appliedscience_MaasBP_vj14_280441

Investigating the function and expression
profile of Snail2 in vascular development
and maturation
Benjamin Maas 21/02/2015
Applied Science AS3 VKL VWO

Investigating the function and
expression profile of Snail2 in vascular
development and maturation
Forming a loss of function through creation of a CRISPR mutant zebrafish
Benjamin Maas, Anne Lagendijk, Sungmin Baek, Ben Hogan
University of Queensland, Institute for molecular Bioscience, Genomics of
Development and Disease Division, Australia, Brisbane St. Lucia, QLD 4072
08/09/2014 – 02/03/2015
i

Summary
The development of the vascular system plays an important role in the body starting
during embryogenesis and continuing on through life. The development of the
vascular system relies on a complex network of signalling pathways combined with
the fine-tuned activity of transcriptional factors. The precise function and expression
profile of many transcription factors remain largely unknown. In this research the
function and expression profile of the transcription factor snail2 during vascular
development are investigated. A loss-of-function model of the Danio Rerio
(zebrafish) is developed using the CRISPR/Cas9 genome-editing tool.
Three different single guide RNAs (sgRNAs) were designed for the
CRISPR/Cas9 technology. sgRNA1, sgRNA2, and sgRNA3 were designed,
synthesized and co-injected with the Cas9 endonuclease in three separate batches,
creating the F0 generation of three families. Co-injection of these two components
into the single-cell stage of zebrafish resulted in site-specific cleavage by Cas9, and
non-homologous end joining (NHEJ) DNA repair, leading to mutations. The
efficiency of cleavage by the sgRNA guided Cas9 on the target sites were tested on all
three batches by a high resolution melting assay (HRMA).
Transgenic (Tg) lines of zebrafish, in which cells specific to the blood
vasculature were tagged with a fluorescent marker, were used to display the vascular
development during embryogenesis. These Tg zebrafish lines were created using a
technique called bacterial artificial chromosome (BAC) recombineering. The
transgenic lines were used for the injections.
The injected embryos from the notch:GFP Tg line (F0) were grown to
adulthood were tested and outcrossed with wild type zebrafish to investigate the
germline transmission. Genotyping showed a frameshift caused by a 7 bp deletion
which led to a premature stopcodon early in the second exon of the snai2 gene. The
premature stopcodon resulted in the loss of the Zinc-finger DNA binding domain of
Snail2. Genotyping of embryos of the outcrosses showed that different mutations can
occur in embryos of one outcross between a CRISPR mutant and a wild type
zebrafish. This leads to the implication that a mutation created in the single-cell stage
of an embryo does not mean that the complete germline carries the same mutation,
implying that DNA cleavage and repair do not occur in the same single-cell stage of
the embryo, leading to different mutations in different cells.
Cleavage by both sgRNA1 and sgRNA2 have been demonstrated by an
agarose gel analysis, impliying the loss of a large DNA fragment. This would mean
that large DNA fragments could be deleted when different CRISPR complexes cleave
at the same time.
In conclusion this research shows that a premature stopcodon can be
introduced early in the second exon of the snai2 gene, before the DNA binding
domain encoding sequence. This gives rise to the conclusion that the loss of function
of snai2 can be induced by the generation of a CRISPR mutant. Also is proven that a
stabile transgenic line can be constructed for the targeting of a specific gene using
BAC recombineering.
ii

Samenvatting
De ontwikkeling van het vaatstelsel speelt een belangrijke rol in het lichaam tijdens
embryogenese en gedurende het leven. De ontwikkeling van het vaatstelsel is
gebaseerd op een ingewikkeld netwerk van signaling pathways in combinatie met een
nauwkeurig afgestelde activiteit van transcriptie factoren. De exacte functie en het
expressie patroon voor vele transcriptie factoren zijn nog steeds grotendeels
onbekend. In dit onderzoek worden het expressie patroon en de functie van Snail2
onderzocht. Een loss-of-function model gebaseerd op Snail2 van de Danio Rerio
(zebravis) is ontwikkeld aan de hand van de CRISPR/Cas9 genome-editing tool.
Drie verschillende single guide RNAs (sgRNAs) werden ontworpen voor de
CRISPR/Cas9 technologie. sgRNA1, sgRNA2, en sgRNA3 werden ontworpen,
gemaakt en geïnjecteerd met Cas9 endonuclease in drie verschillende injectieronden,
hiermee werd de F0 generatie van drie verschillende families opgegroeid. Co-injectie
van deze twee componenten in het eencellig stadium van de zebravis resulteerde in
een sequentie-specifieke dubbelstrengs breuk, en non-homologous end joining
(NHEJ) DNA reparatie, wat leidde tot mutaties in het genomisch DNA. De efficiëntie
van het sequentie-specifieke knippen van de drie verschillende CRISPR complexen
werd getest aan de hand van een high resolution melting assay (HRMA).
Transgene (Tg) lijnen van zebravissen, waarin cellen die specifiek zijn voor
het bloedvatenstelsel werden gelabeld met een fluorescent marker, werden gebruikt
om de vasculaire ontwikkeling visueel te weergeven tijdens de embryogenese van een
zebravis. Deze Tg zebravis lijnen werden gecreëerd aan de hand van een techniek
genaamd bacterial artificial chromosome (BAC) recombineering. Deze transgene
lijnen werden gebruikt voor de injecties.
De geïnjecteerde embryo’s van de notch:GFP Tg lijn (F0) werden opgegroeid
en gekruist met wild type zebravissen om te achterhalen welke zebravissen de mutatie
droegen in hun geslachtscellen. Analyse van het genotype van embryo’s van deze
kruising (F1) lieten een 7 bp deletie zien die leidde tot een premature stopcodon vroeg
in het tweede exon van het snai2 gen. Dit premature stopcodon resulteerde in het
verlies van het Zinc-finger DNA bindings domein van Snail2. Analyse van het
genotype van mutanten laat zien dat het mogelijk is dat F1 generatie embryo’s, van
een kruising tussen een F0 geïnjecteerde CRISPR mutant en een wild type zebravis,
verschillende mutaties dragen. Dit leidt tot de implicatie dat een mutatie gecreëerd in
het eencellige stadium van een embryo niet betekend dat alle geslachtscellen dezelfde
mutatie zullen dragen. Dit zou kunnen betekenen dat het knippen van het DNA en de
reparatie ervan niet in hetzelfde eencellige stadium plaatsvinden, wat kan leiden tot
verschillende mutaties in verschillende cellen.
Aan de hand van een agarose gel analyse is gedemonstreerd dat het knippen
van zowel sgRNA1 en sgRNA2 kan leiden tot de deletie van het DNA fragment
tussen de twee dubbelstrengs breuken gecreëerd door de CRISPR complexen. Dit
betekend dat grote DNA fragmenten uit genomisch DNA kunnen worden geknipt aan
de hand van verschillende sequentie-specifieke CRISPR complexen.
In conclusie laat dit onderzoek zien dat er een premature stopcodon kan
worden geïntroduceerd vroeg in het tweede exon van het snai2 gen, voor de
coderende sequentie voor het DNA bindings domein van Snail2. Op basis hiervan
wordt geconcludeerd dat er een loss-of-function van snai2 kan worden geïnduceerd
aan de hand van de generatie van een CRISPR mutant. Ook is er bewezen dat er een
stabiele transgene lijn voor een specifiek gen kan worden ontwikkeld aan de hand van
BAC recombineering.
iii

Acknowledgements
First of all I would like to thank Ben Hogan for giving me the opportunity to work in
his lab and working on a very interesting project. I would also like to thank Anne
Lagendijk, my supervisor during my period at the IMB, for the great supervision on
my project. Giving me responsibility and at the same time helping me in the right
direction gave me the chance to work on many competences and improve on several
skills. I would like to thank Sungmin Baek for helping me with the synthesis of poper
single-guide RNAs for my injections, and Scott Patterson for his help on BAC
recombineering. Finally I would like to thank all the people that contributed to a
pleasant, and fun working environment, that made my stay at the IMB an
unforgettable experience.
iv

Table of Contents
Summary..............................................................................................................................................ii
Samenvatting ....................................................................................................................................iii
Acknowledgements ........................................................................................................................iv
1. Introduction............................................................................................................................... 1
1.1 General introduction.............................................................................................................................. 1
1.2 Plan................................................................................................................................................................. 2
1.3 Theoretical background ....................................................................................................................... 3
1.3.1 Genome editing........................................................................................................................ 3
1.3.2 The role of the Snail2 protein............................................................................................4
1.3.3 Angiogenesis.............................................................................................................................7
1.3.4 Perivascular cells....................................................................................................................8
2 Materials and Methods............................................................................................................ 9
2.1 Transgenic lines by BAC recombineering..................................................................................... 9
2.1.1 Use of transgenic lines ..............................................................................................................9
2.1.2 Plasmids and Strains............................................................................................................... 10
2.1.3 Clone conformation................................................................................................................. 11
2.1.4 pRedET transformation......................................................................................................... 11
2.1.5 iTol2 insert.................................................................................................................................. 12
2.1.6 second targeting insert.......................................................................................................... 12
2.2 CRISPR/Cas9 technology....................................................................................................................13
2.2.1 Approach................................................................................................................................. 13
2.2.2 Target site selection............................................................................................................ 14
2.2.3 sgRNA generation and transcription........................................................................... 15
2.2.4 Tg Zebrafisch lines and microinjection....................................................................... 16
2.2.5 Control efficiency CRISPR complexes.......................................................................... 16
2.2.6 Identification founder fish ............................................................................................... 18
2.2.7 Generation F1 family........................................................................................................... 19
3 Results.............................................................................................................................................20
3.1 BAC recombineering .................................................................................................................................20
3.1.1 Insert confirmation ................................................................................................................. 20
3.2 CRISPR/Cas9 technology........................................................................................................................20
3.2.1 syntheses sgRNA1, 2 and 3 .................................................................................................. 20
3.2.2 Efficiency assays....................................................................................................................... 22
3.2.3 Identification founder fish.................................................................................................... 25
4 Discussion..................................................................................................................................33
4.1 BAC recombineering.............................................................................................................................33
4.2 CRISPR mutants......................................................................................................................................33
5 Conclusions ...............................................................................................................................34
6 Recommendations..................................................................................................................34
7 Self reflection............................................................................................................................35
8 References.................................................................................................................................36
Attachement I: Transgenesis by BAC selection......................................................................A
Attachement II: CRISPR/Cas9 technology ................................................................................ I
Attachement III: High Resolution Melting Assay................................................................... L
v

1. Introduction
1.1 General introduction
The investigation of how blood and lymphatic vessels form from pre-existing vessels,
called angiogenesis, describes the research being done at the Department of Genomics
of Development and Disease within the Institute for Molecular Bioscience (IMB).
Development of the lymphatic and vascular system during embryonic development is
very important for proper functioning of the human body. An enclosed circulatory
system of blood vessels is formed as the vascular system develops. This way blood
can bring oxygen and to the individual organs while waste products as CO2 and
catabolites can be drained. Alongside the blood vasculature, lymphatic vessels are
formed in which lymph transports fluids and immune competent cells that have left
the blood vessels. Unlike the vascular system, the lymphatic system transports lymph
only in one direction, towards the heart. Both vascular systems comprise of
endothelial cells, which form the interior.
Snail2, a protein encoded by the snai2 gene, is expressed in cells associated to
the endothelial cells, potentially perivascular cells (Hogan lab, unpublished data).
Perivascular cells will be explained in section 1.3.4. To investigate the function of
Snail2, a knockout of the snai2 gene will be created resulting in the Snail2 protein not
being expressed. This way a clear biological model of the loss of function of Snail2
will be created to investigate the role of Snail2 during angiogenesis.
The zebrafish (Danio Rerio) model system offers a unique combination of
imaging techniques, embryonic and genetic tools to study developmental processes
and will therefore be used in this study.
A knockout of the snai2 gene will be generated using the CRISPR/Cas9
technology. CRISPR stands for Clustered Regulated Interspaced Short Palindromic
Repeat and Cas9 is an endonuclease. The general aim of this project is to create a loss
of function allele of the snai2 gene. By using the CRISPR/Cas9 genome editing tool
the aim is to ‘switch off’ the gene of interest by causing a frame shift in the coding
sequence for Snail2, preferably resulting in a premature stop codon. A snai2 knockout
model will be generated which will allow us to study the vascular development in the
absence of functional Snail2 protein.
1

