Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
1
DNA-free genome editing
with CRISPR enzymes
Sunghwa Choe
Seoul National University
Thursday, 27 June, 2018
14:20 - 14:40...
2
Gene discovery by T-DNA random mutagenesis
3
Functional genomics with random mutagenesis
T-DNA tagging methods
4
Evolution of site-specific genome editing
ZFN, TALEN, Cas9
ZFN (Zinc Finger Nuclease)
TALEN (Transcription Activator-Lik...
5
Conventional way of CRISPR/Cas9 genome editing
6
Why DNA-free genome editing?
From deregulation to non-regulation
7
CRISPR/Cas9 ribonucleoprotein rather than DNA
in vitro assembly of functional CRISPR/Cas9
Cas9 effector protein single g...
8
Procedures to prepare CRISPR enzymes
Purification of the CRISPR/Cas9 and Cas9 Plus
[HiTrap Ni-chelating profile]
CRISPR/...
9
Procedures to prepare CRISPR enzymes
sgRNA preparation and holoenzyme
10
Scheme of DNA-free genome editing
11
What genes to edit?
Arabidopsis brassinosteroid mutants
12
556
187 244 165
Does RNP of Cas9-sgRNA enter and edit protoplasts?
(-) 20 60 (-) 20 60
Day 1 Day 3
(ug/200ul)
T7E1 (+)
...
13
Did the double target method work to delete the intervening DNA?
TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGCGGTGGCTAT...
14
Are other loci of the Arabidopsis genome accessible?
PhyB
- +
COI1
- +
Protoplast 1*10^5 cell
Cas9 protein 20 mg (final...
15
Off-target effects are negligible in Arabidopsis
16
Do the assembled RNPs work for rice protoplasts?
DWD1
3-1 3-2 3-3
CYP724
3-1 3-2 3-3
5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGCA...
17
Does the Cas9-sgRNA complex work in lettuce?
Arabidopsis BIN2
(brassinosteroid insensitive2):
gain-of-function mutants
...
18
Ribonucleoproteins (RNPs) – mediated genome editing followed by lettuce plant
regeneration
1 2 3
4 5 6
19
Regeneration of plantlets after GE in lettuce
Growth and Division of lettuce Protoplasts
(LsBIN2 (RG4) editing line) (D...
20
Regeneration of whole plants from edited protoplasts
21
Can we tell edited clones from non-edited ones?
 Yes by RNA guided endonuclease (RGEN)
Kim JM, Kim D, Kim S, Kim JS (2...
22
What are the nature of editing in the regenerating
plantlets?
WT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 ...
23
Does the biallelic heterozygous line exhibit any
phenotype?
ATCACAGTGATGCTCGT-CAAAGG WT
#24-A1 ATCACAGTGATGCTCGTTCAAAGG...
24
Germline transmission of the edited mutations
Bar = 10 cm
25
Number of potential off-target sites in the lettuce
genome (Cas-OFFinder www.regenome.net)
26
Negligible Indel frequencies at the on-target and 91
potential off-target sites
:
:
:
27
8. phyB sgRNA (ggX20) 60 mg + cas9 protein 30 mg
9. phyB sgRNA (gtX20) 60 mg + cas9 protein 30 mg
10. phyB sgRNA (gX19)...
28
Cas9 plasmid 3 mg + sgRNA plasmid 3 mg
CACTAGGAGCAACACCC-----------------------------------AACGGG WT
CACTAGGAGCAACACCTG...
29
DNA-free genome editing procedure
30
Comparison of different genome editing methods
31
Comparison of different genome editing methods
Comparison
Way of CRISPR/Cas delivery
Transgenic Transient
T-DNA DNA mRN...
32
Pros and cons of the DNA-free RNP method in plants
• Pros
• Cas9 protein expression and sgRNA processing in vivo not ne...
33
Working together with
• Prof. Jin-Soo Kim
• Jungeun Kim
• Seung Woo Cho, Ph.D.
• Sang-Gyu Kim
• Je Wook Woo Seoul Natio...
Upcoming SlideShare
Loading in …5
×

