Long-term effects of prenatal stress and diazepam on D2 receptor expression in the nucleus accumbens of adult rats

1. Neuroscience Letters 594 (2015) 133–136
Contents lists available at ScienceDirect
Neuroscience Letters
journal homepage: www.elsevier.com/locate/neulet
Research article
Long-term effects of prenatal stress and diazepam on D2 receptor
expression in the nucleus accumbens of adult rats
S. Lakehaylia,∗
, N. Saida
, M. El Khachibib
, M. El Ouahlic
, S. Nadifib
, F. Hakkoua
, A. Tazia
a
Laboratory of Pharmacology, Faculty of Medicine and Pharmacy of Casablanca, 19 Rue Tarik Bnou Ziad, Casablanca, Morocco
b
Genetics and Molecular Pathology Laboratory, Faculty of Medicine and Pharmacy of Casablanca, 19 Rue Tarik Bnou Ziad, Casablanca, Morocco
c
Sultan My Slimane University, Fac Sciences & Tecniques Beni-Mellal, Life Sciences, Morocco
h i g h l i g h t s
• Prenatal stress has long lasting effects on the dopaminergic system in the nucleus accumbens.
• Offspring from prenatally stressed dams exhibited significantly elevated Drd2 mRNA expression.
• Repeated adult diazepam exposure down-regulated Drd2 expression and prevented the effect of prenatal stress.
a r t i c l e i n f o
Article history:
Received 13 February 2015
Received in revised form 27 March 2015
Accepted 30 March 2015
Available online 1 April 2015
Keywords:
Drd2 expression
Prenatal stress
Nucleus accumbens
Mesocorticolimbic pathway
Diazepam
a b s t r a c t
Early life stress during the gestational period alters specific neuronal circuits leading to behavioral
alterations later in life. In the present study, we assessed the effects of prenatal stress and repeated
benzodiazepine administration on dopamine receptor 2 expression in the nucleus accumbens of adult
offspring.
Our results show elevated Drd2 expression levels in the nucleus accumbens (NAcc) of prenatally
stressed rats compared to control subjects, while repeated diazepam administration in adulthood down-
regulated Drd2 expression and prevented the effect of prenatal stress. These observations suggest that
prenatal stress may induce permanent alterations in the corticolimbic pathway implicated in drug-
seeking behavior.
© 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
It is well known that dopamine exerts its functions via binding
to DA receptors, which are divided into two classes (D1-like and
D2-like receptors) on the basis of their biochemical and physiolog-
ical effects [1]. The D2 receptors are the most abundant subtypes
of D2-like receptors critically involved in drug addiction and the
reward pathway [2]. Many studies have shown that stress alters
dopaminergic function and elicits specific responses depending on
the type and duration of aversive stimulation [3–5].
Benzodiazepines are some of the most commonly prescribed
medications used to treat anxiety and insomnia. Despite the
strong anxiolytic potential, chronic benzodiazepine treatment
∗ Corresponding author. Tel.: +212 22471289; fax: +212 22267091.
E-mail address: Lakehayli.sara@gmail.com (S. Lakehayli).
elicits adaptive responses in the central nervous system, seen
behaviorally as functional tolerance and physical dependence [6].
Furthermore, benzodiazepines modulate chloride ion flux through
GABAA receptor channels leading to an overall hyperpolarization
of GABA interneurons and a decrease in their activity. As a conse-
quence, a reduction in the release of GABA induces a disinhibition
of dopamine (DA) neurons and produces a strong increase in extra-
cellular DA in the mesolimbic reward circuit [7].
Based on the specific involvement of DA system in drug-seeking
behavior, it was important to evaluate the long-lasting effects of
prenatal stress on this system in adult life. In this report, we aimed
to examine whether prenatal stress exposure may have a detrimen-
tal impact on the dopamine receptor 2 expression and its response
to chronic benzodiazepine administration. We therefore, exposed
female rats to chronic stress during their last ten days of pregnancy
and measured the levels of D2-like receptors by real time PCR in
the nucleus accumbens of adult offspring.
http://dx.doi.org/10.1016/j.neulet.2015.03.065
0304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.