1.2 Plan
Using the CRISPR/Cas9 technology, the design and syntheses of a specific single
stranded guide RNA (sgRNA) is required. This sgRNA will, in combination with the
Cas9 endonuclease enzyme, cause double stranded breaks in the genomic region of
interest. To increase the efficiency of the CRISPR/Cas9 technology 3 different gene
specific sgRNAs, targeted to the same gene of interest, will be designed and
synthesized increasing chances of causing a frameshift within the snai2 gene. The
CRISPR/Cas9 technique will be further explained in attachement II.
To validate the occurrence of InDel mutations (explained in attachement III) a
High Resolution Melting Assay (HRMA) will be performed. This biological assay is
used to confirm that there is an InDel mutation generated in the snai2 gene. The InDel
variants prove that the designed single-guide RNAs attach to the targeted sequence in
the snai2 gene and efficient cleavage by Cas9 takes place at that site. The procedure
of this assay will be explained in attachement III.
Once the CRISPR/Cas9 technique is validated, a large number of zebrafish
embryos will be injected with the mixture of Cas9 protein and sgRNAs and a
minimum of 100 embryos will be raised to adulthood.
When the embryos are grown until adulthood, which takes up to two to three
months, the fish will be screened for germline transmission of snai2 mutations. These
fish are referred to as mutant founders. This identification will be done by crossing
the adult zebrafish of the injected embryos with wild type zebrafish. The mutation can
only be inherited by the offspring if the mutation of a specific injected embryo was
transmitted to the germ cells (germline transmission). To determine if the offspring
carries snai2 mutations in its genome, another HRMA will be performed. Using this
method the offspring can be characterised as positive (when having a mutation), or
negative (when having the same sequence as the wild type zebrafish). The genomic
DNA of positive embryos will be sequenced to determine the exact mutation. Positive
tested zebrafish with the same mutation will be incrossed to create an F1 generation
with a homozygous mutation. Those embryos will be used to display the vascular
development using confocal microscopy.
During the time the injected zebrafish are being raised, the perivascular cells
(explained in section 1.3.4.) in which Snail2 is expected to be expressed, will be
further investigated. For this study, a technique called Bacterial Artificial
Chromosome (BAC) recombineering, is used to image the different populations of
these perivascular cells. BAC recombineering is used to create different kinds of
transgenic zebrafish lines of the Danio Rerio that enable us to mark certain proteins,
that are expressed in specific cells, with a fluorescent tag that can be visualised using
confocal microscopy. The technique of BAC recombineering will be further explained
in attachement I. Tagging certain proteins that are specific to a cell gives us the
opportunity to image and study specific cell populations. Because Snail2 is a protein
that is expected to be involved in pathways that regulate migration of perivascular
cells, the imaging of these cells with and without a successful knockout of snai2 gives
us knowledge about the role of Snail2 in this migration process.
2

1.3 Theoretical background
1.3.1 Genome editing
Genome editing, a type of genetic engineering, is a cluster of techniques in which the
genomic DNA of an organism is modified by inserting, replacing or removing DNA
fragments. Genome editing technology is mostly practiced in genetic analysis, by
creating biological models for the understanding of a gene or the function of a protein.
There are several genome editing methods in which genomic DNA can be
modified. These techniques have been developed to create targeted mutations in the
genomic DNA of an organism. This means creating a modification in a genomic
sequence of interest. To create these target specific mutations, the double stranded
DNA of that gene has to be cleaved first, generating a double stranded break (DSB).
DSBs can be caused by several nucleases, depending on which genome editing
technique is being used.
Once a DSB is introduced in the genomic DNA by a specific nuclease, there
are two different ways in which the DNA can be repaired. One of these mechanisms
is called Homologous Recombination (HR), which is an accurate way of DNA repair
using the undamaged sister chromatid or homologous chromosome as a template [1]
.
Another way of repairing damaged DNA is Non-Homologous End Joining (NHEJ), a
mechanism for which no template is needed. NHEJ is a repairing pathway where a
frameshift is most likely tooccur. The frameshift, possibly generating a premature
stop codon, can cause a gene knockout. Therefore the NHEJ repairing pathway is
used in this project, knocking out the snai2 gene. The process of NHEJ will be further
explained in attachement II.
Combining HR along with a genome editing tool within a specific gene allows
the introduction of a wide range of mutations. By supplying specific designed
engineered homologous repair templates instead of using the undamaged sister
chromatid, new and different DNA fragments, can be inserted into the genomic DNA
of an organism in a specific gene of interest [2]
. These insertions are called knock-ins
and will create a change in the gene, causing a mutation or an insertion of sequences
encoding fluorescent tags (explained in attachement II).
The main three methods used in genome editing all share that they are using
programmable site-specific nucleases [3]
. This means that nucleases are used to cleave
at an exact pre-determined position in the genomic DNA of an organism. Zinc-finger
Nucleases (ZNFs), Transcription Activator-Like Effector Nucleases (TALENs) and
Clustered Regulatory Interspaced Short Palindromic Repeat (CRISPR) are currently
the three most used methods to introduce DSBs at pre-determined locations in the
genomic DNA.
All three of these cleavage methods can show errors. These errors occur when
the programmed site-specific nucleases bind to the wrong target site in the genomic
DNA, resulting in off target cleavage. These sites where the nucleases bind and cleave
are called off-target-cleavage sites. Because off-target-cleavage sites decrease the
specificity of gene engineering, they should be prevented where possible.
Which method should be used in combination with specific genomic DNA, to
achieve the most efficient site-specific cleavage, is in many cases yet to be
determined. Thus far studies in zebrafish have shown that using the CRISPR/Cas9
system, site-specific cleavage can be achieved efficiently [4]
. The process of the
CRISPR/Cas9 system will be explained in attachement II.
3

1.3.2 The role of the Snail2 protein
Snail2 is a transcriptional repressor encoded by the snai2 gene in the zebrafish, or
Danio Rerio. The gene is located in chromosome 24 and has a size of 6017 basepairs
and consists of 3 exons and 2 introns [5]
.
The role of the Snail2 protein in vascular development is largely unknown. To
understand the function of Snail transcription factors, epithelial to mesenchymal
transition (EMT) and endothelial to mesenchymal transition (EndMT) must be
introduced, as Snail transcription factors are known to activate these processes [6]
.
Endothelial cells are the cells that form the endothelium as a single cell layer.
This is the inner cellular layer of blood vessels, and therefore in direct contact with
blood.
Epithelial cells, forming the epithelium, line the covering of internal and external
body surfaces. Epithelial cells form the epithelium by one or more layers. Both
epithelium and endothelium are based on a basement membrane (BM) [7]
. This BM, a
composite of several large glycoproteins, supports the epithelium and the
endothelium. An important property of endothelial cells in vascular development is
being able to migrate directed in response to a variety of growth factors. Cell-cell
adhesion and cell polarity are important properties for migration as they are involved
in allowing endothelial cells to leave the tissue [8]
. Endothelial cells within the
endothelium have strong intercellular interactions generated by cellular adhesion
protein complexes such as integrins and Vascular Endothelial cadherin (VE-cadherin)
(Fig. 1). VE-cadherin is also a protein involved in the regulation of the polarity of the
endothelial cells. The cell polarity of individual cells is important as they contribute to
the shape of the cell and cell-cell adhesion. The polarity of the cell strongly
collaborates with the function of the cell.
Figure 1 inter cellular adhesion complexes [8]
.
Mesenchymal cells are progenitor cells that, by a complex pathway of gene
activation, have the ability to differentiate into multiple celltypes. The processes EMT
and EndMT are based on the capacity of epithelial and endothelial cells to switch
phenotypes to mesenchymal cells [9]
. This phenotype switch gives the tissue the
ability to remodel. A complex network of gene activation and repression regulates the
4

initiation, execution and maintenance of EMT and EndMT. To switch from an
epithelial or endothelial phenotype to a mesenchymal phenotype, the cell has to
change in some aspects. Gross changes in polarity, morphology, functionality and
cell-cell interactions are the essential steps for the cells to undergo the phenotype
switch. This phenotype switch is called the transition. During this transition,
endothelial and epithelial cells lose their cell adhesion with other cells within the
tissue. Therefore important intercellular adhesion protein complexes, such as E-
cadherin and integrins, must be degraded. Downregulation of the genes encoding for
these adhesion complexes prevents new expression. Because epithelial and
endothelial cells are arranged on a BM, consisting of a thin sheet of fibres, this must
also be degraded by the transitioning cells before being able to separate from the
tissue. This degradation is caused by the production and secretion of
metalloproteinase by the transitioning cells. Because during this process, the cells also
progressively lose their polarity, they can successfully be separated from the tissue.
To complete the transition, the cells have to activate the expression of additional
mesenchymal genes and proteins, such as vimentin. (Fig. 2). Vimentin is a protein
inducing change in cell shape, motility and polarity [10]
.
Figure 2 schematic overview of the molecular and cellular changes that occur during EMT [9]
. BM indicates
basement membrane; MMPs, matrix metalloproteinases; EMT, epithelial to mesenchymal transition;
αSMA, DDR2 and FSP1 are mesenchymal proteins being expressed in the final state of transition.
During EMT, epithelial cells gain mesenchymal properties and loose contact
with neighbouring cells, enabling them to break through the basement membrane that
separates the different kinds of tissue. One of the hallmarks of EMT is the functional
loss of E-cadhering, a protein encoded by the Cadherin1 gene (CDH1 gene). E-
cadherin is one of the proteins that is strongly involved in cell adhesion between
epithelial cells. Snail2 is known to be a predominant inducer of EMT and thereby
strongly represses the expression of E-cadherin. Expression of Snail2 positively
correlated with tumour grade.
5

There are three Snail proteins that have been identified so far: Snail1 (Snail),
Snail2 (Slug) and Snail3 (Smuc). All the family members encode transcriptional
repressors. They all share a similar organisation with a highly conserved C-terminal
domain, containing four to six zinc finger domains, which are responsible for binding
the DNA when repressing the transcription of E-cadherin. The SNAG (Snail/Gfi)
domain, located at the N-terminal of the protein, is able to bind several co-repressor
complexes. The central region of the protein contains a Serine-Rich Domain (SRD),
important in the regulation of the stability of the protein. The Nuclear Export Box
(NEB) is responsible for the subcellular localization of Snail (Fig. 3).
Figure 3 structure of the Snail protein. The C-terminal contains zinc finger domains, responsible for
binding to the DNA. the N-terminal contains the SNAG domain, which interacts with several co-repressors
and epigenetic remodelling complexes [12]
.
The zinc finger domains of the Snail protein binds to a specific region on the
DNA called the E-box motif. This motif consists of the sequence: 5’ – CANNTG – 3’.
The ‘N’ in the sequence can be any base. This sequence lies within the promoter
region of the CDH1 gene. The binding site of Snail is identical to the binding site of
basic Helix-Loop-Helix (bHLH) transcription factors [13]
. This indicates that Snail
proteins might compete with the bHLH transcription factors involved in the regulation
of the CDH1 gene.
EndMT is a specialised form of EMT. During EndMT, endothelial cells
separate from an organised cell layer and invade the underlying tissue [10]
. The stages
in which this transition is made are comparable to the stages of EMT. They differ in
the up- and downregulation of different genes, to loose contact with neighbouring
cells and leaving their tissue. Like EMT, EndMT allows endothelial cells to
delaminate from an organised cell layer and transition to a mesenchymal phenotype
by loss of cell-cell junctions, loss of endothelial markers, gain of mesenchymal
markers and acquisition of invasive and migratory properties. Therefore EndMT is
suggested to have an important role in tissue remodelling like angiogenesis [11]
.
Angiogenesis will be explained in section 1.3.3. Snail has also proven to be a
regulator of the induction of EndMT, as Snail transcription factors during EndMT
also serve as repressors of the expression of important junction complexes like
Vascular Endothelial cadherin (VE-cadherin) between endothelial cells.
6