Crop plants: DNA-free genome editing with CRISPR enzymes

783 views

Published on

-

Published in: Environment
  • Be the first to comment

Crop plants: DNA-free genome editing with CRISPR enzymes

  1. 1. 1 DNA-free genome editing with CRISPR enzymes Sunghwa Choe Seoul National University Thursday, 27 June, 2018 14:20 - 14:40 OECD CONFERENCE ON GENOME EDITING: APPLICATIONS IN AGRICULTURE – IMPLICATIONS FOR HEALTH, ENVIRONMENT AND REGULATION
  2. 2. 2 Gene discovery by T-DNA random mutagenesis
  3. 3. 3 Functional genomics with random mutagenesis T-DNA tagging methods
  4. 4. 4 Evolution of site-specific genome editing ZFN, TALEN, Cas9 ZFN (Zinc Finger Nuclease) TALEN (Transcription Activator-Like Effector Nuclease CRISPR/Cas9 nuclease (Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 nuclease) Fok I Fok I Fok I Fok I Yu et al., 2016. DOI: 10.5772/6433
  5. 5. 5 Conventional way of CRISPR/Cas9 genome editing
  6. 6. 6 Why DNA-free genome editing? From deregulation to non-regulation
  7. 7. 7 CRISPR/Cas9 ribonucleoprotein rather than DNA in vitro assembly of functional CRISPR/Cas9 Cas9 effector protein single guide RNA
  8. 8. 8 Procedures to prepare CRISPR enzymes Purification of the CRISPR/Cas9 and Cas9 Plus [HiTrap Ni-chelating profile] CRISPR/Cas9 CRISPR/Cas9 PLUS
  9. 9. 9 Procedures to prepare CRISPR enzymes sgRNA preparation and holoenzyme
  10. 10. 10 Scheme of DNA-free genome editing
  11. 11. 11 What genes to edit? Arabidopsis brassinosteroid mutants
  12. 12. 12 556 187 244 165 Does RNP of Cas9-sgRNA enter and edit protoplasts? (-) 20 60 (-) 20 60 Day 1 Day 3 (ug/200ul) T7E1 (+) T7E1 (-)556 312 One day treatment of 200K cells in 200 ml volume with 20 mg RNP with PEG induced indels (-) 12 30 12 30 no PEG (mg) Leaf age : 2 weeks 4 weeks Heteroduplex-specific cutting by T7E1 BRI1 (brassinosteroid insensitive 1)
  13. 13. 13 Did the double target method work to delete the intervening DNA? TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGCGGTGGCTAT........... 190 bp ..........GCTGGGGTGAAACTAAACTGGTCCACACGGCGGAAGATTGCGATAGGATCAGCTAG (wt) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGCGGTGGCTAT........... 190 bp ..........GCTGGGGTGAAACTAAA-------ACACGGCGGAAGATTGCGATAGGATCAGCTAG (-7) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCG---------------------------------------------------------------ACACGGCGGAAGATTGCGATAGGATCAGCTAG (-224) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCG--------------------------------------------------------------CACACGGCGGAAGATTGCGATAGGATCAGCTAG (-223) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCACACGGCGGAAGATTGCGATAGGATCAGCTAG (-223+62) 1. DNA spanning the 2 target sites was PCR amplified 2. Cloned into a TA-cloning vector 3. Clones were randomly selected and Sanger sequenced: 23/40 = 57.5 (%)
  14. 14. 14 Are other loci of the Arabidopsis genome accessible? PhyB - + COI1 - + Protoplast 1*10^5 cell Cas9 protein 20 mg (final concentration : 50 ng/ml) sgRNA 15 mg (final concentration : 38 ng/ml) PEG incubation condition 20 %, 15 min Total volume 400 ml 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTT-GGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG WT 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTT--GGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG -1 bp (3/10) 