1. Jin Fan Kevin Guise Tobias Sommer Karin Brocki Michael Posner http://development-of-attention.net

2. A G T C

3. AGTCTCGATAT CGAT CCTCGCTCGACAGATCGA AGTCTCGATAT CGA A CCTCGCTCGACAGATCGA AGTCTCGATAT CGAA CGAA CCTCGCTCGACAGATCGA AGTCTCGATATCCTCGCTCGACAGATCGA “ snps” “ insertions, duplications” “ deletions”

6. STR Y-chr LOCUS # DYS393 14 DYS19 14 DYS391 10 DYS439 10 DYS389-1 12 DYS389-2 17 DYS388 12 DYS390 22 DYS426 11 DYS385a 15 DYS385b 16 DYS392 11 HAPLOTYPE “G” Saudi Arabia, Iraq, Iran, Pakistan

7. The “real difficulty” in understanding genetic risk factors Sizing up human height variation by Peter M Visscher Genome-wide association studies have identified many variants affecting susceptibility to disease. Now, three studies use this approach to study adult height variation in a combined sample size of approx 63,000 individuals and report a total of 54 validated variants influencing this trait. Nature Genetics 40, 489 - 490 (2008)

8. Can we deploy genetic markers as non-invasive proxies for mechanisms ? “ gain” -80 -50 DRD2 activation suppresses Cells in the resting state DRD1 activation excites Cells in the -50 mV state Coincident inputs Will drive a cell from -50 to -80 mV ACTION POTENTIALS & SYNAPTIC PLASTICITY word color response BLUE NMDA COMT DA

9. Human Attention Network Task (ANT)

10. Distribution of normalized scores for executive attention N = 200 normal adult volunteers Stimulus-Response conflict score 0 10 20 30 40 50 60 70 80 90 0.05 0.15 0.25 0.35 This group “ Slows down” during incongruent trials

11. Correlation values between twin pairs of MZ and DZ twins for each network and mean RT. _______________________________________ Twin Alerting Orienting Conflict RT _______________________________________ MZ .465 * .099 .727 ** .740 ** DZ .375 .395 * .281 .659 ** _______________________________________ Note: * p < .05; ** p < .01 Heritability Alerting Orienting Conflict RT _____________________________________________ h 2 F = 2 ( r MZ – r DZ ) .18 -.59 .89 .16 h 2 H = ( r MZ – r DZ )/ .14 -.49 .62 .24 (1 – r DZ ) ML fit: h 2 .18 .00 .72 .16

12. Fan et al., 2004

13. Dopamine Transporter Dopamine Receptor Monoamine Oxidase A COMT

14. Low DA levels High DA levels 20 30 N = VAR00002 2.00 1.00 Mean +- 1 SE VAR00001 .24 .22 .20 .18 .16 .14 .12 Conflict ratio score COMT Val 108/158 MAOA long prom. repeat COMT Met 108/158 MAOA short prom. repeat

15. Fan et al., 2003 MAOA (4-repeat) – (3-repeat) 4-repeat, LOW MA 3-repeat, Hi MA Reaction Time Diff Red = activity biased by MAOA 4-repeat allele Blue = activity biased by MAOA 3-repeat allele

16. Julie Williams and Michael C O’Donovan European Journal of Human Genetics (2006) 14, 681–689 DYX1C1 DCDC2 KIAA0319