2. 134 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136
Table 1
Primer sequences used for semi-quantitative real-time PCR.
Gene Gene bank Primer sequences (5 –3 ) Amplification size
Hprt NM 012583.2 Fwd: GACCGGTTCTGTCATGTCG 61
Rev:ACCTGGTTCATCATCACTAATCAC
Drd2 NM 012547 Fwd AAGCGCCGAGTTACTGTCAT 111
Rev GGCAATGATACACTCATTCTGGT
2. Materials and methods
2.1. Animals
Experiments were carried out in male and female Wistar rats
(Laboratory of Pharmacology Casablanca), weighing 200–250 g.
Rats were housed three per cage and allowed free access to food and
water. Animals were handled daily for 7 days before each experi-
ment. Constant temperature (22 ± 1 ◦C) and lighting conditions (12
L:12 D cycle) were maintained in the housing room. All experiments
were approved by the Ethical Committee for biomedical research
of the Faculty of Medicine and Pharmacy of Casablanca, Morocco
(Comité d’Éthique pour la Recherche Biomédicale de Casablanca:
CERBC).
2.2. Drugs
Diazepam (Roche, Morocco), was obtained as solution
(1 g/100 ml) and diluted in 0.9% NaCl. Animals received saline (0.9%
NaCl) or drug (Diazepam: 2.5 mg/kg) injections, as appropriate in
a volume of 5 ml/kg body weight of animal.
2.3. Prenatal stress procedure
Prenatal stress was conducted as previously described [8]: Preg-
nant female rats were assigned randomly to prenatal stress (PS) and
control (Ctrl) groups. Stress was performed each day of the last ten
days of pregnancy in which the neural development of the fetus is
supposed to occur in rats [9].
Stressed dams were taken to an experimental box with a grid
floor that allowed delivering daily 80 electric shocks (0.5 mA, for
5 s, 1–2 min apart) on a random basis during 100-min sessions
carried out between 08:00 and 16:00 h. Control females were left
undisturbed in their home cages. After birth, the litter sizes were
recorded and adjusted to the same litter size (8 pups per litter).
All offspring were fostered by their own mothers. The pups were
weaned at 21 days of age and housed in groups of three per cage. A
total of 5 randomly selected litters per group was used in this study.
A maximum of three pups per litter was used for each experimental
group to avoid any litter effect [10]. The experiments were carried
out during the light phase of the light-dark cycle.
2.4. Injection treatments
Adult control (Ctrl) and PS offspring (80 days of age) were
weighed and randomly assigned to either a saline or diazepam
(DZP) group (n = 6 for each group). Saline groups received four daily
intraperitoneal (i.p) injections of NaCl 0.9%, while the DZP groups
received four daily i.p injections of diazepam (2.5 mg/kg).
2.5. Tissue collection
Adult treated and untreated rats were euthanized by decapita-
tion 24 h after the last injection. Brains were quickly removed and
placed on ice. The nucleus accumbens was dissected out from this
section, a rat brain atlas [11] being used for reference. Two coronal
cuts were made at right angles to the axis of the brain. The first
cut was made 1 mm anterior to the optic chiasma while the second
cut was 1.5 mm anterior to the first cut. The nucleus accumbens
(NAcc) was dissected, frozen on dry ice and stored at −80 ◦C until
molecular analysis.
2.6. Real-time PCR analysis
Total RNA was extracted from frozen tissues using Tri-
zol (Invitrogen) according to manufacturer’s instructions. RNA
concentration and quantified using the NanoVueTM Plus Spec-
trophotometer (GE Healthcare, UK). RNA extracts were kept frozen
until use.