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTTaGGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG +1 bp (1/10) 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTTtGGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG +1 bp (4/10) 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGT--GGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG -1 bp (2/10) PhyB BRI1-TS1 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCG-CGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT WT 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGgCGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT +1 bp (1/4) 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAG---CGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT -2 bp (2/4) 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGtCGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT +1 bp (1/4) BRI1 - + + RNP
  15. 15. 15 Off-target effects are negligible in Arabidopsis
  16. 16. 16 Do the assembled RNPs work for rice protoplasts? DWD1 3-1 3-2 3-3 CYP724 3-1 3-2 3-3 5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGCACAGTGGCCCGGCCTACGACGTCAGGTTCT----ACCCGGATTCGCAGCAGC WT 5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGCACAGTGGCCCGGCCTACGACGTCAGGTTCT-//-ACCCGGATTCGCAGCAGC +33 bp(4/5) 5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGC-----------------------------T----ACCCGGATTCGCAGCAGC -29 bp(1/5) DWD1 CYP724 5’-CAGGAACCTTGCTCTAGCACTGGTCACCTCCACAAAGCTCAAGCCCAGCTACCTTGGCGACATTGAGAAGATTGCACTGCATATAGTTGGGTCATGGCATGGCAAGAGCAAGG WT 5’-CAGGAACCTTGCTCTAGCACTGGTCACCTCCACAAAGCTCAAGCCCAGCTACCTTGGCGACATTGAGAAGATTGCACTGCATATAGTTGGGTCAT-GCATGGCAAGAGCAAGG -1bp (2/2) Protoplast 3*10^4 cell Cas9 protein 20 mg (final concentration : 50 ng/ml) sgRNA 15 mg (final concentration : 38 ng/ml) PEG incubation condition 20 %, 15 min Total volume 400 ml
  17. 17. 17 Does the Cas9-sgRNA complex work in lettuce? Arabidopsis BIN2 (brassinosteroid insensitive2): gain-of-function mutants WT het homo T7E1 Ctrl 1 2 3 4 5 * (culture) sgRNA (ug) 0 5 10 20 40 80 CAS9 (ug) 0 2.5 5 10 20 40 Indel (%) 10 14 8 11 LsBIN2 5’-AATTTTTCGGGTTTTAAAGCATCACAGTGATGCTCGTCAAAGGATGCCTCTCAT |||||||||||||||||||||||||||||||||||||||||||||||||||||| 3’-TTAAAAAGCCCAAAATTTCGTAGTGTCACTACGAGCAGTTTCCTACGGAGAGTA LsBIN2-RG4
  18. 18. 18 Ribonucleoproteins (RNPs) – mediated genome editing followed by lettuce plant regeneration 1 2 3 4 5 6
  19. 19. 19 Regeneration of plantlets after GE in lettuce Growth and Division of lettuce Protoplasts (LsBIN2 (RG4) editing line) (Deep sequencing analysis : NGS)
  20. 20. 20 Regeneration of whole plants from edited protoplasts
  21. 21. 21 Can we tell edited clones from non-edited ones?  Yes by RNA guided endonuclease (RGEN) Kim JM, Kim D, Kim S, Kim JS (2014) Genotyping with CRISPR-Cas-derived RNA-guided endonucleases. Nature Commu 5: 3157 Arrows: cut Red: deletion Yellow: insertion PCR Digestion Run