The suggestion of EndMT being involved in angiogenesis, with Snail being an
important regulatory protein of that process, raises the question whether Snail is
expressed in endothelial cells or in cells located near endothelial cells. The question
also includes the exact role of Snail in inducing EndMT.
1.3.3 Angiogenesis
Angiogenesis is the growth of blood vessels forming from existing vasculature. It is a
process that occurs in life in both health and in disease that begins during embryonic
development and continues on through life [15]
. Blood capillaries are needed in every
tissue for the exchange of nutrients and metabolites. Angiogenesis is a process that
reacts to changes in metabolic activity. Exercise for example stimulates angiogenesis
in skeletal muscle and heart, as a lack of exercise can lead to capillary regression.
Angiogenesis is a process that can be split into two types. Sprouting
angiogenesis is the type in which Vascular Endothelial Growth Factor A (VEGF-A)
coordinates the vascular growth in a hypoxic environment. A hypoxic environment is
an environment where there is a lack of oxygen. When functional cells in a tissue,
called parenchymal cells, suffer from a deficiency of oxygen they respond by
secreting VEGF-A. Under the influence of VEGF-A, leading cells at the tips of
vascular sprouts, guide a developing capillary sprout through the extra cellular matrix
(ECM). These leading cells are called tip cells. Tip cells can digest a pathway through
the ECM by secretion of proteolytic enzymes called Matrix Metalloproteinases
(MMPs). Long, thin cellular projections on the tip cells, called filopodia, secrete these
MMPs (Fig. 4). Filopodia are heavily enriched with VEGFR2, which is a receptor for
VEGF-A. This allows the tip cells to sense differences in the VEGF-A concentration.
High concentrations of VEGF-A secreted by parenchymal cells indicate a hypoxic
environment, which stimulates tip cells to guide the developing capillary sprout to the
area with the oxygen deficiency in a certain tissue.
Figure 4 tip cell leading to a hypoxic environment by detection of VEGF-A [16]
. The MMPs are secreted by
the sprout tips to digest the pathway through the ECM.
Intussusceptive angiogenesis, or splitting angiogenesis, the second type of
angiogenesis, is a process where an existing blood vessel splits in two, creating a new
blood vessel. Because this type of angiogenesis only requires the reorganization of
existing endothelial cells and it does not rely on immediate endothelial proliferation
or differentiation, splitting angiogenesis is considered to be faster and more efficient
than sprouting angiogenesis. This type of angiogenesis plays an important role in the
7

vascular development of embryos where growth is fast and resources are limited.
Compared to sprouting angiogenesis, the control of splitting angiogenesis is poorly
understood. However, it is known that splitting angiogenesis can also be stimulated
by VEGF-A.
1.3.4 Perivascular cells
Vascular walls are composed of two different cell types, endothelial cells and mural
cells. Mural cells can again be referred to as two different cell types. Vascular smooth
muscle cells are mural cells when associated with large arteries and veins [17]
.
However when they are associated with capillaries, mural cells are referred to as
pericytes. Pericytes are located in the BM. During development, pericytes expand in
number and migrate to cover endothelial tubes (Fig. 5). A lot of the signalling
pathways in which the migration of pericytes are mediated remain unknown. A
signalling pathway known to be implicated in pericyte development and maintenance
is the Notch3 signalling pathway. Notch3 is a receptor protein located on the
membrane of pericytes and vascular smooth muscle cells. When specific molecules
attach to the Notch receptor on the membrane of one of the mural cells, the receptors
send signals to the nuclei of these cells. The signals cause the cells to activate
particular genes. This property of mural cells can lead to EMT or EndMT properties.
Studies suggest that the Notch pathway is also used for the up-regulation of Snail
transcriptional factors, and therefore plays an important role in EMT [18]
. This
suggestion brings us back to the question in which cells Snail2 is expressed.
Figure 5 pericyte covering endothelial tube [19]
.
8

2 Materials and Methods
2.1 Transgenic lines by BAC recombineering
2.1.1 Use of transgenic lines
The sgRNAs forming the CRISPR complexes 1,2 and 3 will be injected in different
transgenic zebrafish lines. The aim of using different transgenic lines (Tg) is to
investigate the function of Snail2 as well as where it is expressed (explained in
attachement I: BAC recombineering). To investigate the location of Snail2 expression
an already present BAC plasmid was used. The transgenic line created with this BAC,
called Tg BAC snail2T2A:GFP, overexpressed Snail2 and expressed GFP in a tissue-
specific manner. Overexpression of Snail2 is caused by the complete Snail2 encoding
sequence in the BAC construct. T2A is a peptide that links the GFP reporter gene to
the native open reading frame (ORF) of Snail2. Once both proteins are expressed T2A
self-cleaves thereby disconnecting the proteins from each other. Without the self-
cleaving property of the T2A peptide, GFP would be directly connected to Snail2 and
possibly inhibiting it’s function as a transcription factor. The Snail2 and GFP being
expressed at the same moment at the same place gives information about the location
of expression of Snail2. Though conclusions about whether Snail2 migrates after
disconnecting from GFP cannot be made, as this cannot be imaged using the Tg BAC
snail2T2A:GFP.
As discussed in section 1.3.4, Snail2 might be upregulated by the Notch3
signalling pathway. An already present transgenic line carrying the notch:GFP
transgene is used to get information about tissue that is involved in this Notch3
signalling pathway. In this transgenic line a specific upstream activating sequence is
used that is stimulated by the signals caused by Notch3 signalling. This construct
causes expression of GFP in tissue involved in the Notch3 signalling pathway. A
hypothesis is that Snail2 might be upregulated by the Notch3 signalling pathway. It
might also be possible that expression of Snail2 forms a sort of positive feedback for
Notch signalling. This can be investigated by comparing CRISPR mutant- of this
transgenic line, with wild type embryos of the same transgenic line.
9

To investigate the role of Snail2 in EMT or EndMT processes, two other
transgenic lines are used. The Tg BAC acta2:YFP carries the DNA in its genome that
is constructed to contain the ACTA2 promoter region controlling expression of the
Yellow Fluorescent Protein (YFP) reporter gene. This means that YFP will be
expressed in the specific tissue. ACTA2 stands for Smooth Muscle α-Actin, which is
a protein, expressed in perivascular cells. Because a hypothesis is that Snail2 plays a
role in the signalling pathway in which pericytes migrate during vascular
development, the knockout of Snail2 may influence this process as explained in
section 1.3.4. Imaging the YFP protein in time displays the location of pericytes
during vascular development. Comparing CRISPR mutants of the Tg BAC acta2:YFP
with uninjected embryos of the same transgenic line, displays the difference in
phenotypes. The Tg acta2:YFP was already present. The other transgenic line, Tg
BAC pdgf-β:TagRFP-T, was created to also tag perivascular cells. pdgf-β stands for
Platelet Derived Growth Factor– β and is also specifically expressed in perivascular
cells. TagRFP-T is a red fluorescent protein that is expressed under the control of the
PDGF-β promoter in the PDGF-β TagRFP-T transgenic line. Because the expression
of ACTA2 and PDGF-β in perivascular cells might differ in expression in time and
conditions in the vascular developmen, the influence of Snail2 on perivascular cells
can be investigated using two different angles.
2.1.2 Plasmids and Strains
For the construction of the Tg BAC pdgf-β:TagRFP-T BAC, a BAC containing the
PDGF gene had to be ordered. This was the CH73-289D6 BAC (BACPAC). As
explained in draft I the construction require several plasmids. The pRedET plasmids
(GeneBridges) and the plasmids containing the targeting templates were ordered.
When bacteria contain the pRedET plasmid, they can only be incubated at 30°C
overnight because the pRedET plasmids contain the SC101 temperature sensitive
origins. Incubating them at higher temperatures will kill the pRedET plasmid. The
plasmids used to generate the targeting templates were a kind gift from collaborators.
The primers used to create the templates for the first targeting step,
iTol2_Amp(R), contained a complementary sequence for the amplification of the
referred region, but also contained the 50 bp long homology arms that were needed
for the incorporation into the pdgf-β BAC plasmid.
iTol2_ Amp(R) forward primer:
gcgtaagcgggcacatttcattacctctttctccgcacccgacatagatCCCTGCTCGAGCCGGGCCCAAGTG
iTol2_Amp(R) reverse primer:
gcggggcatgactattggcgcgccggatcgatccttaattccgtctactaATTATGATCCTCTAGATCAGATC
The red sequences in the primers are the overhangs that will serve as homology arms
when inserted into the BAC backbone.
10

The primers used for the second targeting step, TagRFP-T_Kan(R), contained
different homology arms as this, the reporter cassette, was to be inserted at a different
location then the iTol2_Amp(R) insert.
TagRFP-T_Kan(R) forward primer:
Upstream 50 bp homology arm – ACCATGGTGAGCAAGGGCGAGGAG
TagRFP-T_Kan(R) reverse primer:
Downstream 50 bp homology arm - TCAGAAGAACTCGTCAAGAAGGCG
2.1.3 Clone conformation
Pdgf-β BAC cultures were streaked out on plates of LB with Chloramphenicol (Cm)
[11.3 μg/ml]. The plates were grown overnight at 37°C. the next day grown colonies
were taking up and resuspended in 50 μl MQ. A colony PCR was performed. Every
reaction contained 4 μl 5x HF Buffer (New England Biolabs), 0.4 μl dNTPs [10 mM],
1 μl forward and reverse primer mix [10 μM], 0.2 μl phusion Taq [2 U/μl] (Thermo
scientific), 13.4 μl mQ and 1 μl of the resuspended colony. The remaining mQ/colony
mixture containing the pdgf-β BAC plasmid checked by the colony PCR was
inoculated in 1 ml of LB-Cm, and grown overnight (O/N) at 37°C. 500 μl of the O/N
culture is used to make a glycerol stock. This stock is stored at -80°C, and is used to
grow new cultures of the pdgf-β O/N at 37°C. The stock is prepared by adding 500 μl
of 30% glycerol to 500 μl of the O/N grown culture. The glycerol stock is stored at -
80°C.
Pdgf-β control primerset:
• Forward control primer: GTTTCCTTTGGCTTTGAGGCGA
• Reverse control primer: AGCACAGAGCAGAAATCAGGAC
2.1.4 pRedET transformation
A pipette tip was used to scratch some culture of the -80°C glycerol stock of the pdgf-
β. This was added to 1 ml LB-Cm and grown overnight (O/N) at 3°C. 40 μl of this
O/N culture was transferred to 2 ml fresh LB-Cm and incubated at 37°C for 2.5 hours.
After the incubation the grown culture was transferred to a 2 ml tube. In a cold room
(4°C) the culture was centrifuged at 5000 g for 1 minute. The supernatant was
discarded and the pellet is resuspended in 1 ml of ice-cold mQ water. The culture is
centrifuged at 5000 g for 1 minute once more. The supernatant was also taking off
again, and the pellet was resuspended in 1 ml of ice-cold mQ water. For the last time
the culture was centrifuged at 5000 g for 1 minute and the supernatant was discarded
very careful. Approximately 50 μl were still to be left in the tube when the
supernatant was discarded. Next, 2 μl of pRedET plasmid (Gene Bridges) [10 ng/μl]
was added. The mixture of bacteria in 50 μl mQ water and 2 μl of pRedET plasmid
were transferred to a 1 mm electroporation cuvette (Biorad) and electroporated with
standard E. coli settings (1.35 kV, 10 μF and 600 Ω) (Biorad). The electroporation
rate should be around 5 milliseconds. Directly after electroporation 950 μl of fresh LB
was added. The mixture of LB with the electroporated culture was incubated for 3
hours at 30°C. after the incubation 100 μl was plated out on LB plates containing
Chloramphenicol [11.3 μg/ml] and Tetracyclin (Tet) [3.3 μg/ml]. Single colonies of
the plates were used for a colony PCR. The same protocol as the clone conformation
11

