SlideShare a Scribd company logo
1 of 44
Cracking the genetic code for better
health
Francois P. Bernier, MD
Department Head and Associate Professor, Department of Medical Genetics, Cumming
School of Medicine
Section Chief, Clinical Genetics, Alberta Health Services
April 4, 2017
Francois P. Bernier
 Head and Associate Professor,
Department of Medical
Genetics, Cumming School of
Medicine
 MD from the University of
Manitoba
 Expert in the use of genomics
for novel gene discovery and
the implementation of new
technologies in health care
 Published in leading journal of
his field and is local and
national expert in the use of
genomics in precision health
Cracking the genetic code for
better health
 Cracking the Human Genome
• How did the multi billion dollar Human Genome Project result
in the promise of a routine $100 genome test?
 Genes and our Health
• How do genetic changes impact our health, and how might
the knowledge of our personal genome improve our health?
 Precision Health, Genomics and Society
• What is Precision Health, and how will genomics impact not
only our health, but also the health of our families and
communities?
What do you think?
http://www.theglobeandmail.com/news/national/time-to-lead/the-dna-
dilemma-why-science-wants-your-genome/article5921666/?from=6121976
A B
Globe and Mail Reader’s opinion
Develop, Grow, Renew, Renew,
Renew…
Cumming School of Medicine Centre
for Health Genomics and Informatics
Massively parallel Next Generation Sequencers
Nanopore sequencers
https://nanoporetech.com
Human genome sequencing
Single Gene
Many Genes Non-Genetic
Multifactorial
Genetics 101
Single Gene
Many Genes Non-Genetic
Multifactorial
Genetics 101
10%
Rare Genetics Diseases
Cystic Fibrosis
Sickle Cell
Breast Cancer
Etc
50%
Complex Genetics Diseases
High blood pressure
Depression
Autism
Cancer
Rare diseases
 Individually affect < 1/2000 people
 Collectively willaffect1/12-1/17Canadians
 80% are genetic, ~7000 in total
 50% of people affected are children
 Takes > 5-years to diagnose
 30% of children with an RD die under 5
 Genetic cause known for just over half
 Treatment available for <10%
0
0.5
1
1.5
2
2.5
3