  22. 22. 22 What are the nature of editing in the regenerating plantlets? WT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 ATCACAGTGATGCTCGT-CAAAGG WT #08 ATCACAGTGATGCTCGTTCAAAGG +1 #09 ATCACAGTGATGCTCGTTCAAAGG +1 #10-A1 ATCACAGTGATGCT----CAAAGG -3 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 #11-A1 ATCACAGT----------CAAAGG -9 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 ATCACAGTGATGCTCGT-CAAAGG WT #12 ATCACAGTGATGCTCGTTCAAAGG +1 #14-A1 ATCACAGT----------CAAAGG -9 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 #18-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #20-A1 ATCACAGTGATGCTCGT---AAGG -2 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 #21-A1 ATCACAGTGATGCTCGTTCAAAGG +1 ATCACAGTGATGCTCGT-CAAAGG WT #24-A1 ATCACAGTGATGCTCGTTCAAAGG +1 -A2 ATCACAGTGATGCTCG--CAAAGG -1 #25-A1 ATCACAGTGATGCTCGTTCAAAGG +1 -A2 ATCACAGTGATGCTCGT-CAAAGG WT #29-A1 ATCACAGTG-------T-CAAAGG -7 -A2 ATCACAGTGATGCTCGT-CAAAGG WT #30-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #31-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #33-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #34-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #28 (WT) #24 (bi-allelic) #30 (bi-allelic , homo) -RGEN +RGEN
  23. 23. 23 Does the biallelic heterozygous line exhibit any phenotype? ATCACAGTGATGCTCGT-CAAAGG WT #24-A1 ATCACAGTGATGCTCGTTCAAAGG +1 -A2 ATCACAGTGATGCTCG--CAAAGG -1 #26 (WT) ATCACAGTGATGCTCGT-CAAAGG
  24. 24. 24 Germline transmission of the edited mutations Bar = 10 cm
  25. 25. 25 Number of potential off-target sites in the lettuce genome (Cas-OFFinder www.regenome.net)
  26. 26. 26 Negligible Indel frequencies at the on-target and 91 potential off-target sites : : :
  27. 27. 27 8. phyB sgRNA (ggX20) 60 mg + cas9 protein 30 mg 9. phyB sgRNA (gtX20) 60 mg + cas9 protein 30 mg 10. phyB sgRNA (gX19) 60 mg + cas9 protein 30 mg Indels (%) NGS 0.020 0.046 0.021 1.7 4.6 4.5 4.2 27 8.7 48 1 2 3 4 5 6 7 8 9 10 12 hours ** Indels (%) NGS 0.0066 0.042 0.016 4.0 9.6 9.6 9.5 36 14 49 1 2 3 4 5 6 7 8 9 10 24 hours ** Plasmid DNA method RNP method 1. Control (PEG treatment only) 2. 35Sp-cas9 plasmid only 12 mg 3. U626p-phyB sgRNA plasmid only 12 mg 4. 35Sp-cas9 plasmid 3 mg + U626p-phyB sgRNA plasmid 3 mg 5. 35Sp-cas9 plasmid 6 mg + U626p-phyB sgRNA plasmid 6 mg 6. 35Sp-cas9 plasmid 12 mg + U626p-phyB sgRNA plamisd 12 mg 7. 35Sp-cas9 plasmid 24 mg + U626p-phyB sgRNA plamisd 24 mg 2*105 cell RNP method Comparison of RNP vs DNA methods: time course efficiency
  28. 28. 28 Cas9 plasmid 3 mg + sgRNA plasmid 3 mg CACTAGGAGCAACACCC-----------------------------------AACGGG WT CACTAGGAGCAACACCTGATGATCAGGTCCTTCTTCACCTCCTTGTAGCCCTAACGGG + 35bp (2/90518) DNA vs RNP method: Unwanted DNA integration issue
  29. 29. 29 DNA-free genome editing procedure
  30. 30. 30 Comparison of different genome editing methods
  31. 31. 31 Comparison of different genome editing methods Comparison Way of CRISPR/Cas delivery Transgenic Transient T-DNA DNA mRNA RNP Mutation efficiency ++ ++ + +++ Specificity + + + ++ Duration 10-16 weeks 6-8 weeks 6-8 weeks 6-8 weeks Foreign DNA integration Yes Yes/No No Never Antibiotic selection Yes No No No
  32. 32. 32 Pros and cons of the DNA-free RNP method in plants • Pros • Cas9 protein expression and sgRNA processing in vivo not needed • No foreign DNA remained in the genome • Homozygous mutant for multiple genes at single generation • Cons • Possibility of accompanying somaclonal variation during tissue culture • Difficulty regeneration of whole plants from some crop protoplasts like maize and soybean • Safe and efficient delivery of RNPs
  33. 33. 33 Working together with • Prof. Jin-Soo Kim • Jungeun Kim • Seung Woo Cho, Ph.D. • Sang-Gyu Kim • Je Wook Woo Seoul National University • Soon Il Kwon , Ph.D. • Claudia Corvalán • Jongjin Park G+FLAS LIFE SCIENCES • Sunmee Choi

×