AlgorithmTime ComplexitySpace ComplexityFeaturesLinear Searc.pdf

•

0 likes•2 views

rdtraders2007

Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide-and-conquer Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide-and-conquer Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive Solution Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide-and-conquer Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide.

Education

Time: Linear Time
Space: Constant time
Memory: not & in-place both variants
Feature: largest element has bubbled to the top of the array
Merge Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: not
Feature: divide-and-conquer
Quick Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: In-place
Feature: divide-and-conquer,recursive
Algorithm
Time Complexity
Space Complexity
Features
Linear Search
O(n)
O(1)
Time: Linear time
Space: Constant time
Memory: In-place
Feature: sequential search, brute-force search
Binary Search
O(log n)
O(1)
Time: Logarithmic Time
Space: Constant time
Memory: not
Feature: divide-and-conquer

Selection Sort
O(n^2)
O(1)
Time: Quadratic Time
Space: Constant time
Memory: In-place
Feature: not stable
Insertion Sort
O(n)
O(1)
Time: Linear Time
Space: Constant time
Memory: In-place
Feature: sequential search
Bubble Sort
O(n)
O(1)
Time: Linear Time
Space: Constant time
Memory: not & in-place both variants
Feature: largest element has bubbled to the top of the array
Merge Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: not
Feature: divide-and-conquer
Quick Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: In-place
Feature: divide-and-conquer,recursive

Solution
Algorithm
Time Complexity
Space Complexity
Features
Linear Search
O(n)
O(1)
Time: Linear time
Space: Constant time
Memory: In-place
Feature: sequential search, brute-force search
Binary Search
O(log n)
O(1)
Time: Logarithmic Time
Space: Constant time
Memory: not
Feature: divide-and-conquer
Selection Sort
O(n^2)
O(1)
Time: Quadratic Time
Space: Constant time
Memory: In-place
Feature: not stable
Insertion Sort
O(n)
O(1)
Time: Linear Time
Space: Constant time
Memory: In-place
Feature: sequential search
Bubble Sort
O(n)

O(1)
Time: Linear Time
Space: Constant time
Memory: not & in-place both variants
Feature: largest element has bubbled to the top of the array
Merge Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: not
Feature: divide-and-conquer
Quick Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: In-place
Feature: divide-and-conquer,recursive
Algorithm
Time Complexity
Space Complexity
Features
Linear Search
O(n)
O(1)
Time: Linear time
Space: Constant time
Memory: In-place
Feature: sequential search, brute-force search
Binary Search
O(log n)
O(1)
Time: Logarithmic Time
Space: Constant time
Memory: not

Feature: divide-and-conquer
Selection Sort
O(n^2)
O(1)
Time: Quadratic Time
Space: Constant time
Memory: In-place
Feature: not stable
Insertion Sort
O(n)
O(1)
Time: Linear Time
Space: Constant time
Memory: In-place
Feature: sequential search
Bubble Sort
O(n)
O(1)
Time: Linear Time
Space: Constant time
Memory: not & in-place both variants
Feature: largest element has bubbled to the top of the array
Merge Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: not
Feature: divide-and-conquer
Quick Sort
O(n log (n))
O(n)
Time: Linearithmic time
Space: Linear time
Memory: In-place
Feature: divide-and-conquer,recursive

