The document summarizes the targeted disruption of the citrinin synthase gene in Monascus purpureus through Agrobacterium tumefaciens-mediated transformation. Key steps include construction of targeting vectors containing homologous regions of the citrinin synthase gene for homologous recombination, transformation of M. purpureus conidia using A. tumefaciens, and selection of transformants using hygromycin resistance. Analysis by PCR, Southern blotting, and two-dimensional electrophoresis confirmed disruption of the citrinin synthase gene.
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
20081217 04嘉曉勤 根瘤農桿菌介導敲除紫色紅麴菌桔黴素合成基因
1. Jia Xiaoqin Zhejiang University of Technology 嘉晓勤 浙江工业大学 Agrobacterium tumefaciens -mediated Disruption of Citrinin Synthase Gene in M. purpureus
2. Targeted Mutagenesis in Eukaryotes 10 -2 More than 1 Kb 70 M ~ 230 M 10 -4 ~ 10 -5 More than 1 Kb, up to 22 kb 70 M ~ 120,000 M 0.5~30% More than 1 kb 30 ~ 40 M 50-100% 50 –100 bp 13.5 M Targeted integration efficiency Homologous DNA-flanking regions Genomic DNA Eukaryote Yeast Filamentous fungus Plant Mammal
3. 1) Protoplasts transformation a. Transformation of protoplasts using electroporation, or by a combination of CaCl 2 and polyethylene glycol (PEG). b. Preparation of intact protoplasts is a tedious process; Regeneration of the protoplasts back to mycelial cultures is very problematic. 2) Biolistic transformation a. Transformation of spores or hyphae by tungsten or gold particles coated with DNA, which are accelerated through high velocity microprojectiles b. The particle bombardment results in integration of DNA sequences as multiple copies. 3) Agrobacterium tumefaciens -mediated transformation (ATMT) a. Transformation of conidia or protoplasts by transferring T-DNA, part of its tumor-inducing (Ti) plasmid, to fungal cells. b. Ease of use, high efficiency and high percentage of single T-DNA insertion Filamentous Fungal Transformation Methodology
4. IM, bacterial inner membrane; NPC, nuclear pore complex; OM, bacterial outer membrane; PP, bacterial periplasm. A Model for Molecular Interactions during ATMT of Plant Cells
5. 1. Citrinin synthase gene (NCBI: AB167465, pksCT ) pksCT 2. Citrinin synthase (Type I fungal polyketide synthase) Citrinin Synthase in M. purpureus Genomic DNA Gene 1 KS 413 aa AT 294 aa PP 64 aa DREV 157 aa Epimerase 288 aa 2584 aa NAD dependent epimerase/dehydratase family 2213 ... 2500 Epimerase (DH) DREV methyltransferase 1938 ...>2094 DREV (ME) Phosphopantetheine attachment site 1660 ... 1723 PP Acyl transferase domain 906 ... 1199 AT Polyketide synthase (PKS) 383 ... 795 KS Region_name Region Note 5΄ 3΄ 1 9269 1K 2K 3K 4K 5K 6K 7K 8K 9K 7754
12. pL1 Construction of Targeting Vector: (I) pDBJ051 pDH2857 pL1 - digestion 10K bp--- 4K bp--- 2K bp--- 1K bp--- 500 bp--- pDH2857 - digestion Hind III Sal I H + S Hind III Sal I H + S 5΄ 9269 1K 2K 3K 4K 5K 6K 7K 8K 9K 3΄ CTR PCR T trp hph P mgpd pDH2857 5,572 bp T trp hph P mgpd pDBJ051 6,170 bp CTR