of the pdgf-β BAC culture was performed only this time it was performed on the
pdgf-β BAC and pRedET culture, so positive colonies were selected by using a
forward and reverse primer set for RedET. Again the remaining mQ/colony mixture
of a RedET positive colony was inoculated. Only this time it was inoculated in 1 ml
LB-Cm-Tet and incubated O/N at 30°C. Again 500 μl of the O/N culture was used to
make a glycerol stock.
pRedET control primerset:
pRedET Forward CTCTTGCGGGATATCGTC
pRedET Reverse GTGATGTCGGCGATATAGG
2.1.5 iTol2 insert
A pipette tip scratched with the pdgf-β BAC/RedET glycerol stock was added to 1 ml
of LB-C-Tet and grown O/N at 30°C. 40 μl of the O/N culture was inoculated in 2 ml
fresh LB-Cm-Tet and incubated at 30°C for 4 hours. 67 μl of L-arabinose [10%] was
added and the mixture was again incubated at 37°C for 1 hour. The culture was
transferred to a 2 ml tube. The same washing steps were performed as explained in
section 2.1.4. 2 μl of the prepared iTol2_Amp(R) PCR product was added to the
mixture. To insert the iTol2_amp(R) PCR template into the pdgf-β BAC plasmid, the
same electroporation protocol as explained in section 2.1.4 was used. After
electroporation the cultures were incubated for 1 hour at 37°C. After the incubation
the culture was centrifuged for 1 minute at 5000 G. The supernatant was discarded
accept for 100 μl. The pellet was resuspended in this 100 μl medium and plated on LB
plates containing Chloramphenicol [11.3 μg/ml] and Ampicilin [16.7 μg/ml]. These
were incubated overnight at 37°C. Again single colonies on the plate were picked
and checked on a colony PCR in the same way as explained in section 2.1.4, using a
forward and reverse primer set for iTol2_Amp(R). The remaining mQ/colony mixture
of a positive colony was inoculated in 1 ml LB-Cm-Amp and grown overnight at
37°C. Again 500 μl of the grown pdgf-β/iTol2 culture was used to make a glycerol
stock.
2.1.6 second targeting insert
The last step was performed with 1 ml of an O/N grown pdgf- β/RedET/iTol2 culture.
The culture was grown O/N in 1 ml of LB-Cm-Amp at 37°C. 40 μl of this O/N
culture grown stock was added to 2 ml fresh LB-Cm-Amp and incubated for 2.5 hours
at 37°C. The grown culture was transferred to a 2 ml tube, for the exhibition of the
washing steps. The washing steps were performed as explained in section 2.1.4 in the
cold room. 1 μl of the insert Tag-RFP-T_Kan(R) was added to the mixture for
electroporation. The electroporation was performed as explained in section 2.1.4. The
electroporated cultures were incubated at 37°C for 1 hour. For selection of the proper
BAC, the cultures were plated on LB plates containing Chloramphenicol [11.3
μg/ml], Ampicilin [16.7 μg/ml] and Kanamycin [16.7 μg/ml]. Plating of the cultures
was performed as described in section 2.1.5. The plates were incubated overnight at
37°C. For selection of the target BAC, a colony PCR was performed on the grown
single colonies on the LB-Cm-Amp-Kan plates using the forward primer of TagRFP-
T_Kan(R) and the reverse primer of pdgf-β. The protocol of the colony PCR was the
same as described in section 2.1.4. The remaining mQ/colony mixture of a positive
12

colony sample was inoculated in 1 ml LB-Cm-Amp-Kan medium and grown O/N at
37°C. And glycerol stocks were made as described in section 2.1.5.
2.2 CRISPR/Cas9 technology
2.2.1 Approach
Three different sgRNAs are designed to cleave the genomic DNA in the snai2 gene at
three different locations when co-injected with Cas9. The sgRNAs are referred to as
sgRNA1, sgRNA2 and sgRNA3. The aim of designing these three sgRNAs is to reach
a complete knockout of the snai2 gene. Because the knockout of the gene depends on
the introduction of a premature stop codon, different approaches are used. Because
Snail2 is a transcription factor, the DNA binding domain of the protein is important
for its function. Introducing a premature stop codon upstream of the coding region for
the DNA binding domain will therefore have a high probability of causing a non-
functional truncated protein. The DNA binding domain of Snail2 is encoded in the
second and third exon of the three exons of the gene.
ATGCCTCGTTCATTCCTAGTAAAGAAGCATTTCAATGCAGCTAAGAAACCGAATTAT
AGTGAACTGGAGAGTCCGACAGTGTTTATTTCTCCATATGTCTTAAAAGCCCTCCCG
GTGCCTGTTATACCTCAG.CCTGAAGTGTTAAGCCCGGTGGCGTACAATCCCATAAC
AGTATGGACTACCAGCAACCTGCCACTGTCGCCCCTT.CCCCACGACCTGTCCCCCA
TATCCGGATACCCCTCATCTCTCTCTGACACATCCTCTAATAAGGACCACAGCGGTT
CGGAGAGCCCCAGAAGTGACGAAGACGAGCGGATACAATCCACCAAGCTGTCGGACG
CTGAGAAGTTTCAGTGCGGTTTGTGTAACAAGTCCTACAGCACGTATTCGGGACTCA
TGAAGCACAAACAGCTGCACTGCGACGCACAGAGTCGGAAATCGTTCAGCTGCAAGT
ACTGCGAGAAGGAATACGTGAGTCTAGGAGCCCTAAAGATGCACATAAGGACACACA
CGCTGCCGTGCGTTTGTAAAATGTGTGGAAAAGCTTTCTCCAGGCCTTGGCTGCTGC
AGGGACACATTAGAACACACACGGGTGAGAAACCGTTTTCCTGCCCCCACTGCAGTC
GTGCATTCGCAGATCGATCGAACCTCCGAGCCCACCTGCAAACCCACTC.AGACGTG
AAGAAATACCAGTGCAAGAACTGCTCTAAAACATTCTCTCGCATGTCGCTGCTGCAC
AAACATGAGGAATCTGGCTGTTGCATCGCACACTGA
All three exons are displayed in the sequence above. The first exon is
displayed in yellow, the second in blue and the third in yellow again. The bold and
italic region in the second and third exon displays the coding region for the DNA
binding domain of the Snail2 protein. The purple regions display the selected target
sites for respectively sgRNA1, sgRNA2 and sgRNA3. The exact location and
sequence of these target sites will be further explained in section 2.2.1.2. The dots in
the purple sequences display the cleave sites of the CRISPR (sgRNA/Cas9)
complexes.
13

sgRNA1 and sgRNA2, were selected to target regions in the second exon,
upstream of the encoding sequence for the DNA binding domain of the protein.
Injecting embryos with one of the two sgRNAs hypothetically leads to InDels, aiming
to introduce a premature stop codon. This is one approach to knock out snai2.
Alternatively, injecting both sgRNA1 and sgRNA2 along with Cas9 in the same
embryo, could lead to a major loss of sequence in the DNA. When the Cas9
endonucleases of the CRISPR complexes 1 and 2 cleave at the same time, NHEJ will
not be able to prevent the DNA region between the cleave sites to be separated from
the genomic DNA. The NHEJ repair pathway will only help reconnecting the loose
ends of the DNA strand after cleavage. This would mean that the sequence between
the cleave sites is basically cleaved out of the genomic DNA. The introduction of the
InDel will again lead to the introduction of a premature stop codon upstream of the
encoding sequence for the DNA binding domain. SgRNA3 is targeted to a region
within the encoding sequence for the DNA binding domain, in the third exon. This
way a premature stop codon will be introduced somewhere within the encoding
region for the DNA binding domain, resulting in a non-functional domain. The
precise target site selection on which the approaches were based, are explained in
section 2.2.2.
2.2.2 Target site selection
Target sites in de snai2 gene were selected using the database of CHOPCHOP [20]
.
The three target sites in the snai2 gene were selected based on their uniqueness in the
genome of the Danio Rerio and their location in the exons. In selection of the target
sites in the genomic DNA, the Protospacer Adjacent Motif (PAM) sequence had to be
directly attached to the 20 base pair target site (explained in attachement II:
CRISPR/Cas9 Technology). This PAM sequence was chosen to match the 5’ – NGG
– 3’. The 5’ requirement of the target site was selected to end with ‘GG’. This
selection was made to increase the stability of the sgRNA binding to the genomic
DNA. These requirements lead to DNA target sites matching the sequence 5’ GG –
N19 – GG 3’, with ‘N’ as any possible nucleotide. The last requirement to be satisfied
was a GC content which had to be 50% or higher. Three matches given by
CHOPCHOP were selected. The exact position and sequence of the target site are
displayed in section 2.2.1.
14

