.2016
Digiwest journa club presentation_18.10.2016
 
Organizational Heterogeneity of Human Genome
Organizational Heterogeneity of Human GenomeOrganizational Heterogeneity of Human Genome
Organizational Heterogeneity of Human Genome
 
Q pcr symposium2007-pcrarray
Q pcr symposium2007-pcrarrayQ pcr symposium2007-pcrarray
Q pcr symposium2007-pcrarray
 
Nucleic Acid Therapy Purity Methods by Capillary Gel Electrophoresis
Nucleic Acid Therapy Purity Methods by Capillary Gel ElectrophoresisNucleic Acid Therapy Purity Methods by Capillary Gel Electrophoresis
Nucleic Acid Therapy Purity Methods by Capillary Gel Electrophoresis
 
Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...
Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...
Epidemiologial study of bovine brucellosis in three selected agro-ecologies o...
 
Principle, Procedure and applications of Digital PCR.pptx
Principle, Procedure  and applications of Digital PCR.pptxPrinciple, Procedure  and applications of Digital PCR.pptx
Principle, Procedure and applications of Digital PCR.pptx
 
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche ...
 

Effect of scd gene on milk production

  • 1. University of Debrecen Centre for Agricultural and Applied Economics Science Faculty of Agricultural and Food Sciences and Environmental Management Effect of Stearoyl-COA desaturase gene polymorphism on milk production traits of Hungarian Holstein Friesian cows By :  Tegegn Gudeta, Jaleta (MSc thesis) Debrecen , Hungary, May 2012
  • 2. Introduction Marker Assisted selection in modern dairy Number of studies conducted in large scale on candidate genes in dairy breeding SCD is hypothesiszed candidate gene  It catalyze Cis∆-9 desaturation  Mapped to chromosome 26 in bovine  SCD 1 and SCD5  Associated with milk fatty acid composition Studies of SCD gene not conducted in HHF
  • 3. Objectives of the study To estimating allele and genotype frequencies of SCD gene polymorphism(878 C/T) To determining the effect of SCD gene polymorphism on cows milk production traits
  • 4. Materials and Methods 1) Animals and Milk data  Hair root samples (8-10) were collected from 277 HHF in Tedej Dairy Farm located 15 km north of Debrecen  One lactation milk record data were collected for 277 HHF cows-305 day average milk yield (kg), fat yield (kg), fat percentage(%), protein yield (kg), protein percentage (%) and SCC (10,000 cell/ml)
  • 5. 2) Study Methods  Molecular Laboratory of UD  DNA isolation from Hair root  3-5 hair root+ 100 µL Lysis buffer+1.5 ProteinK  Water bath for 60 min at 60 0c , for 20 min at 95 oc water bath, stored at -20 oc  Spectrophotometrical Analysis-Nanodrop Spectrophotometer RT-PCR 7300
  • 6. 3) DNA Amplification and Sequencing  7300 RT-PCR machine (Applied Biosystem)  Reaction mix(10µL): 1µl DNA, 5µl 1xTaqMan MasterMix (PN 4371355, USA), 0.25µl 1xSNP probe and 3.75µl dH2O.  TaqMan probe sequence: The fluorescent probe VIC: ACTTACCCACAGCTCC The fluorescent probe FAM: TTACCCGCAGCTCC  SCD Primers (625µl 40x mix, Warington, UK, WA37PB): Forward Primer: CCCCGAGAGAATATTCTGGTTTCC Reverse primer : CCACTAGACGTGGTCTTGCT
  • 7.  Amplification and Sequencing protocol  Initial steps: Activation at 950C for 10 minutes (AmpliTaq Gold DNA polymerase), Melting for 15 sec at 920C, Annealing/Extension at 600C for 1 minute (40 cycles).  The SNP 878 C/T was used in this study and the nucleotide substitution was identified according to Tanguichi et al., (2004).
  • 8. 4.) Data Analysis a)Descriptive Statistics using R software (Version: R- 2.14.2) b)Hardy-Weinberg Equation c) Analysis of Variance (ANOVA) using R software (Version: R-2.14.2)
  • 9. Results and Discussion 1. Genotypes and Allele Frequencies of SCD gene Polymorphisms  Amplification curve for CC(left) and CT(right) genotypes
  • 10. Result of amplification curve for TT genotype (Green line)
  • 11. Allelic discrimination of SCD genotypes (Blue-CC, Green-CT, and Red-TT)
  • 12. Genotype and allele frequencyy of the SCD gene in the investigated Hungarian Holsteins cow population No of Animals (Genotype SCD P value X2 Frequencies in %) Allele % CC CT TT 0.04695 3.947 Observed 94(34) 148(53) 35(13) C(0.61) Expected 102(37) 132(48) 43(15) T(0.39)
  • 13. 2. Effects of SCD Genotypes on Recorded Milk Production Traits Parameter Genotype CC CT TT P value Fat (%) 3.76±0.41 3.8±0.43 3.7±0.38 0.2272 Protein (%) 3.22±0.178 3.22±0.178 3.23±0.14 0.998 SCC(X103 cell/ml) 136±106.4 116±70.2 119±72.7 0.2264 305 MY (kg) 8277.5±1301 8468.5±1542 8463.4±1294 0.5805 305 FY (kg) 310.6±52.4 321.9±55.2 313±50.6 0.2505 305 PY (kg) 266.1±38.5 272.1±45.8 272.3±36.2 0.5315 Mean and standard deviation of milk production traits and its association with SCD genotypes.
  • 14. Conclussions  Higher C allele(0.61) frequency and lower T allele (0.39) frequency was reported in this study  The SCD genotypes frequency in HHF herds under this study were not in Hardy-Weinberg equilibrium, the possible reason for this result may be small numbers of animals included in this study and indicating the herds were not in a random mating system  SCD-878 C/T locus cannot be considered as candidate gene in milk production traits  Further studies will be necessary on large number of animals to confirm the current result