For RT-PCR, cDNAs were obtained by reverse transcription from
2 ␮g of RNA using 4 ␮l of M-MLV reverse transcriptase (Invitrogen),
1 ␮l random Examer (Invitrogen), 10 nM dNTP (Invitrogen) and 1 ␮l
de RT Superscript at 200 U/␮l (Invitrogen, Morocco).
From resulting cDNAs (2 ␮l per sample), each sequence of inter-
est was amplified in a final volume of 25 ␮l of a commercial reaction
mixture, containing: 5× reaction buffer, 1.5 mM MgCl2, 50 ␮M
primers, 0.25 U Taq polymerase (BIOLINE, LONDON, UK) and 50 ng
of cDNA.
Thermal cycling parameters were: 35 cycles of DNA denatura-
tion (5 min at 95 ◦C), primer hybridization (30 s at 95 ◦C), elongation
(30 s at 72 ◦C) and a final elongation step (7 min at 72 ◦C). PCR
products were separated by electrophoresis on 2% agarose gel and
visualized by ethidium bromide staining. Each sample was ana-
lyzed in triplicate and to ensure measurements form different PCR
runs were cross-comparable. Real time PCR was performed using
real time PCR Applied Biosystem FAST 7500 apparatus and Syber
Green according to manufacturer’s protocol.
Relative quantification was used to determine fold changes
(control vs PS), using the CT method. Primer sequences are
shown in Table 1. Hprt was used as a housekeeping gene.
2.7. Statistical analysis
Data were analyzed using parametric analysis of variance
(ANOVA), with group (control vs PS) and treatment (vehicle vs
diazepam) as between-subject variables, followed by student’s t-
test. Significance was set at p < 0.05.
3. Results
As shown in Table 2, no differences in litter sizes, number of
males and females per litter and male/female ratio were found
between prenatally stressed and non-stressed animals (p > 0.05).
Two-way analysis of variance showed a significant
stress/treatment interaction (Fig 1: F(3,20) = 32.108; p < 0.001).
Table 2
Litter parameters analyzed in control and prenatally stressed litters.
Parameter Control Prenatal stress
Litter size 9.6 ± 0.74 10.2 ± 0.37
Number of males per litter 5.2 ± 0.31 5.0 ± 0.22
Number of females per litter 4.4 ± 0.51 5.2 ± 0.37
Male/female ratio 1.17 ± 0.08 0.99 ± 0.11
Data are expressed as mean ± SEM of PS (n = 10) and control (n = 10) litters.

3. S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136 135
.0
.5
1.0
1.5
2.0
2.5
Ctrl-Saline PS-Saline Ctrl-DZP PS-DZP
***
** ≠≠≠
+
DRD2relaƟveFoldchange
Fig. 1. Real-time quantitative RT-PCR analysis of the effect of prenatal stress and
diazepam (2.5 mg/kg) injections on Drd2 mRNA level in the NAcc.
Data are expressed as mean ± SEM of Drd2 levels in the NAc (n = 6 for each
group). **p < 0.01 and ***p < 0.001 vs Ctrl-Saline. +p < 0.05 vs Ctrl-DZP group, /= /= /=
p < 0.001 vs PS-Saline group.
Statistical analyses of the group means revealed a significant
upregulation of Drd2 mRNA (p < 0.001) in the NAcc of PS animals
compared with Ctrl-Saline group. Moreover, repeated exposure
to diazepam in control and prenatally stressed adult rats led to a
significant decrease in the expression of Drd2 mRNA in the NAcc
in the control rats (p < 0.01, compared with Ctrl-saline group) and
the PS-DZP treated group (p < 0.001, compared with PS-Saline
group). Strikingly, a significant downregulation of Drd2 mRNA was
observed in the NAcc of PS group treated with DZP compared to
control rats treated with the same drug.