14. Construction of Targeting Vector: (II) pDBJ052 pL2 pL1 pL2 - digestion 10K bp--- 4K bp--- 2K bp--- 1K bp--- 500 bp--- pL1 - digestion Sac I Kpn I S + K Sac I Kpn I S + K CTL PCR T trp hph P mgpd pDBJ051 6,170 bp CTR T trp hph P mgpd pDBJ052 7,598 bp CTR CTL 5΄ 9269 1K 2K 3K 4K 5K 6K 7K 8K 9K 3΄
17. Binary vector Construction of Targeting Vector: (III) pDBJ053 Binary plasmid Agrobacterium CTL hph CTR CTL hph CTR RB LB aadA pCAMBIA0380 6,812 bp T trp hph P mgpd CTR CTL RB aadA LB pDBJ053 11,785 bp T trp hph P mgpd pDBJ052 7,598 bp CTR CTL A. tumefaciens AGL1 A. tumefaciens chromosome Ti plasmid
18. Effect of AS Concentration & Membrane on ATMT Transformation Efficiency 400 mM 300 mM 200 mM 100 mM 0 mM AS concentration in Pre-cultivation medium 0 mM Acetosyringone (AS) in the IM agar plate 8 9 11 7 0 Cellulose ester membrane 12 9 6 5 0 Nylon membrane 2 0 0 3 0 Filter paper 10 10 14 7 4 Filter paper 7 5 4 4 5 Nylon membrane 18 25 32 41 48 Cellulose ester membrane 200 mM Acetosyringone (AS) in the IM agar plate Number of transformants
19. Hygromycin Resistant for SM001 & Transformants a: Colony diameter in mm of 5 day cultures, means of three duplicate cultures. 19.3 25 10.0 50 100 12.5 6.25 0 - 19.4 20.4 23.7 M. purpureus SM001 (mm) Colony growth a on CM with hygromycin B at mg/l concentration of 22.0 22.3 22.8 23.0 23.0 23.1 M. purpureus Transformant (mm) 1000 900 800 700 600 500 22.0 200 21.9 300 400 125 100 0 21.9 21.9 22.0 22.0 M. purpureus Transformant (mm) Colony growth a on CM with hygromycin B at mg/l concentration of
20. PCR Production for Different Types of Transformant 〓 : positive ○: negative ○ ○ ○ 〓 〓 〓 Elsewhere ○ 〓 ○ 〓 〓 〓 Insertion type II 〓 ○ 〓 〓 〓 〓 Insertion type I ○ 〓 〓 ○ 〓 〓 Replacement ○ ○ ○ 〓 ○ 〓 Wild type 9/10 (left I) 7/8 (R-border) 5/6 (L-border) 3/4 (cit) 1/2 ( hph ) a/b (P mgpd 1) Control Replacement Insertion type I Insertion type II Elsewhere a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 a/b 1/2 3/4 5/6 7/8 9/10 0.6 kb 1.6 kb 1.1 kb 0.9 kb 0.7 kb
21. *Type, Replacement : Insertion type I : Insertion type II : Elsewhere **HR(homologous recombination): Replacement + Insertion type I + Insertion type II ; NHR: Elsewhere PCR Analysis of T-DNA Integration Event (I) 0mM AS in the IM agar plate for co-cultivation 50 : 50 - - 0 : 100 - HR(%) vs. NHR(%) 0 : 0 : 1 : 1 0 0 0 : 0 : 0 : 3 0 Type Filter paper 25 : 75 56 : 44 50 : 50 20 : 80 - HR(%) vs. NHR(%) 1 : 0 : 2 : 9 2 : 0 : 3 : 4 1 : 0 : 2 : 3 1 : 0 : 0 : 4 0 Type Nylon 50 : 50 44 : 56 54 : 36 57 : 43 - HR(%) vs. NHR(%)** 1 : 0 : 3: 4 1 : 1 : 2 : 5 2 : 1 : 4 : 4 1 : 0 : 3 : 3 0 Type * Cellulose ester 400 mM 300 mM 200 mM 100 mM 0 mM AS concentration in A. tumefaciens pre-cultivation medium Membrane filter