3.5
30 40 50 60 70 80 90 100 110
Neutrophils
x10^9/L
Days
Patient Neutrophils
Lower Limit of Normal Neutrophils
Patient with low white blood
cells and infections
His genetic code
2000 letters out of 3 billion!
TTTCCCAGGGAAAGCTTCAATCAGCAAACAGTCTGCATGGGTCATCCCCTTCACTCCCAGCTGAGCAAACTCCAAGACAT
CTTCTACCCCAACACCAGCAATTGTGCCAAGGGCTATTAGGCTCTCAGCATGACTATTTTTAGAGACCCCGTGTCTGTCACT
GAAACCTTTTTTGTGGGAGACTATTCCTCCCATCTGCAACAGCTGCCCCTGCTGACTGCCCTTCTCTCCTCCCTCTCATCCC
AGAGAAACAGGTCAGCTGGGAGCTCTGCCCCCACTGGAAGGGACCAACAGGGGCCCAGTCACTGACCCCGAGACGTT
TGCATCCTGCACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTATTGATTGGTGTGCCGTTT
TCTCTGGAAGCCTCTTAAGAACACAGTGCGCAGGTGGGTGGAGCCGTCCCCCCAGGAGCACAGGCAGACAGAACGCTC
CTTGAAGCTGGTCTCCACACAGTGCTGGTTCCGTCACCCCCTCCCAAGGAAGTAGGTCTGAGCAGCTTGTCCTGGCTGTG
TCCATGTCAGAGCAACGGCCCAAGTCTGGGTCTGGGGTCTGCCTGTGGCTGCTGCGGTGGCGGATGGGACGCGGGCAA
AGGCTCCTCACCAGCCCCAGGTCCTTTCCCAGAGATGCCTGGAGGGAAAAGGCTGAGTGGGTGCTTAAATACAGAAAA
GGCAGGACAGAATTACAAGGTGCTGGCCCAGGGCGGGCAGCGGCCCTGCCTCCTACCCTTGCGCCTCATGACCAGCTTG
TTGAAGAGATCCGACATCAAGTGCCCACCTTGGCTCGTGGCTCTCACTGCAACGGGAAAGCCACAGACTGGGGTGAAG
AGTTCAGTCACATGCGACCGGTGGCTCCCTGTCCCCACCCCCATGACACTCCCCAGCCCTCCAAGGCCACTGTGTTTCCCA
GTTAGCTCAGAGCCTCAGTCGATCCCTGACCCAGCACCGGGCACTGATGAGACAGCGGCTGTTTGAGGAGCCACCTC
AGCCACCTCGGGGCCAGGGCCAGGGTGTGCAGCACCACTGTACGGCGGGGGGAGAGCAAGGCAAAAGCAGCGCTGG
GTACAAGCTCAAAACCATAGTGCCCAGGGCACTGCCGCTGCAGGCGCAGGCATCGCATCACACCATCTGTATCTCAGGAG
GCTGCAGTGGCTGACCACCGCCTTGGACCGCTCTTGGCAGTCGAAAAAGATTCTCCTGTCAGTTTGAGCTGGGTGAGGG
GAGGATTGGTGGCGGCCCAGGGCTTCCAGCATGTGCCCTAGGGGAAGCAGGGGCCAGCTGGCAACACCCGGTGGCCA
GGGTGGAGGGGAGTTTTCGCTCCTGCGCTTGGCCTTGCCGATGCCCCCAGGAGGCCGGACCTTTAGAGACTGTGTGTG
GGGGCCGGCACTGGTTTCTGCAACCACCTGAGCGCGGGCATCCTGTGTGCAGATACTCCCTGCTTCCTCTCTAGCCCCCA
CCCTGCAGAGCTGGACCCCTGAGCTAGCCATGCTCTGACAGTCTCAGTTGCACACACGAGCCAGCAGAGGGGTTTTGTG
CCACTTCTGGATGCTAGGGTTACACTGGGAGACACAGCAGTGAAGCTGAAATGAAAAATGTGTTGCTGTAGTTTGTTATT
AGACCCCTTCTTTCCATTGGTTTAATTAGGAATGGGGAACCCAGAGCCTCACTTGTTCAGGCTCCCTCTGCCCTAGAAGTG
AGAAGTCCAGAGCTCTACAGTTTGAAAACCACTATTTTATGAACCAAGTAGAACAAGATATTTGAAATGGAAACTATTCAA
AAAATTGAGAATTTCTGACCACTTAACAAACCCACAGAAAATCCACCCGAGTGCACTGAGCACGCCAGAAATCAGGTGG
Found the mistake!