4. Discussion
Stress exposure during early life has long been considered as
an etiological factor in psychiatric disorders and enhanced drug-
seeking behavior later in life [12–16]. These effects are mediated
by exposure to elevated levels of glucocorticoids which can readily
traverse the placental barrier and influence brain development in
utero, leading to behavioral alterations and dysfunction of specific
neural substrates [17,18,14]. We previously showed that adult rats
that had been exposed to prenatal stress display increased place
preference for the diazepam-paired side and are more sensitive to
the anxiolytic actions of benzodiazepines compared with controls
[8]. Furthermore, many studies have shown that prenatal stress
influenced dopamine receptor expression in the nucleus accum-
bens of adult offspring [19,20], which were more responsive to
stress and cocaine [21,22,14,15], suggesting that early life events
can program the mesolimbic circuit.
Since the mesolimbic dopaminergic system is strongly impli-
cated in motivational and reward aspects of addictive behaviors
[23,24], the present investigation was undertaken to determine
the long-term effects of prenatal stress exposure on D2 receptors
expression.
Our results indicate that prenatal stress induced changes in the
nucleus accumbens (NAcc) of adult offspring. Drd2 mRNA expres-
sion levels were markedly upregulated in the NAcc of prenatally
stressed rats. Moreover, repeated diazepam exposure significantly
down-regulated Drd2 expression in adult PS rats compared with
controls.
These findings are in agreement with other studies which
reported a similar increase in D2 receptors and a decrease in D3
receptors in the nucleus accumbens of adult male offspring sub-
jected to prenatal restraint stress [12]. Another study has found
similar results in Drd2 overexpression following prenatal dexam-
ethasone exposure within the NAcc of adult offspring associated
with low intra-NAcc levels of dopamine and an impoverishment
in dopaminergic inputs in the NAcc indicating a hypodopamin-
ergic state [16]. Other investigators have reported that PS rats
had reduced neuronal numbers in the NAcc and fewer dopamine
inputs from the VTA [25]. In addition, PS rats displayed a higher
DA turnover in prefrontal cortex and a lower turnover in corpus
striatum and nucleus accumbens [26,27].
All these findings suggests that the increased mRNA levels of
Drd2 in the NAc of prenatal stress exposed animals may appear
as a compensatory mechanism due to the low dopamine levels
observed in this structure. The alteration of dopaminergic system
due to the prenatal stress may provide a biochemical basis for
the behavioral abnormalities previously reported in adult rats sub-
jected to prenatal stress which demonstrate that prenatal stress
enhanced the abuse potential of benzodiazepines in the offspring
during adulthood [8].
The mesolimbic dopaminergic system is known to be involved
in motivational and reward aspects of addictive behaviors [23,24].
Furthermore, chronic administration of benzodiazepine stimulated
dopamine levels in the NAcc by reducing the inhibition of dopamin-
ergic neurons [28]. Moreover, a previous study in rats suggested
that ventral tegmental area (VTA) DA neurons are disinhibited after
diazepam injection [29]. Besides, activation of GABAA receptors by
direct administration of muscimol (GABAA receptor agonist) into
the VTA significantly increased dopamine release in the NAcc [30].
High levels of dopamine within the nucleus accumbens mediate
the rewarding effects of drug of abuse [31].
The results of the present study showed that repeated diazepam
administration down-regulated Drd2 expression in the nucleus
accumbens of PS and control animals treated with diazepam.
This down-regulation seems to be an adaptive mechanism in
response to the potential increased dopamine levels following
such treatment. Moreover, the down-regulation of D2 receptors
following diazepam administration was more marked in adult
prenatally stressed animals compared with non-stressed ani-
mals, suggesting a hypersensitivity of dopamine receptors due to
the hypo-dopaminergic state induced by prenatal stress. There-
fore, prenatal stress exposure changed the sensitivity of the
mesencephalic dopaminergic transmission to benzodiazepine in
adulthood.