More from rdtraders2007

SolutionSolutionSolution.pdf

rdtraders2007

slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf

rdtraders2007

s(s^2-b^2)Solutions(s^2-b^2).pdf

rdtraders2007

Question not visible. Please update the question and then i can answ.pdf

rdtraders2007

Please find the required program along with the comments against each line, also find the output at last : #include #include #include #include using namespace std; void listCodonPositions(string dna, string codon){ vector positions; // holds all the positions that codon occurs within dna size_t pos = dna.find(codon, 0); // finds the first occurance of codon if(pos != string::npos) //if no codon is found cout << pos << \" \" << flush; else cout << \"No occurance\" << flush; while(pos != string::npos) //iterate till no occurance is found in a dna { pos = dna.find(codon,pos+1); //find next occurance if(pos != string::npos) //if no codon is found cout << pos << \" \" << flush; } cout << endl; } int main() { string humanDNA = \"CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTG TCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAGCTGAGCACTGGAGTGGAG TTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATG\"; string mouseDNA = \"CGCAATTTTTACTTAATTCTTTTTCTTTTAATTCATATATTTTTAATATGTTTACTAT TAATGGTTATCATTCACCATTTAACTATTTGTTATTTTGACGTCATTTTTTTCTATTTC CTCTTTTTTCAATTCATGTTTATTTTCTGTATTTTTGTTAAGTTTTCACAAGTCTAATA TAATTGTCCTTTGAGAGGTTATTTGGTCTATATTTTTTTTTCTTCATCTGTATTTTTAT GATTTCATTTAATTGATTTTCATTGACAGGGTTCTGCTGTGTTCTGGATTGTATTTTTC TTGTGGAGAGGAACTATTTCTTGAGTGGGATGTACCTTTGTTCTTG\"; string unknownDNA = \"CGCATTTTTGCCGGTTTTCCTTTGCTGTTTATTCATTTATTTTAAACGATATTTATAT CATCGGGTTTCATTCACTATTTTTCTTTTCGATAAATTTTTGTCAGCATTTTCTTTTAC CTCTTCTTTCTGTTTATGTTAATTTTCTGTTTCTTAACCCAGTCTTCTCGATTCTTATCT ACCGGACCTATTATAGGTCACAGGGTCTTGATGCTTTGGTTTTCATCTGCAAGAGTCT GACTTCCTGCTAATGCTGTTCTGTGTCAGGGTGCATCTGAGCACTGATGTGGAGTTTT CTTGTGGATATGAGCCATTCATAGTGTGGGATGTGCCATAGTTCATG\"; string codon; cout << \"Enter codon : \" << endl; cin >> codon; char exit[] = \"*\"; while(strcmp(codon.c_str(),exit)!=0){ cout << \"Occurances in humanDNA : \"<< endl; listCodonPositions(humanDNA,codon); cout << \"Occurances in mouseDNA : \"<< endl; listCodonPositions(mouseDNA,codon); cout << \"Occurances in unknownDNA : \"<< endl; listCodonPositions(unknownDNA,codon); cout << \"Enter codon : \" << endl; cin >> codon; } } -------------------------------------------------------------------------------- OUTPUT : Enter codon : AAA Occurances in humanDNA : 3 43 Occurances in mouseDNA : No occurance Occurances in unknownDNA : 43 91 Enter codon : TGC Occurances in humanDNA : 8 22 31 52 95 141 208 224 248 258 266 310 Occurances in mouseDNA : 269 Occurances in unknownDNA : 8 22 208 224 242 248 266 326 Enter codon : * Solution Please find the required program along with the comments against each line, also find the output at last : #include #include #include #include using namespace std; void listCodonPositions(string dna, string codon){ vector positions; // holds all the positions that codon occurs within dna size_t pos = dna.find(codon, 0); // finds the first oc.

Please find the required program along with the comments against eac.pdf

rdtraders2007

Order the steps of the viral life cycle. 1. viral entry into host 2. disassembly of virus 3. replication of virus 4. transcription of virus 5. assembly of new viral units 6. release of new virus Order these human vaccines by year of introduction from earliest to most recent. 1. Smallpox - 1796 2. plague - 1890 3. tetanus - 1930 4. polio - 1955 5. rubella - 1963 Question 10. Gamma rays and X rays are ionizing radiations Question 13. The disadvantages of intravenous injection for drug administration are: Risk of overdose Risk of infection Solution Order the steps of the viral life cycle. 1. viral entry into host 2. disassembly of virus 3. replication of virus 4. transcription of virus 5. assembly of new viral units 6. release of new virus Order these human vaccines by year of introduction from earliest to most recent. 1. Smallpox - 1796 2. plague - 1890 3. tetanus - 1930 4. polio - 1955 5. rubella - 1963 Question 10. Gamma rays and X rays are ionizing radiations Question 13. The disadvantages of intravenous injection for drug administration are: Risk of overdose Risk of infection.

Order the steps of the viral life cycle.1. viral entry into host.pdf

rdtraders2007

Listing of the type of alleles present in an organisms cell Genotype The allele for polydactylism (extra finger or toe) is expressed to different digrees in different individuals that have it Variable expressivity Height in humans is determined by the interaction of genes on different loci Polygenic inheritance Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB Codominance All the genes in a cell of organism Genome Solution Listing of the type of alleles present in an organisms cell Genotype The allele for polydactylism (extra finger or toe) is expressed to different digrees in different individuals that have it Variable expressivity Height in humans is determined by the interaction of genes on different loci Polygenic inheritance Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB Codominance All the genes in a cell of organism Genome.