22. (II) 200mM AS in the IM agar plate for co-cultivation *Type, Replacement : Insertion type I : Insertion type II : Elsewhere **HR(homologous recombination): Replacement + Insertion type I + Insertion type II ; NHR: Elsewhere PCR Analysis of T-DNA Integration Event (II) 200mM AS in the IM agar plate for co-cultivation 70 : 30 50 : 50 71 : 29 71 : 29 50 : 50 HR(%) vise NHR(%) 2 : 2 : 3 : 3 4 : 0 : 1 : 5 2 : 1 : 7 :4 2 : 1 : 2 : 2 1 : 0 : 1 : 2 Type Filter paper 43 : 57 40 : 60 50 : 50 50 : 50 60 : 40 HR(%) vise NHR(%) 1 : 0 : 2 : 4 0 : 0 : 2 : 3 0 : 0 : 2 : 2 0 : 0 : 2 : 2 0 : 0 : 3 : 2 Type Nylon 50 : 50 64 : 36 72 : 28 54 : 46 27 : 73 HR(%) vise NHR(%) 5 : 1 : 3 : 9 13 : 0 : 3 : 9 11 : 1 : 11 : 9 7 : 4 : 11 : 19 3 : 1 : 9: 35 Type Cellulose ester 400 mM 300 mM 200 mM 100 mM 0 mM AS concentration in A. tumefaciens pre-cultivation medium Membrane filter
23. Southern Blot Analysis of Transgenic Fungus CT: parent strain ( M. purpureus SM001) R1, R2, R3: putative gene recombination type I1, I2, I3: putative insertion type I I4, I5, I6: putative insertion type II E1, E2, E3, E4: putative elsewhere insertion type probe CTR CTL Pm gpd hph T trp LB RB T-DNA (kb) 12.0 7.0 6.0 5.0 2.0 1.6 CT R1 R2 R3 I1 I2 I3 I5 I6 I7 E1 E2 E3 E4
24. Sequence Analysis of Junction of Targeted Event Saccharomyces cerevisiae …… CTATCAGTGTTTGACAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGC …… Sequeence of transformant …… CTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAAAGAGCGTTTA RB plasmid TGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGC … LB plasmid fusion 5΄ CTL Pm gpd hph CTR T trp LB RB 3΄ T-DNA LB CTL Pm gpd hph CTR T trp RB CTL T trp Pm gpd hph CTR Junction fragment
26. A: M. purpureus SM001 (parent strain) B : Transformant K10 (recombination) C : Transformant A4 (elsewhere insertion) D : Transformant F4 (Insertion type I) E : Transformant C8 (Insertion type II) 2-D Electrophoresis of Proteins from M. purpureus D M pH 10 3 E M pH 10 3 A pH 10 3 M B M pH 10 3 C pH 10 3 M
27. Matched Comparison of Proteome Image matching by ImageMaster 2D platinum software, version 6.0 B : Transformant K10 (recombination) A: M. purpureus SM001 (parent strain)
28. HPLC Analysis of SM001 & Mutants Fermented Rice ① Parent strain SM001 Solution ①: standard=3:1 A B Transformant (recombination type) Transformant (Insertion type I) C D Transformant (Insertion type II) Transformant (Elsewhere Insertion) E F
29. 1. Agrobacterium tumefaciens (AGL1-pDBJ053) was used to transform the spore of M. purpureus to disrupt the pksCT gene (citrinin polyketide synthase) by homologous recombination with hygromycin B resistance selection marker. 2. The transformation is effected by acetosyringone concentration and support membrane of the medium. Nitrocellulose membrane showed more efficency than nylon and filters paper in most condition. 3. Different Monascus transformant types have been assessed by conidia PCR. Most gene insertion events utilized the longer region of homology. 4. Southern blot analysis of transformants indicated that those strains had a single-copy hph transgene sequence insertion in the genome. 5. Those transformants retained the hygromycin-resistant phenotype during five vegetative life cycles. Conclusion