2.2.3 sgRNA generation and transcription
To generate a sgRNA, DNA is needed as a template as explained in attachement II.
This DNA template has to contain a promoter for in vitro transcription, the spacer
region that is specific to the target site in the genomic DNA and an overlap region that
anneals to a constant oligonucleotide. This constant oligonucleotide encodes for the
reversed complement sequence of the sgRNAs tracrRNA. The sequence of the
tracrRNA tail of the sgRNA is always the same, regardless of the target site in the
genomic DNA. The following oligonucleotides for the generation of the DNA
templates were designed and ordered (Integrated DNA Technology).
sgRNA1 gene-specific oligonucleotide sequence:
5’ – ATTTAGGTGACACTATAGGGCTTAACACTTCAGGCTGGTTTTAGAGCTAGAAATAGCAAG – 3’
5’ – ATTTAGGTGACACTATAGGGGACAGGTCGTGGGGAAGGTTTTAGAGCTAGAAATAGCAAG – 3’
5’ – ATTTAGGTGACACTATAGGTATTTCTTCACGTCTGAGGTTTTAGAGCTAGAAATAGCAAG – 3’
The red sequences of the oligonucleotides display the SP6 promoter sequence.
The blue sequences are encoding the spacer region of the sgRNA, the crRNA, which
is complementary to the target site within the genomic DNA. The green sequences
display the overhang regions that are complementary with the constant
oligonucleotide encoding the reverse-complement of the tracrRNA tail of the sgRNA.
Constant oligonucleotide:
5’ –
AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTG
CTATTTCTAGCTCTAAAAC – 3’
The green displayed sequence of the constant oligonucleotide is the sequence
that anneals with the overhang regions of the gene-specific oligonucleotides, which
are also displayed in green.
To generate the DNA templates 1 μl of a gene-specific oligonucleotide [100
μM], 1 μl of the constant oligonucleotide [100 μM] and 8 μl water were added to a
200 μl PCR tube (Eppendorf). This procedure was performed with the three designed
gene-specific oligonucleotides in three separate PCR tubes. The PCR tube with a total
volume of 10 μl was subjected to an incubation program. The program consisted of 5
minutes at 95°C followed by a decrease in temperature from 95°C to 85°C with 2°C
per second. Then from 85°C to 25°C with a temperature decrease of 0.1°C per
second, and finally it was held at 4°C. This step was performed to anneal the
oligonucleotides. To obtain double stranded DNA the oligonucleotides were filled in
in the 5’  3’ direction by adding 2.5 μl dNTPs [10 mM (Invitrogen)], buffer 2 [10x
(New England Biolabs)], 2 μl BSA [10x, 1 mg/ml (New England Biolabs)], 0.5 μl T4
DNA polymerase [3 U/ml (New England Biolabs)] and 2.8 μl of water. The total
reaction volume of 19.8 μl of the three PCR tubes were incubated at 12°C for 20
minutes. After the incubation, the double stranded DNA had to be purified to increase
the transcription efficiency. This was done by using a Axyprep PCR clean up kit
(Axygen Biosciences). To test the DNA product they were run on a 2% agarose DNA
gel. The product should show a dominant band at 120 bp. When the proper products
15

were confirmed, the sgRNAs were transcribed using the SP6 MEGAscript kit
(Ambion). The reactions of the three PCR tubes were treated with 1 μl of TURBO
DNase [1 U/μl (Ambion)] to digest DNA remaining’s, and incubated for 15 minutes
at 37°C. The transcribed sgRNAs had to be purified using the Direct-Zol™
RNA
miniprep kit (Zymo Research). The concentrations of the sgRNAs were measured
using the Nanodrop and diluted to a concentration of 300 ng/μl and stored at -80°C.
2.2.4 Tg Zebrafisch lines and microinjection
As explained in section 2.1.1, the transgenic lines chosen to be injected were the
ACTA2 YFP, NOTCH GFP, PDGF-β TagRFP-T and the Snail2T2A:GFP. For the co-
injection of Cas9 endonuclease and one of the sgRNAs, mixtures were prepared. 1 μl
sgRNA [300 ng/μl] was added to 1 μl of Cas9 [1 μg/μl]. This reaction was incubated
at 37°C for 15 minutes. After the incubation 0.5 μl phenol red dye was added, and the
reaction was put on ice until injection.
The embryos of the transgenic lines had to be injected in the stage of one-cell
zygotes. This way a possible mutation in the injected cell will be transmitted to all
cells during the development of the embryo, increasing chances of transmitting the
mutation to the germ cells of the embryo. Females were crossed with males from the
same transgenic line (incross). The embryos of this incross were selected to be co-
injected with Cas9 and one or two of the specific sgRNAs.
2.2.5 Control efficiency CRISPR complexes
Injecting the embryos with the intention of growing them until adulthood to create the
F0 generation, required an efficiency assay that displays mutations that have taken
place in the genomic DNA of the injected embryos. HRMA was chosen for the
screening of the mutations (explained in attachment III: High Resolution Melting
Assay). This assay was used to test the mutation rates of embryos injected with one or
two specific sgRNAs. This was a way to investigate the efficiency of the CRISPR
complexes. As explained in attachment III, an HRMA is only reliable when
performed on a small double stranded DNA region. Therefore, to perform HRMA,
three different primer sets were designed for an HRMA for each sgRNA. The primer
sets, consisting of a forward and a reverse primer, were designed to flank an area with
a maximum of 110 bp. This area contained the predicted cleave site of each sgRNA,
and would therefore also contain the site in which the insertion or deletion of
nucleotides had taken place. The primer-BLAST tool of NCBI [21]
was used to design
the following primers specific to the intended PCR target.
HRMA primers CRISPR sgRNA1:
• Forward ATGTCTTAAAAGCCCTCCCGGT
• Reverse AGGTTGCTGGTAGTCCATACTGTT
• Forward GGTGGCGTACAATCCCATAACAG
• Reverse TGTGTCAGAGAGAGATGAGGGGT
• Forward GCAGATCGATCGAACCTCCG
Reverse GCGACATGCGAGAGAATGTT
16

20 embryos were used for each of the three sgRNAs to be injected along with Cas9
endonuclease. 24 hours post fertilization (hpf), genomic DNA of the embryos was
extracted for analysis. The DNA was extracted by adding 50 μl of a mixture of 1ml
DNA extraction buffer A [10 mM Tris-HCL, pH 8.0, 0.3% NP4O, 1 mM EDTA, 50
mM ICCI, 0.3% Tween20] and 50 μl of proteinase K [10 mg/ml] to a PCR tube
containing one single embryo. This reaction was incubated for 2 hours at 55°C and
then 5 minutes at 99°C. For the HRMA the genomic DNA of 8 uninjected embryos of
the ACTA2 YFP transgenic line was extracted to be used as a control. For the
HRMA, a 384-wells plate was used (Applied Biosystems). Every reaction contained
1μl of prepared genomic DNA, 5 μl Meltdoctor™ HRM Mastermix (Applied
Biosystems), 1 μl of primermix [5 mM forward primer, 5 mM reverse primer] and 3
μl of water.
17

2.2.6 Identification founder fish
The identification of the founder fish includes investigating the germline transmission
of the mutation of the injected zebrafish embryos. This means that a possible mutation
generated by the CRISPR/Cas9 method is transmitted to the germcells of the injected
embryo. If the germcells carry the mutation, they can transmit the mutation to the next
generation (F1). This was done by performing an HRMA on extracted DNA of
embryos of zebrafish raised from an outcross between specific injected embryos, with
wild type zebrafish. These embryos were embryos of the F1 generation.
Two families of zebrafish were obtained as explained in section 2.2.1. One
family (number 107829) contained zebrafish raised from embryos injected with
sgRNA1. The other family (number 107896) contained zebrafish raised from embryos
injected with sgRNA1/sgRNA2. From both these families fish were used to cross with
wild type fish in order to investigate whether a possible mutation has occurred in the
germline of the fish or not. Positive samples, meaning that the HRMA showed
heterozygous mutations, of a specific tested fish were used for genotyping to
determine the mutation in the genome. Positive tested individual zebrafish from
CRISPR families 107896 or 107829 were kept in separate tanks labelled with: family
number, sex, date and a specific letter (107829, male, 01 Jan, A). This system was
used to determine the genomic mutation of each specific zebrafish by sequencing. The
tested embryos coming from the labelled CRISPR family fish were given the same
code along with a sample number (107829, male, 01 Jan, A1) in order to determine
different mutations in different embryos. For the sequencing special primers were
designed to amplify a region of 412 bp. The amplified region flanked most of the
second exon of snai2 (Fig. 6).
Figure 6 schematic overview of the primer selection for sequencing to amplify a region in the snai2 gene
containing the target sites for zebrafish injected with sgRNA1, sgRNA2 or both (SnapGene Viewer).
Sequencing primerset:
• Forward primer: GTGACCTGTCAAAGTAGGC
• Reverse primer: CCCGAATACGTGCTGTAGG
18

2.2.7 Generation F1 family
The F1 generation was made by incrossing confirmed CRISPR mutants of the 107829
and 107896 families. This was done to generate a new family of fish carrying a
homozygous mutation. The embryos coming from the incrosses were labelled with
the codes given to the CRISPR parents (F0). For example: 107829, male, 22 Dec, C. x
107829, female, 01 Jan, A.
Positive tested embryos were used for confocal microscopy further to identify
possible defects during vascular development. This procedure was performed further
in the process.
19

3 Results
3.1 BAC recombineering
3.1.1 Insert confirmation
To confirm if all inserts were successfully incorporated into the pdgf-β BAC plasmid,
a PCR was performed on single colonies that were grown overnight at 37 °C on LB-
Cm-Amp-Kan plates. This is explained in section 2.1.6. The PCR products of the
colony PCR were run on a 1.5% agarose gel (Fig. 7). This was done to check if the
BAC construct contained the iTol2 insert and the TagRFP-T insert.
Figure 7 Control of the product size of the iTol2 inserts on 8 single colonies of the BAC (lane 2-9). Control of
the product size of the pdgf-β/TagRFP-T insert on the same 8 single colonies of the BAC constructs (lane 10-
17).
To see in Figure 6 is that the BAC constructs contains both inserts. The iTol2 insert
detected by the use of iTol2 forward and reverse primers amplified a PCR product
with a size of 300 bp as it should. The TagRFP-T insert was detected by the use of a
TagRFP-T_Kan(R) forward primer and a pdgf-β reversed primer (primers are
displayed in section 2.1). These primers amplified a PCR product with a size of 200
bp. This showed that also the last targeting insert, containing the reporter cassette,
was successfully incorporated into the BAC construct.
The pdgf-β BAC construct contained will be injected into wild type embryos
to create the Tg pdgf-β:TagRFP-T zebrafish line.
3.2 CRISPR/Cas9 technology
3.2.1 syntheses sgRNA1, 2 and 3
The CRISPR technology is used to create the snai2 knockout. For these CRISPR
complexes sgRNAs had to be designed to target specific sites in the genomic DNA as
explained in section 2.2.
The synthesised DNA templates needed for the in vitro transcription to
generate the sgRNAs were analysed on a 2% agarose gel for product size. The
product sizes were validated at 120 bp (Fig. 8).
20

The generated DNA templates with the size of 120 bp were measured using
the Nanodrop to determine the DNA concentration (Table 1).
Table 1 Concentration of generated DNA templates.
DNA template sgRNA1 66.9 ng/μl
The templates were used to generate the sgRNAs. The sgRNAs were also run
on a 2% agarose gel to validate the products (Fig. 9).
The analysis of the gel shows that the products have the proper sizes which
means that the sgRNAs were correctly generated. The concentration of the sgRNAs
was determined using the Nanodrop (Table 2).
Figure 8A control product size DNA templates for
sgRNA1 (left band) and sgRNA2 (right band). Product
size at 120 bp length. The marked lane contains
collaborators product.
Figure 8B control product size DNA template for
sgRNA3. The marked lane contains collaborators
product.
Figure 9A sgRNA1 (left) and 2 (right) product
validation. Product size 120 bp.
Figure 9B sgRNA3 product validation. Product size 120
bp.
21

Table 2 Concentration of validated sgRNAs.
sgRNA1 3359.4 ng/μl
sgRNA2 2081.9 ng/μl
sgRNA3 717.8 ng/μl
3.2.2 Efficiency assays
As explained in section 2.2.5 the sgRNAs were checked on the efficiency of their site-
specific cleavage before they were grown up to form the F0 generation. An HRMA
was performed on sgRNA1/Cas9 co-injected embryos of the of the Tg BAC
notch:GFP (Fig. 10).
The derivative melting curve of the uninjected embryos displayed in Figure
10A, shows that only one PCR product that has been amplified during the PCR of the
HRMA. This can be concluded because the derivative melting curves shows single
peaks at the same temperature. Figure 10B, displaying the aligned melting curves,
shows that the uninjected embryos do not have any InDel mutations in the amplified
region in their genomic DNA. This means that they can be used as a reliable control.
Comparing the injected embryos with these controls shows several InDel mutations in
the amplified region of the genomic DNA. 18 out of 20 embryos show a variant
aligned melting curve compared to the controls. This mutation rate give rise to an
efficiency of 90% by the CRISPR complex on the target site of sgRNA1.
A second HRMA was performed on co-injected sgRNA2/Cas9 embryos of the
Tg BAC notch:GFP (Fig. 11).
Figure 10B Display of the mutation rate of the DNA
of the embryos co-injected with sgRNA1/Cas9 by
comparison of the aigned melt curves.
Figure 10A Display of the derivative melt curve of the
DNA of the uninjected embryos of the Tg BAC
notch:GFP, serving as a control for the reliability of the
HRMA.
22