Interestingly, a recent study has shown that L-DOPA admin-
istration normalized the hypodopaminergic state and the Drd2
responses to subsequent morphine and ethanol exposure of
prenatal DEX exposed animals [16] suggesting that a simple rein-
statement of dopaminergic homeostasis may prevent drug abuse
in vulnerable individuals.
More studies are needed to determine the precise mechanisms
underlying the susceptibility to later substance abuse.
5. Conclusion
In summary, we demonstrate that prenatal stress has long last-
ing effects in prenatally stressed offsprings that extend into the
adulthood. Prenatally stressed rats displayed an increased Drd2
mRNA expression levels in the nucleus accumbens which was sig-
nificantly down-regulated after repeated adult administration of
diazepam.
References
[1] J.M. Beaulieu, R.R. Gainetdinov, The physiology, signaling, and pharmacology
of dopamine receptors, Pharmacol. Rev. 63 (2011) 182–217.
[2] H.S. Bateup, E. Santini, W. Shen, S. Birnbaum, E. Valjent, D.J. Surmeier, et al.,
Distinct subclasses of medium spiny neurons differentially regulate striatal
motor behaviors, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 14845–14850.
[3] S. Puglisi-Allegra, E. Kempf, C. Schleef, S. Cabib, Repeated stressful
experiences differently affect brain dopamine receptor subtypes, Life Sci. 48
(1991) 1263–1268.

4. 136 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136
[4] S. Cabib, S. Puglisi-Allegra, F.R. D’Amato, Effects of postnatal stress on
dopamine mesolimbic system responses to aversive experiences in adult life,
Brain Res. 604 (1993) 232–239.
[5] J.M. Finlay, M.J. Zigmond, The effect of stress on central dopaminergic
neurons: possible clinical implications, Neurochem. Res. 22 (1997)
1387–1394.
[6] J.H. Woods, J.L. Katz, G. Winger, Benzodiazepines: use, abuse, and
consequences, Pharmacol. Rev. 4 (1992) 151–347.
[7] K.R. Tan, M. Brown, G. Labouèbe, C. Yvon, C. Creton, J.M. Fritschy, U. Rudolph,
C. Lüscher, Neural bases for addictive properties of benzodiazepines, Nature
463 (2010) 769–774.
[8] S. Lakehayli, N. Said, O. Battas, F. Hakkou, A. Tazi, Prenatal stress alters place
conditioning and sensitivity to benzodiazepines in adult rats, Neurosci. Lett.
591 (2015) 187–191.
[9] B. Clancy, R.B. Darlington, B.L. Finlay, Translating developmental time across
mammalian species, Neuroscience 105 (2001) 7–17.
[10] R. Chapman, J. Stern, Failure of severe maternal stress or ACTH during
pregnancy to affect emotionality of male rat offspring: implications of litter
effects for prenatal studies, Dev. Psychobiol. 12 (1979) 255–269.
[11] G. Paxinos, C. Watson, The Rat Brain, sixth ed., Elsevier academic Press,
Burlington, MA, USA, 2007.
[12] C. Henry, G. Guegant, M. Cador, E. Arnauld, J. Arsaut, M. Le Moal, J.
Demotes-Mainard, Prenatal stress in rats facilitates amphetamine-induced
sensitization and induces long lasting changes in dopamine receptors in the
nucleus accumbens, Brain Res. 685 (1995) 179–186.
[13] M. Vallée, S. Maccari, F. Dellu, H. Simon, M. Le Moal, Long term effects of
prenatal stress and postnatal handling on age-related glucocorticoid secretion
and cognitive performance: a longitudinal study in the rat, Eur. J. Neurosci. 11
(1999) 2906–2916.
[14] P.V. Piazza, M. Le Moal, Pathophysiological basis of vulnerability to drug
abuse: role of an interaction between stress, glucocorticoids, and
dopaminergic neurons, Annu. Rev. Pharmacol. Toxicol. 36 (1996) 359–378.
[15] R. Sinha, Chronic stress, drug use, and vulnerability to addiction, Ann. N.Y.