Listing of the type of alleles present in an organisms cellGenotyp.pdf

rdtraders2007

An Operating System (OS) is an interface between a computer user and computer hardware. An operating system is a software which performs all the basic tasks like file management, memory management, process management, handling input and output. The kernel is a used for operating system need to be protected from user programs to maintain the proper operation of the computer system .The kernel is a computer program that constitutes the central core of a computer\'s operating system. It has complete control over everything that occurs in the system.As such, it is the first program loaded on startup, and then manages the remainder of the startup, as well as input/output requests from software, translating them into data processing instructions for the central processing unit. kernel is usually loaded into a protected area of memory, which prevents it from being overwritten by other, less frequently used parts of the operating system or by applications. The kernel performs its tasks, such as executing processes and handling interrupts, in kernel space, whereas everything a user normally does, such as writing text in a text editor or running programs in a GUI, is done in user space. This separation prevents user data and kernel data from interfering with each other and thereby diminishing performance or causing the system to become unstable. Solution An Operating System (OS) is an interface between a computer user and computer hardware. An operating system is a software which performs all the basic tasks like file management, memory management, process management, handling input and output. The kernel is a used for operating system need to be protected from user programs to maintain the proper operation of the computer system .The kernel is a computer program that constitutes the central core of a computer\'s operating system. It has complete control over everything that occurs in the system.As such, it is the first program loaded on startup, and then manages the remainder of the startup, as well as input/output requests from software, translating them into data processing instructions for the central processing unit. kernel is usually loaded into a protected area of memory, which prevents it from being overwritten by other, less frequently used parts of the operating system or by applications. The kernel performs its tasks, such as executing processes and handling interrupts, in kernel space, whereas everything a user normally does, such as writing text in a text editor or running programs in a GUI, is done in user space. This separation prevents user data and kernel data from interfering with each other and thereby diminishing performance or causing the system to become unstable..

An Operating System (OS) is an interface between a computer user and.pdf

rdtraders2007

Internal Evidence General Ledger Files canceled Payrolled Checks Payroll time records Receiving Reports Minutes of the Board of Directors Cancelled Notes Payable External Evidence Vendors Invoices Bank Statements Purchase Requisitions Remittance Advices Signed Leased Agreements Duplicate Copies of bills of Lading Notes Receivable External Evidence are more reliable than the internal evidences because External evidences are the evidences which we gets from the third party there is no involvement of the management or employee of the organisations. Internal Evidences are prepared internally within the organisation and the chances of manipulation in internal evidences are more than the external evidences. Solution Internal Evidence General Ledger Files canceled Payrolled Checks Payroll time records Receiving Reports Minutes of the Board of Directors Cancelled Notes Payable External Evidence Vendors Invoices Bank Statements Purchase Requisitions Remittance Advices Signed Leased Agreements Duplicate Copies of bills of Lading Notes Receivable External Evidence are more reliable than the internal evidences because External evidences are the evidences which we gets from the third party there is no involvement of the management or employee of the organisations. Internal Evidences are prepared internally within the organisation and the chances of manipulation in internal evidences are more than the external evidences..

Internal Evidence General.pdf

rdtraders2007

In reaction # 3 either the cis or trans diol may be used as a reactant. These isomers are rapidly interconverted under the rearrangement conditions, indicating that the initial water loss is reversible; a result confirmed by isotopic oxygen exchange. The clear preference for a methylene group shift versus a methyl group shift may reflect inherent migratory aptitudes, or possibly group configurations in the 3º-carbocation intermediate. In the conformation shown here both methyl and methylene groups may shift, or an epoxide ring may be formed reversibly. An alternative chair-like conformation having an equatorial methyl group should be more stable, but would not be suitable for a methyl shift. The predominant ring contraction is therefore understandable. Reaction # 4 is an unusual case in which a strained ring contracts to an even smaller ring. Phenyl groups generally have a high migratory aptitude, so the failure to obtain 2,2- diphenylcyclobutanone as a product might seem surprising. However, the carbocation resulting from a phenyl shift would be just as strained as its precursor; whereas the shift of a ring methylene group generates an unstrained cation stabilized by phenyl and oxygen substituents. Conjugative stabilization of the phenyl ketone and absence of sp2 hybridized carbon atoms in the small ring may also contribute to the stability of the observed product. Finally, reaction # 5 clearly shows the influence of reaction conditions on product composition, but explaining the manner in which different conditions perturb the outcome is challenging. Treatment with cold sulfuric acid should produce the more stable diphenyl 3º-carbocation, and a methyl group shift would then lead to the observed product. The action of a Lewis acid in acetic anhydride, on the other hand, may selectively acetylate the less hindered dimethyl carbinol. In this event the acetate becomes the favored leaving group (presumably coordinated with acid), followed by a 1,2-phenyl shift. It is reported that the symmetrically substituted isomeric diol (drawn in the shaded box) rearranges exclusively by a methyl shift, but the configuration of the starting material was not stated (two diastereomers are possible). Because of the influence of other factors (above), it has not been possible to determine an unambiguous migratory order for substituents in the pinacol rearrangement. However, some general trends are discernible. Benzopinacol, (C6H5)2C(OH)C(OH)(C6H5)2, undergoes rapid rearrangement to (C6H5)3CCOC6H5 under much milder conditions than required for pinacol. Indeed, it is often the case that phenyl or other aromatic substituents adjacent to a forming carbocation will facilitate that ionization in the course of their migration to the cationic site. In non-aromatic compounds of the type (CH3)2C(OH)C(OH)RCH3, migration of R increases in the manner R = CH3 < R = C2H5 << R = (CH3)3C. Since the shifting alkyl group must carry part of the overall positive charge, alkyl substit.