The derivative melting curve displayed in Figure 11A shows multiple peaks
meaning that multiple different PCR products were amplified. This means that the
controls are not reliable and cannot be used as a reference for mutation recognitions
of the samples carrying DNA of injected embryos. The validation of the site-specific
cleavage of the CRISPR complex formed by Cas9 and sgRNA2 cannot be determined
using this HRMA. As displayed in Figure 11B, possible mutations are not
recognizable because the aligned melting curves do not simulate the melting process
of the proper product. The aligned melting curves should be similar to the aligned
melting curves displayed in Figure 10B.
Another HRMA was perfomed on co-injected sgRNA2/sgRNA3/Cas9
embryos of the Tg BAC acta2:YFP (Fig. 12). Double site-specific cleavage of
sgRNA2 and 3 can be identified by unamplified product in the concerning well. This
is because the sgRNA3 forward primer in this case is not able to bind the DNA as this
is cleaved out of the genomic DNA. The PCR will therefore fail to amplify this DNA
region.
Figure 11A Displays the derivative melting
curve of the DNA of the uninjected embryos of
the Tg BAC notch:GFP, serving as a control
for the reliability of the HRMA.
Figure 11B Display of the aligned melt
curve of the embryos co-injected with
sgRNA2/Cas9 and the aligned melt
curves of the controls.
Figure 12A Display of the derivative melt
curve of the DNA of the uninjected embryos
of the Tg BAC acta2:YFP, serving as a
control for the reliability of the HRMA.
Figure 12B Display of the mutation rate of the DNA
of the embryos co-injected with
sgRNA2/sgRNA3/Cas9 by comparison of the aligned
melt curves.
23

The derivative melting curves of the uninjected Tg BAC acta2:YFP embryos
displayed in Figure 12A show that only one PCR product has been amplified during
the PCR of the HRMA. Figure 12B, displaying the aligned melt curves of the
uninjected embryos and the sample’s containing the DNA of the embryos co-injected
with sgRNA2/sgRNA3/Cas9, shows that the uninjected embryos do not contain any
InDel mutations in the amplified region, which means that they can be used as a
reliable control. Comparing the controls with the sample’s containing the DNA of the
injected embryos again shows several InDel mutations. 8 out of 10 injected embryos
show an aligned melting curve that is different from the aligned melting curve of the
control embryos, meaning that the tested injected embryos give a mutation rate of
80%. In this case this gives rise to the efficiency of site-specific cleavage of the
CRISPR complex on the target site of sgRNA3, but not about the efficiency on the
target site of sgRNA2. The efficiency of the CRISPR complex on the target site of
sgRNA3 is 80%.
Amplified DNA of double injected embryos were also checked on a 1.5%
agarose gel to see if double site-specific cleavage had taken place, using the forward
primer of sgRNA2 and the reverse primer of sgRNA3. These assays were performed
on embryos co-injected with sgRNA1/sgRNA2/Cas9 or sgRNA2/sgRNA3/Cas9.
Embryos of the Tg BAC acta2:YFP were co-injected with
sgRNA1/sgRNA2/Cas9. For the PCR to amplify the region of interest, the forward
primer of sgRNA1 was used in combination with the reverse primer of sgRNA3. The
region of interest has a length of 164 bp. If both CRISPR complexes cleave at the
same time, a DNA fragment of 75 bp is deleted. During NHEJ repair, the size of the
InDel will determine the new length of the DNA. The repaired strand without inserted
or deleted basepairs will have a length of 89 bp. The PCR was performed on DNA
extracted from 24 sgRNA1/sgRNA2/Cas9 co-injected embryos and 8 uninjected
embryos. The products were run on a 1.5% agarose gel (Fig. 13).
Figure 13 Picture of the gel on which the amplified DNA regions of the uninjected Tg BAC acta2:YFP (lane
1-4 and 25-28) and the sgRNA1/sgRNA2/Cas9 injected TgBAC acta2:YFP (lane 5-24 and lane 29-32) are
run.
Small InDel mutations are hard to perceive on a gel, as they often are just a
few basepairs. In lane 6 a band is visible at approximately 100 bp. Because all the
other bands are the same size as the uninjected embryos, the detected band in lane 6 is
24

most likely the cause of a double cleavage mutation, meaning that the DNA fragment
between the target sites of sgRNA1 and sgRNA2 is cleaved out. The ladder, which is
not well defined, shows that the gel did not run long enough.
Amplified DNA of the embryos of the co-injected sgRNA2/sgRNA3/Cas9 Tg
BAC acta2:YFP were also run on a 1.5% agarose gel. The region of interest was
amplified by using the control forward primer of sgRNA2 and the control reverse
primer of sgRNA3. The amplified region should have a size of 967 bp. This was a lot
bigger because the region also contained the complete intron between the second and
third exon of the snai2 gene. The region in-between the cleavage sites had a size of
853 bp, meaning that the eventually repaired DNA would have a size of 114 bp.
Running the products on the gel and analysing them did not show any big basepair
deletions (data not shown).
3.2.3 Identification founder fish
The zebrafish co-injected with sgRNA1 (family number 107829), and
sgRNA1/sgRNA2 (family number 107896) of the F0 generation that carry a mutation
in their genome, meaning that they also carry this mutation in their germline, have to
be identified to create an F1 generation of zebrafish carrying the same mutation.
Many zebrafish of both the families 107829 (sgRNA1) and 107896 (sgRNA1, 2) will
be crossed with wild type zebrafish to confirm that the mutation is also transmitted to
the germline of the injected zebrafish. The genomic mutation in the embryos of these
outcrosses will be displayed in an overview in attachement IV. In this section an
example of the analysis of HRMA and sequencing results is given.
Sample ‘107829, male, 12 Jan, B14’ (F1) was tested positive by an HRMA
(Fig. 14).
Figure 14 Display of the HRMA of sample ‘107829, male, 12 Jan, B14’. The red lines display the aligned
melting curve of the wil type embryos. The purple line displays the aligned melting curve of sample ‘107829,
male, 12 Jan, B14’, showing a heterozygous mutation.
This sample was used for sequencing. This way the exact sequence mutation in the
sequence can be determined using the genomic DNA of a wild type zebrafish as
reference DNA (Fig. 15). For the sequencing the primers discussed in section 2.2.6
were used. The upper chromatogram displays the upper strand and the chromatogram
beneath shows the bottom strand of the ‘107829, male, 12 Jan, B14’ sample DNA.
25

Figure 15 Display of the sequence of the upper and lower strand of the amplified region in the genomic
DNA of sample ‘107829, male, 12 Jan, B14’ by a chromatogram. Wild type zebrafish DNA is used as a
reference.
The upper chromatogram of the upper strand starts showing double peaks after 5’ -
CCTCAG’ - 3’ (red arrow). The chromatogram beneath starts showing double peaks
after 3’ – AACACT – 5’ (red arrow). The upper strand is used to manually determine
the mutation in the DNA of the sample. The manual determination was compared to
the results of software [22]
made for data analysis of sequence results, which came
down to a deletion of 7 bp (Fig. 16).
Figure 16 Overview of the 7 bp deletion in the ‘107829, male, 12 Jan, B14’ sample using the software
program Poly Peak Parser [22]
.
A 7 bp deletion in the snai2 gene at this location in the genome of the zebrafish leads
to a change in the composition of amino acids and subsequently to a premature
stopcodon (Fig. 17). The amino acid composition of wild type zebrafish is displayed
in an overview in attachement IV along with the mutant founders (F1 generation).
Figure 17 overview of the mutated genome of the ‘107829, male, 12 Jan, B14’ sample. Stopcodons are
displayed as the red squares.
Figure 17 shows that at position 133 there is a codon coding for cysteine followed by
a stopcodon. In the wild type genome there is a codon coding for proline at position
133. the stopcodon after cysteine displayed of the ‘107829, male, 12 Jan, B14’ sample
26

can be considered a premature stopcodon. The fish labelled ‘107829, male, 12 Jan,
B14’, is a CRISPR mutant and carries this mutation in his germcells.
Another important observation to be noticed, is that sample ‘107829, male, 12
Jan, D3’ shows an exact similar genomic mutation even though the tested embryos
are derived from two different zebrafish of the F0 generation (Fig. 18).
Samples 107829, male, 07 Jan, B2/B3/B5 (F1) were also positive tested by an
HRMA (Fig. 19).
Figure 19 Display of the HRMA of samples ‘107829, male, 07 Jan, B2/B3/B5’. The red lines display the
aligned melting curve of the wil type embryos. The green lines display the aligned melting curves of samples
‘107829, male, 07 Jan, B2/B3/B5’, showing heterozygous mutations.
Figure 18A Display of the HRMA of sample
‘107829, male, 12 Jan, D3’.
Figure 18B overview of the 7 bp deletion in the ‘107829, male, 12 Jan, D3’
sample by Poly Peak Parser [22]
.
27

Figure 19 shows that the curves of samples B2, B3 and B5 all look like each other,
leading to the suggestion that the DNA of these embryos contain the same mutation.
All samples were sequenced xusing the same primerset as discussed in section 2.2.6.
Because the chromatograms of the upper and lower strand of all three samples was
similar, only the chromatograms of sample ‘107829, male, 07 Jan, B2’ will be
displayed (Fig. 20). The fact that the chromatograms of B2, B3 and B5 look similar,
approve the suggestion that they contain the same genomic mutation.
DNA of sample ‘107829, male, 7 Jan, B2/B3/B5’ by a chromatogram. Wild type zebrafish DNA is used as a
reference.
The upper chromatogram of the upper strand starts showing double peaks after
5’ – ATACCT – 3’ (red arrow). The chromatogram beneath starts showing double
peaks after 3’ – AAGTCC – 5’ (red arrow). Again a manual method was used to
determine the mutation in the genomic DNA of the mutant zebrafish that came down
to a deletion of 6 bp near the target site of sgRNA1. Again this was compared to the
results given by the software program Poly Peak Parser [22]
(Fig. 21).
Figure 21 Overview of the 6 bp deletion in the ‘107829, male, 7 Jan, B2/B3/B5’ sample by Poly Peak Parser
[22]
.
A 6 bp deletion in the snai2 gene at this location leads to the change of a single codon
at position 130 and the deletion of two amino acids. The only change in amino acids
is the codon at position 130 encoding glutamic acid instead of glutamine (Fig. 22).
28

Figure 22 Overview of the mutated genome of the ‘107829, male, 7 Jan, B2/B3/B5’ sample. A glutamic acid
instead of a glutamine is encoded at position 130 bp.
Again a sample from another fish with label ‘107829, male, 12 Jan, B17’ (F1),
contains the exact same mutation (Fig 23).
Sample ‘107896, male, 22 Jan, C1’ (F1) was also positive tested by an HRMA
(Fig. 24).
Figure 24 Display of the HRMA of samples ‘107896, male, 22 Jan, C1’. The red lines display the aligned
melting curve of the wil type embryos. The blue line displays the aligned melting curve of sample ‘107896,
male, 22 Jan, C1’, showing a heterozygous mutation.
Figure 23A Display of the HRMA of sample
‘107829, male, 12 Jan, B17’.
Figure 23B overview of the 6 bp deletion in the ‘107829, male, 7 Jan, B17’
sample by Poly Peak Parser [22]
.
29