Acad. Sci. 1141 (2008) 105–130.
[16] A.J. Rodrigues, P. Leao, J.M. Pego, D. Cardona, M.M. Carvalho, M. Oliveira, et al.,
Mechanisms of initiation and reversal of drug-seeking behavior induced by
prenatal exposure to glucocorticoids, Mol. Psychiatry 17 (2012)
1295–1305.
[17] A.J. Rodrigues, P. Leao, M. Carvalho, O.F. Almeida, N. Sousa, Potential
programming of dopaminergic circuits by early life stress,
Psychopharmacology 214 (2010) 107–120.
[18] J.J. Cerqueira, J.M. Pego, R. Taipa, J.M. Bessa, O.F. Almeida, N. Sousa,
Morphological correlates of corticosteroid-induced changes in prefrontal
cortex-dependent behaviors, J. Neurosci. 25 (2005) 7792–7800.
[19] A.L. Jongen-Relo, G.J. Docter, A.J. Jonker, E. Vreugdenhil, H.J. Groenewegen, P.
Voorn, Differential effects of dopamine depletion on the binding and mRNA
levels of dopamine receptors in the shell and core of the rat nucleus
accumbens, Brain Res. Mol. Brain Res. 25 (1994) 333–343.
[20] M.A. Berger, V.G. Barros, M.I. Sarchi, F.I. Tarazi, M.C. Antonelli, Long-term
effects of prenatal stress on dopamine and glutamate receptors in adult rat
brain, Neurochem. Res. 27 (2002) 1525–1533.
[21] T.E. Kippin, K.K. Szumlinski, Z. Kapasova, B. Rezner, R.E. See, Prenatal stress
enhances responsiveness to cocaine, Neuropsychopharmacology 33 (2008)
769–782.
[22] P.V. Piazza, J.M. Deminiere, M. Le Moal, H. Simon, Factors that predict
individual vulnerability to amphetamine self-administration, Science 245
(1989) 1511–1513.
[23] G.F. Koob, N.D. Volkow, Neurocircuitry of addiction,
Neuropsychopharmacology 35 (2010) 217–238.
[24] M.J. Meaney, W. Brake, A. Gratton, Environmental regulation of the
development of mesolimbic dopamine systems: a neurobiological
mechanism for vulnerability to drug abuse? Psychoneuroendocrinology 27
(2002) 127–138.
[25] M. Carlsson, A. Carlsson, Interactions between glutamatergic and
monoaminergic systems within the basal ganglia implications for
schizophrenia and Parkinson’s disease, Trends Neurosci. 13 (1990) 272–276.
[26] S.J. Alonso, E. Navarro, C. Santana, M. Rodríguez, Motor lateralization
behavioral despair and dopaminergic brain asymmetry after prenatal stress,
Pharmacol. Biochem. Behav. 58 (2) (1997) 443–448.
[27] E. Fride, M. Weinstock, Prenatal stress increases anxiety related behavior and
alters cerebral lateralization of dopamine activity, Life Sci. 42 (1988)
1059–1065.
[28] K.R. Tan, U. Rudolph, C. Luscher, Hooked on benzodiazepines: GABAA receptor
subtypes and addiction, Trends Neurosci. 34 (4) (2011) 188–197.
[29] D.P. O’Brien, F.J. White, Inhibition of non-dopamine cells in the ventral
tegmental area by benzodiazepines: relationship to A10 dopamine cell
activity, Eur. J. Pharmacol. 142 (1987) 343–354.
[30] Z.X. Xi, E.A. Stein, Nucleus accumbens dopamine release modulation by
mesolimbic GABAA receptors-an in vivo electrochemical study, Brain Res. 798
(1998) 156–165.
[31] G.F. Koob, M. Le Moal, Drug addiction, dysregulation of reward, and allostasis,
Neuropsychopharmacology 24 (2) (2001) 97–129.