In reaction # 3 either the cis or trans diol may .pdf

rdtraders2007

Intermolecular forces exist between molecules and influence the physical properties. We can think of H2O in its three forms, ice, water and steam. ... However, the physical properties of H2O are very different in the three states. Solution Intermolecular forces exist between molecules and influence the physical properties. We can think of H2O in its three forms, ice, water and steam. ... However, the physical properties of H2O are very different in the three states..

Intermolecular forces exist between molecules and.pdf

rdtraders2007

H2 concentration will decrease and H2O concentrat.pdf

rdtraders2007

elemental form of sodium and hydrogen is very rea.pdf

rdtraders2007

C. Both A and B are correct .pdf

rdtraders2007

C gained 2 hydrogen. It was reduced. It is theref.pdf

rdtraders2007

B. Li Solution B. Li .pdf

rdtraders2007

A is stronger acid because it give more H+ to sol.pdf

rdtraders2007

Error message number = int(input(Enter a number )) Name.pdf

rdtraders2007

Dear,The answer is .7.SolutionDear,The answer is .7..pdf

rdtraders2007

Crayfish contain an exoskeleton which means it needs to get rid of it in order to grow in size. This is called molting. If the food is abundant they will molt several times quite often early in life. The crayfish hides and crawl out of its exoskeleton through a slit along its dorsal surface. It will and wait for a while until the new skeleton hardens. In preparation for molting the crayfish withdraws most of the calcium from its shell, and stores it in two white \"tablets\"in the sides of its head. An incomplete cycle of molting can be caused due to mutation in a certain transcription factor such that it could not bind to the DNA and transcribed the m RNA that encodes ecdysone. So, the answer of the above qujestion wil be Ans. C. Solution Crayfish contain an exoskeleton which means it needs to get rid of it in order to grow in size. This is called molting. If the food is abundant they will molt several times quite often early in life. The crayfish hides and crawl out of its exoskeleton through a slit along its dorsal surface. It will and wait for a while until the new skeleton hardens. In preparation for molting the crayfish withdraws most of the calcium from its shell, and stores it in two white \"tablets\"in the sides of its head. An incomplete cycle of molting can be caused due to mutation in a certain transcription factor such that it could not bind to the DNA and transcribed the m RNA that encodes ecdysone. So, the answer of the above qujestion wil be Ans. C..

Crayfish contain an exoskeleton which means it needs to get rid of i.pdf

rdtraders2007

More from rdtraders2007 (20)

SolutionSolutionSolution.pdf

slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf

s(s^2-b^2)Solutions(s^2-b^2).pdf

Question not visible. Please update the question and then i can answ.pdf

Please find the required program along with the comments against eac.pdf

Order the steps of the viral life cycle.1. viral entry into host.pdf

Listing of the type of alleles present in an organisms cellGenotyp.pdf

An Operating System (OS) is an interface between a computer user and.pdf

Internal Evidence General.pdf

In reaction # 3 either the cis or trans diol may .pdf

Intermolecular forces exist between molecules and.pdf

H2 concentration will decrease and H2O concentrat.pdf

elemental form of sodium and hydrogen is very rea.pdf

C. Both A and B are correct .pdf

C gained 2 hydrogen. It was reduced. It is theref.pdf

B. Li Solution B. Li .pdf

A is stronger acid because it give more H+ to sol.pdf

Error message number = int(input(Enter a number )) Name.pdf

Dear,The answer is .7.SolutionDear,The answer is .7..pdf

Crayfish contain an exoskeleton which means it needs to get rid of i.pdf

Recently uploaded

This PowerPoint helps students to consider the concept of infinity.

christianmathematics

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

MaritesTamaniVerdade

How to Give a Domain for a Field in Odoo 17

Celine George

How to Add New Custom Addons Path in Odoo 17

Celine George

Accessible Digital Futures project (20/03/2024)

Jisc

Application orientated numerical on hev.ppt

RamjanShidvankar

Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx

Pooja Bhuva

General Principles of Intellectual Property: Concepts of Intellectual Proper...