In this case, embryo C1 (F1) was the only sample from Fish C of the F0 generation
that carried this mutation. Other mutations of fish C and other fish from the 107896
family are displayed in attachement IV. Based on the HRMA, the sample was
sequenced using the same primerset as discussed in section 2.2.6. The result of the
sequencing is displayed in Figure 25.
DNA of sample ‘107896, male, 22 Jan, C1’ by a chromatogram. Wild type zebrafish DNA is used as a
reference.
The upper chromatogram in Figure 32 starts showing double peaks after 5’ –
CACCCC – 3’, where the chromatogram beneath starts showing double peaks after 3’
– CCCCAC – 5’. To determine the exact mutation, again a manual method is
executed on the data to determine the exact mutation in the genomic DNA. This
resulted in a 5 bp deletion near the target site of sgRNA2. The manual outcome was
compared to the results given by the software program Poly Peak Parser [22]
(Fig. 26).
Figure 26 overview of the 5 bp deletion in the ‘107896, male, 22 Jan, C1’ sample by Poly Peak Parser [22]
.
The 5 bp deletion led to a frameshift and premature stopcodon downstream near the
region in which the mutation has occurred in the genomic DNA (Fig. 27). The change
in amino acids upstream of the premature stopcodon are displayed in attachement IV.
Figure 27 Overview of the mutated genome of the ‘107896, male, 22 Jan, C1’ sample. Again the stopcodons
are displayed as red squares.
32

4 Discussion
4.1BAC recombineering
To display a successful insert of a targeting insert into the BAC construct, a colony
PCR was performed. This PCR failed to work when using the same protocol for each
insert. Adjusting the PCR protocol for each insert made it possible to prove successful
incorporation of a specific targeting insert. Due to a shortage of time, the BAC
construct was not injected into zebrafish embryos and imaged. This procedure is yet
to be performed.
4.2 CRISPR mutants
CRISPR mutants were confirmed by HRMA and sequencing as explained in section
2.2. For the determination of the mutation rate of a batch with a specific sgRNA a
HRMA was performed as explained in section 2.2.5. The primerset for the control of
the mutationrate on the second target site (sgRNA2) by an HRMA showed a divergent
amplification plot (see figure 11A). This means that the primerset amplifying the
DNA region containing the second target site on the genomic DNA were not properly
designed and did not give an accurate PCR product. However, after injections of
sgRNA1/sgRNA2 in the Tg BAC acta2:YFP batch, an agarose gel showed a sample
that was significantly shorter than the other products (see figure 13, lane 6). This
implicates cleavage of the sgRNAs at the same time and loss of the 75 bp long DNA
fragment in-between the cleavage sites. Because the DNA ladder is not accurate, a
close estimation of the length of the highlighted sample (Fig. 18, lane 6) could not be
made. Yet, if double cleavage occurred, the proper functioning of the CRISPR
complex with sgRNA2 on the second target site has been demonstrated. Another
demonstration of the functioning of sgRNA2 is the sequencing data showing a 5 bp
deletion near the second target site in the DNA of sample ‘107896, male, 22 Jan, C1’
in section 3.2.3 (see figure 25 & 26).
Another important issue is the creation of a homozygous F1 generation with a
stabile CRISPR mutation. Injecting a CRISPR/Cas9 complex into the single cell stage
of a zebrafish embryo should theoretically result in a mutation that is then passed on
through every cell. Therefore the germline, so every germcell, should contain the
same genomic mutation. However, HRMA and genotyping (attachement IV) shows
us that crossing CRISPR mutant F0 generations 107829 and 107896 with wild type
zebrafish results in embryos that contain different mutations. This might be possible
because the cutting of the CRISPR/Cas9 complex and the NHEJ DNA repair do not
all occur in the same stage of the embryo. The implication of DNA repair happening
in, for example, the two-cell stage of the embryo, gives rise to the possibility of
different mutations in the germline of one injected embryo. The creation of a clean
homozygous CRISPR mutant generation requires an equal mutation. Therefore, it is
better to create a heterozygous F1 generation and a homozygous F2 generation for
imaging. This way, zebrafish of the F1 generation can be genotyped and selected
based on their mutation for the creation of the F2 generation. This will result in a clean
homozygous F2 generation.
33

5 Conclusions
This research shows that a stabile Bacterial Artificial Chromosome construct can be
created for the targeting of the pdgf-β gene with a TagRFP-T fluorescent protein by
BAC recombineering. Creation and imaging of the Tg pdgf-β:TagRFP-T is still in
progress.
Genotyping has proven that a snai2 knockout mutant of the Danio Rerio can
be generated by the CRISPR/Cas9 technology. Design and co-injection of several
site-specific single guide RNAs gives rise to accurate cleavage by a Cas9
endonuclease on a targeted site in the second and third exon of the snai2. A premature
stopcodon can be introduced in the beginning of the Zinc-finger DNA binding domain
of Snail2 leading to a non-functional protein. This gives rise to the conclusion that the
loss of function of snai2 can be induced by the generation of a CRISPR mutant.
6 Recommendations
For more effective BAC recombineering, the colony PCR protocol should be
optimized for it to work on every targeting insert. This way it will be more accurate,
and all primers of earlier performed inserts can be used in the role of a positive
control during the same colony PCR.
As discussed in section 4.2, the most important next step would be the creation
of a clean homozygous F2 generation that can be used for imaging. This way a
specific phenotype can be connected to the knockout of Snail2 and the function of
Snail2 can possibly be more accurately determined.
For the determination of a more accurate model for the expression profile of
Snail2, a transgenic line specific for smooth muscle cells can be generated. If a Snail2
knockout is created in this Tg line, confocal microscopy could possibly reveal more
about the expression profile of Snail2 and also its function.
Because an implication of Snail2 is to be controlled by Notch signalling, a
knockout model of Notch3 could possibly reveal more about the involvement of
Notch signalling in the control of Snail2 if injected in a transgenic line that expresses
a fluorescent protein under the control of the snai2 promotor, for example
snail2T2A:GFP. Also because the mCherry and GFP expression in the transgenic
lines controlled by the snai2 promotor are not really strong, it would be better to
create a transgenic line that shows stronger expression of the reporter cassette. For
example by the use of Upstream Activating Sequence (UAS) cassettes in front of the
reporter cassette, or by the use of a different reporter cassette.
Another interesting process to investigate would be the cleavage by different
CRISPR complexes at the same time, enabling a large DNA fragment to be deleted
out of the genome. Because CRISPRs are relative cheap and it is a quick method.
Optimizing this method would allow the deletion of large fragments relatively easy.
34

7 Self reflection
In my time at the Institute for Molecular Bioscience I have gained a lot of experience
and knowledge. A hard thing about an internship in general I think is the start. When
you are in the lab on your own and you have to start organising your projects and own
experiments. When I started I made many mistakes because of the fact that I didn’t
organise my experiments properly. This made it very chaotic. I think I learned quite
quickly that organising and planning your day enables me to keep a better focus on
my experiments without being distracted about other thoughts of things I have to do.
Another aspect is lab skills. On Fontys University you learn many skills but don’t use
those skills to often. When you work in a lab and have to use specific skills every day,
you learn how to work more effective. After a while, when you get better at some
things, you start saving a lot of time and experiments seem to succeed more often. In
the beginning I found it hard that I had to repeat experiments because they didn’t
work. Speaking with colleagues in the lab taught me that that is also a part of working
in the lab and that it is just a matter of trouble shooting to make an experiment
succeed. My overall experience at the IMB has been insanely good. I had a very nice
working environment and nice people around me to work with. A new and cool
experience I thought was the fact that I really lead my own project, even though my
supervisor informed me about the plan of the project, helped me gaining some
important skills and helped me make decisions during my project. The project I have
been working on is not completely finished yet, and if I had the chance I would stay
another year to finish it properly!
35

8 References
 [1]: Qiagen, ‘DSB repair by homologous recombination’, consulted on 25/09/14,
http://www.qiagen.com/products/genes%20and%20pathways/pathway%20details.
aspx?pwid=143
 [2]: Dickinson DJ, Ward JD, Reiner DJ, Goldstein B, ‘Engineering the
Caenorhabditis elegans genome using Cas9-triggered homologous
recombination’, consulted on 25/09/14,
http://www.ncbi.nlm.nih.gov/pubmed/23995389
 [3]: Thomas Gaj, Charles Gersbach, Carlos F Barbas, ‘ZFN, Talen, and
CRISPR/Cas-based methods for genome engineering’. Trends in Biotechnology,
Vol. 31, No. 7, pp. 397 – 398.
 [4]: Ryan M. Walsch, Konrad Hochedlinger, ‘A variant CRISPR-Cas9 system
adds versatility to genome engineering’. PNAS, Vol. 110, No. 39, pp. 15514 –
15515.
 [5]: Kent WJ, ‘BLAT – the BLAST-like allignment tool’, last consulted on
20/10/2014, https://genome.ucsc.edu/cgi-
bin/hgc?hgsid=389893389_R6ZGinWT5pAJdMtTmECGiDvdIA7c&c=chr24&o=
36882657&t=36888674&g=refGene&i=NM_001008581
 [6]: Jason C. Kovacic, Nadia Mercader, Miguel Torres, Manfred Boehm, Valentin
Fuster, ‘Epithelial-to-Mesenchymal and Endothelial-to-Mesenchymal
Transistion’, consulted on 29/09/2014,
http://circ.ahajournals.org/content/125/14/1795.long#sec-5
 [7]: LeBlue VS, Macdonald B, Kalluri R, ‘Structure and function of basement
membranes’, Exp Biol Med (Maywood), October 2009, Vol. 239, No. 9, pp. 1121
 [8]: Carlos O. Lizama, Ann C. Zovein, ‘Polarizing pathways: Balancing
endothelial polarity, permeability, and lumen formation’, Elsevier, March 2013,
Vol. 319, pp. 1247 – 1254.
 [9]: Samy Lamouille, Jian Xu, Rik Derynck, ‘Molecular mechanisms of epithelial-
mesenchymal transitions’. Molecular Cell Biology, Vol. 15, March 2014, pp. 178-
196.
 [10]: Melissa G. Mendez, Shin-Ichiro Kojima, Robert D. Goldman, ‘Vimentin
induces changes in cell shape, motility, and adhesion during epithelial to
mesenchymal transistion’, The FASEB Journal, june 2010, Vol. 24, No. 6, pp.
1838 – 1851.
 [11]: Yifan Wang, Jian Shi, Kequn Chai, Xuhua Ying, Binhua P. Zhou, ‘The role
of Snail in EMT and Tumorigenesis’, Current cancer drug targets, Vol. 13, April
2014, pp. 963 – 972.
36