Poonam Aher Patil

Plant propagation: Sexual and Asexual propapagation.pptx

UmeshTimilsina1

REMIFENTANIL: An Ultra short acting opioid.pptx

Dr. Ravikiran H M Gowda

Wizards are very useful for creating a good user experience. In all businesses, interactive sessions are most beneficial. To improve the user experience, wizards in Odoo provide an interactive session. For creating wizards, we can use transient models or abstract models. This gives features of a model class except the data storing. Transient and abstract models have permanent database persistence. For them, database tables are made, and the records in such tables are kept until they are specifically erased.

How to Create and Manage Wizard in Odoo 17

Celine George

Python Notes for mca i year students osmania university.docx

Ramakrishna Reddy Bijjam

The basics of sentences session 3pptx.pptx

heathfieldcps1

Fostering Friendships - Enhancing Social Bonds in the Classroom

Pooky Knightsmith

Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...

Pooja Bhuva

Basic Civil Engineering notes first year Notes Building notes Selection of site for Building Layout of a Building What is Burjis, Mutam Building Bye laws Basic Concept of sunlight ventilation in building National Building Code of India Set back or building line Types of Buildings Floor Space Index (F.S.I) Institutional Vs Educational Building Components & function Sills, Lintels, Cantilever Doors, Windows and Ventilators Types of Foundation AND THEIR USES Plinth Area Shallow and Deep Foundation Super Built-up & carpet area Floor Area Ratio (F.A.R) RCC Reinforced Cement Concrete RCC VS PCC

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Denish Jangid

Sociology 101 Demonstration of Learning Exhibit

jbellavia9

NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...

Amil baba

Micro-Scholarship, What it is, How can it help me.pdf

Poh-Sun Goh

Key note speaker Neum_Admir Softic_ENG.pdf

Admir Softic

Recently uploaded (20)

This PowerPoint helps students to consider the concept of infinity.

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

How to Give a Domain for a Field in Odoo 17

How to Add New Custom Addons Path in Odoo 17

Accessible Digital Futures project (20/03/2024)

Application orientated numerical on hev.ppt

Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx

General Principles of Intellectual Property: Concepts of Intellectual Proper...

Plant propagation: Sexual and Asexual propapagation.pptx

REMIFENTANIL: An Ultra short acting opioid.pptx

How to Create and Manage Wizard in Odoo 17

Python Notes for mca i year students osmania university.docx

The basics of sentences session 3pptx.pptx

Fostering Friendships - Enhancing Social Bonds in the Classroom

Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Sociology 101 Demonstration of Learning Exhibit

NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...

Micro-Scholarship, What it is, How can it help me.pdf

Key note speaker Neum_Admir Softic_ENG.pdf

AlgorithmTime ComplexitySpace ComplexityFeaturesLinear Searc.pdf

1. Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide-and-conquer Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n) O(1)

2. Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide-and-conquer

3. Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive

4. Solution Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not Feature: divide-and-conquer Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n)

5. O(1) Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive Algorithm Time Complexity Space Complexity Features Linear Search O(n) O(1) Time: Linear time Space: Constant time Memory: In-place Feature: sequential search, brute-force search Binary Search O(log n) O(1) Time: Logarithmic Time Space: Constant time Memory: not

6. Feature: divide-and-conquer Selection Sort O(n^2) O(1) Time: Quadratic Time Space: Constant time Memory: In-place Feature: not stable Insertion Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: In-place Feature: sequential search Bubble Sort O(n) O(1) Time: Linear Time Space: Constant time Memory: not & in-place both variants Feature: largest element has bubbled to the top of the array Merge Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: not Feature: divide-and-conquer Quick Sort O(n log (n)) O(n) Time: Linearithmic time Space: Linear time Memory: In-place Feature: divide-and-conquer,recursive

AlgorithmTime ComplexitySpace ComplexityFeaturesLinear Searc.pdf

Recommended

Recommended

More Related Content

More from rdtraders2007

More from rdtraders2007 (20)

Recently uploaded

Recently uploaded (20)

AlgorithmTime ComplexitySpace ComplexityFeaturesLinear Searc.pdf