 [12]: M. Angela Nieto, ‘The Snail superfamily of zinc-finger transcription
factors’. Nature reviews, Molecular Cell Biology, Vol. 3, March 2002, pp. 155 –
160.
 [13]: S. Potenta, E. Zeisberg, R. Kalluri, ‘The role of endothelial-to-mesenchymal
transition in cancer progression’. British journal of cancer, Vol. 99, September
2008, pp. 1375 – 1379.
 [14]: Laurens A. Van Meeteren, Peter ten Dijke, ‘Regulation of endothelial Cell
plasticity by TGF-β’. Cell Tissue Res, Vol. 347, 2012, pp. 177 – 186.
 [15]: Thomas H. Adair, Jean-Pierre Montani, ‘Angiogenesis’. Morgan & Claypool
Life sciences, 2010.
 [16]: Florian Milde, Michael Bergdorf, Petros Koumoutsakos, ‘A Hybrid Model
for Three-Dimensional Simulations of Sprouting Angiogenesis’. Biophysical
Journal, October 2008, Vol. 95, No. 7, pp. 3146 – 3160.
 [17]: Yuying Wang, Luyuan Pan, Cecelilia B. Moens Bruce Appel, ‘Notch3
establishes brain vascular integrity by regulating pericty number’. The company
of development, Vol. 141, 2014, pp. 307 – 317.
 [18]: Jorg Reichrath, Sandra Reichrath, ‘Notch Signaling in Embryology and
Cancer’. Landes Bioscience, New York, 2012, pp. 250 – 251.
 [19]: Stuart J. Mills, Allison J. Cowin, Pritinder Kaur, ‘Pericytes, mesenchymal
stem cells and the wound healing process’, Cells, 2013, Vol. 2, pp. 622.
 [20]: Tessa G. Montague, Jose M. Cruz, James A. Gagnon, George M. Church,
Eivind Valen, ‘CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome
editing’. Nucleic Acids Research, 2014, Vol. 42.
https://chopchop.rc.fas.harvard.edu/about.php
 [21]: J. Ye, G. Coulouris, I. Zaretskaya, I. Cutcutache , S. Rozen, T.L. Madden,
‘Primer-BLAST: a tool to design target-specific primers for polymerase chain
reaction’, BMC Bioinformatics, June 2012, Vol. 18, No. 134,
http://www.ncbi.nlm.nih.gov/pubmed/?term=22708584
 [22]: Hill JT, Demarest BL, Bisgrove BW, Su YC, Smith M, Yost HJ (2014),
‘Poly Peak Parser: method and software for identification of unknown using
sanger sequencing of PCR products’. Consulted on 22/01/2015,
http://spark.rstudio.com/yostlab/PolyPeakParser/.
 [23]: Nandor Nagy, Olive Mwizerwa, Karina Yaniv, Liran Carmel, Rafael
Pieretti-Vanmarcke, Brant M. Weinstein, Allan M. Goldstein, ‘Endothelial cells
promote migration and proliferation of enteric neural crest cells via β1 integrin
signaling’. Developmental Biology, June 2009, Vol. 330, No. 2, pp. 263 – 272.
37

 [24]: John J. Armstrong, Karen K. Hirschi, ‘Recombineering of BAC DNA for the
Generation of Transgenic Mice’, consulted on 15/10/2014,
http://cdn.intechopen.com/pdfs-wm/24401.pdf
 [25]: Kevinsche, ‘ The big bad bac: Bacterial Artificial Chromosomes’, consulted
on 16/10/2014, http://www.scq.ubc.ca/the-big-bad-bac-bacterial-artificial-
chromosomes/
 [26]: Louise van der Weyden, David J. Adams, Allan Bradley, ‘Tools for targeted
manipulation of the mouse genome’, Physiological Genomics, January 2002, Vol.
11, No. 3, pp. 133 – 164.
 [27]: Jeroen Bussmann, Stefan Schulte-Merker, ‘Rapid BAC selection tol2-
mediated transgenesis in zebrafish’. ‘TECHNICAL PAPER’, accepted: 22 june
2011.
 [28]: Muyers, J.P.P.P et al, ‘Rapid modification of bacterial artificial
chromosomes by ET-recombination, Nucleic Acids Research, 1999, Vol. 27, pp.
1555 – 1557.
 [29]: Roger Y. Tsien, ‘The Green Fluorescent Protein’, Annual Review of
Biochemistry, July 1998, Vol. 67, pp. 509 – 544.
 [30]: Kazuhide Asawaka, Koichi Kawakami, ‘Targeted gene expression by the
Gal4-UAS system in zebrafish’. Japanse society of developmental biologists,
accepted: 22 march 2008.
 [31]: Katja Prubing, Aaron Voigt, Jorg Schulz, ‘Drosophila melanogaster as a
model organism for Alzheimer’s disease’, Molecular Neurodegradation, 2013,
Vol. 8, No. 35.
 [32]: Ryan M. Walsch, Konrad Hochedlinger, ‘A variant CRISPR-Cas9 system
adds versatility to genome engineering’. PNAS, Vol. 110, No. 39, September
2013, pp. 15514 – 15515.
 [33]: P. Perez-Pinera, ‘RNA-guided gene activation by CRISPR-Cas9-based
transcription methods’, consulted on 07/10/2014,
http://2013.igem.org/Team:Duke/Project/Basics.
 [34]: James A. Gagnon, Eivind Valen, Summer B. Thyme, Peng Huang, Laila
Ahkmetova, Andrea Pauli, Tessa G. Montague, Steven Zimmerman, Constance
Richter, Alexander F. Schier, ‘Efficient mutagenesis by Cas9 protein-mediated
oligonucleotide insertion and large-scale assessment of Single-Guide RNAs’.
PLOS one, Vol. 9, No. 5, May 2014, e98186.
 [35]: F. Ann Ran, Patrick D. Hsu, Jason Wright, Vineeta Agarwala, David A.
Scott, Feng Zhang, ‘Genome engineering using the CRISPR-Cas9 system’.
Nature Protocols, Vol. 8, October 2013, pp. 2281 – 2308.
38

 [36]: Maria Eali, Carl T. Wittwer, ‘High Resolution Analasys for Gene Scanning’,
PMC, Vol. 50, No. 4, April 2010, pp. 250 – 261.
39

Attachement I: Transgenesis by BAC selection
A BAC (Bacterial Artificial Chromosome) is an artificial DNA construct, based on a
fertility plasmid found in Escherichia Coli called the F-plasmid [24]
. This F-plasmid is
a DNA molecule that is separate from chromosomal DNA. An important property of
this plasmid is a process called conjugation. Conjugation allows to be transferred
from one bacterial cell to another bacterial cell by direct cell-to-cell contact. BACs
are transferred into a bacterial cell by a process called transformation. Transformation
is another way for exogenous DNA to be directly transported through the membrane
of a bacterial cell.
BACs are constructed to contain the F-plasmid with a complete locus of one
or more genes. BACs can maintain genomic DNA sequences up to 350 Kbp in length.
This means that a BAC may also contain all upstream regulatory elements necessary
for gene expression such as the promoter region. The gene in a BAC can therefore be
expressed in a cell where all necessary transcriptional factors are also expressed. For
the study of the transcription and expression of genes in specific cells BACs are an
efficient tool. To study a gene of interest, a gene-specific BAC has to be constructed.
To design a proper BAC plasmid, gene loci have to be incorporated into the
BAC. Development and optimization methods for harnessing these BAC carrying
gene loci are required. These methods are referred to as BAC recombineering. BAC
recombineering relies on the presence of unique restriction enzyme sites in the F-
plasmid via a series of digestions. Ligation processes then incorporate the desired
DNA sequence into the plasmid (Fig. 28).
Figure 28 BAC construct containing a certain gene of interest ligated in the F-plasmid [25]
.
An important system to insert specific DNA regions into the BAC plasmid is
Homologous Recombination. This system requires linear DNA as a template, as
explained in section 1.3.1. Homologous Recombination is a way to repair double
stranded DNA breaks. If the used DNA template contains the desired DNA sequence
along with a 50 basepair 3’ and a 5’ homology arm, it can be incorporated into the
BAC plasmid (Fig. 29). The 3’ homology arm has to be homologous at the 5’ site of
the DSB in the BAC plasmid, where the 5’ homology is required to be homologous at
the 3’ site of the DSB in the BAC.
A

Figure 29 Insert incorporation in BAC by homologous recombination. The insert DNA contains two
homology arms [26]
. The 5' homology arm is homologous to the left of the DSB in the BAC plasmid, while the
3' homology arm is homologous to the right side.
The lineair template DNA necessary for homologous recombination can be
generated by PCR. Designing proper primers, specific regions of linear DNA can be
amplified for the use of BAC recombineering [27]
. Homologous recombination is a
process that has to take place inside bacteria, as it relies on many enzymes. This is
why the BAC plasmid is grown in an E. coli strain. A pRedET plasmid is co-
transferred into this E. coli strain along with the BAC plasmid, as it expresses
restriction- and ligation enzymes necessary for the incorporation of the PCR amplified
linear DNA template. Electroporation is used to create Double Stranded Breaks in the
BAC plasmid. The enzymes expressed by the pRedET plasmid can induce
homologous recombination if the DSB is generated on a position where the homology
arms of the linear template are homologous to the 5’ and 3’ site relative to the DSB in
the BAC plasmid (Fig. 30). DSB positions in the BAC where the homology arms are
not complementary, homologous recombination will not be possible. Those DSBs
will be repaired using Non Homologous End Joining. Because these sites will contain
random insertions or deletions of a variable number of nucleotides after repair, they
will not be specific BACs containing the gene of interest. The specific generated
BACs have to be separated from non-specific BACs. Incorporating a resistance gene
against a specific antibiotic into the backbone of the BAC plasmid creates this
selection. This resistance gene, also amplified by PCR, is co-incorporated in the linear
DNA template along with the gene of interest. The template containing the gene of
interest, the resistance gene and the necessary 50 basepair homology arms are
generated by connecting the PCR products of the specific amplified linear DNA
regions using a region of non-coding DNA. The non-coding sequence between the
resistance gene and the gene of interest does not influence the expression of the genes.
As homologous recombination uses this linear DNA template as an insert, only DSBs
in BACs repaired by homologous recombination will now contain the gene of interest
along with the resistance gene. The resistance gene protects the bacteria against a
B

specific antibiotic. Bacteria containing BAC plasmids that have not incorporated the
insert by homologous recombination will therefore not be protected against the
chemical, and will die when exposed to it. Selection takes place by plating the
bacteria on a plate containing the specific antibiotic. This way only bacteria
containing the BAC plasmids with the resistance gene in their backbone, the ones
where homologous recombination repaired DSBs will survive and form colonies.
pRedET is a plasmid that is very sensitive for changes in temperature and is
best kept with 30 °C. For the BAC constructs it is best to grow at 37°C when the
DNA template is successfully incorporated in the plasmid. Changing the temperature
from 30 to 37 °C will destroy the pRedET plasmid. When only one insert has to be
incorporated in the BAC plasmid, the pRedET plasmid is no longer necessary in the
bacteria after successful incorporation. Though, if a second insert is to be
incorporated into the BAC construct, the pRedET plasmid has to be re-transformed
into the bacteria to again provide the enzymes required for homologous
recombination.
Figure 30 inserting linear DNA template containing the gene of interest along with the resistance gene into
the backbone of the BAC plasmid [28]
. pRedET as an external plasmid providing the necessary enzymes for
restriction and ligation activity.
When a BAC construct is present in a mammalian cell it can provide
information about the tissue in which cells transcribe certain genes, and the tissue of
which the cells express certain proteins. BAC plasmids are constructed to contain a
complete gene of interest, meaning that it also contains the upstream regulatory
sequences including the promoter. The promoter region of the DNA, when bound
with gene specific transcription factors, regulates transcription of a gene. If this
promoter region has a downstream start codon and protein coding sequence, a protein
is expressed.
Green Fluorescent Protein (GFP) is a protein that is able to generate a highly
visible emitting internal fluorophore when exposed to light in the blue ultraviolet
range [29]
. This makes it a protein that can easily be detected when it is expressed in
cells, giving information about the location of its expression.
C

appliedscience_MaasBP_vj14_280441

appliedscience_MaasBP_vj14_280441

Recommended

Recommended

More Related Content

What's hot

What's hot (19)

Viewers also liked

Viewers also liked (11)

Similar to appliedscience_MaasBP_vj14_280441

Similar to appliedscience_MaasBP_vj14_280441 (20)

appliedscience_MaasBP_vj14_280441