AGCCACCTCGGGGCCAGGGCCAGGGTGTGCAGCACCACTGTACGGCGGGGGGAGAGCAAGGCAAAAGCAGCGCTGGGTACAAGCTCAAAACCATAGTGCCCAGGGCACTGCCGCTGCAGGCGCAGGCATCGCATCACACCATCTGTATCTCAGGAGGCTGCAGTGGCTGACCACCGCCTTGGACCGCTCTTGG
GAGGATTGGTGGCGGCCCAGGGCTTCCAGCATGTGCCCTAGGGGAAGCAGGGGCCAGCTGGCAACACCCGGTGGCCAGGGTGGAGGGGAGTTTTCGCTCCTGCGCTTGGCCTTGCCGATGCCCCCAGGAGGCCGGACCTTTAGAGACTGTGTGTGgtgtgactatgtcatacstgcgs
ttsGGGGCCGGCACTGGTTTCTGCAACCACCTGAGCGCGGGCATCCTGTGTGCAGATACTCCCTGCTTCCTCTCTAGCCCCCACCCTGCAGAGCTGGACCCCTGAGCTAGCCATGCTCTGACAGTCTCAGTTGCACACACGAGCCAGCAGAGGGGTTTT
GTCCACTTCTGGATGCTAGGGTTACACTGGGAGACACAGCAGTGAAGCTGAAATGAAAAATGTGTTGCTGTAGTTTGTTATTAGACCCCTTCTTTCCATTGGTTTAATTAGGAATGGGGAACCCAGAGCCTCACTTGTTCAGGC
TAGAAGTCCAGAGCTCTACAGTTTGAAAACCACTATTTTATGAACCAAGTAGAACAAGATATTTGAAATGGAAACTATTCAAAGCCACCTCGGGGCCAGGGCCAGGGTGTGCAGCACCACTGTACGGCGG
GGGTACAAGCTCAAAACCATAGTGCCCAGGGCACTGCCGCTGCAGGCGCAGGCATCGCATCACACCATCTGTATCTCAGGAGGCTGCAGTGGCTGACCACCGCCTTGGACCGCTCTTGGC
AGTCGAGGATTGGTGGCGGCCCAGGGCTTCCAGCATGTGCCCTAGGGGAAGCAGGGGCCAGCTGGCAACACCCGGTGGCCAGGGTGGAGGGGAGTTTTCGCTCCTGCGC
TTGGCGGGGCCGGCACTGGTTTCTGCAACCACCTGAGCGCGGGCATCCTGTGTGCAGATACTCCCTGCTTCCTCTCTAGCCCCCACCCTGCAGAGCTGGACCCCT
GAGCTAGCCACTTCTGGATGCTAGGGTTACACTGGGAGACACAGCAGTGAAGCTGAAATGAAAAATGTGTTGCTGTAGTTTGTTATTAGACCCCTTCTTT
CCATTGGTAGAAGTCCAGAGCTCTACAGTTTGAAAACCACTATTTTATGAACCAAGTAGAACAAGATATTTGAAATGGAAACTATTCAAAAAATTG
AGAATTTCCTCAAAGAGCTGCTCCCACCTGAAGGAGACGCGCTGCTGCTGCTGTCGTCCTGCCTGGCTCTGAAACACAAAGTGTGGGG
TGTCTAGCCAGCTCCAATCCCAGAACCCAGCACCTTGGCTACCCTCAAAGAGCTGCTCCCACCTGAAGGAGACGCGCTGCTGCT
GCTGTCGTCCTGCCTGGCTCTGAAACACAAAGTGTGGGGTGTCTAGGGAAGAAGGTGTGTGACCAGGGAGGTCCCCGG
CCCAGCTCCAATCCCAGAACCCAGCACCTTGGCTACCCTCAAAGAGCTGCTCCCACCTGAAGGAGACGCGCTGCTG
CTGCTGCTGCCTGGCTCTGAAACACAAAGTGTGGGGTGTCTAGGGAAGAAGGTGTGTGACCAGGGAGGTCC
CCGGCCCAGCTCCAATCCCAGAACCCAGCACCTTGGCTACCCTCAAAGAGCTGCTCCCACCTGAAGGAGACG
CGCTGCTGCTGCTGTCGTCCTGCCTGGCTCTGAAACACAAAGTGTGGGGTGTCTAGGGAAGAAGGT
GTGTGACCAGGGAGGTCCCCGGCCCAGCTCCAATCCCAGAACCCAGCACCTTGGCTA
CCCTCAAAGAGCTGCTCCCACCTGAAGGAGACGCGCTGCTGCTGCTGTC
GTCTCTTGCATCTGTTCTCTTCCAGGTTTCTTTTTGGAGA
CAGGCCCTTTTGATGGGTCCATGAGTCTGGTTACTACAG
CCAGGCTCCAGCCCAG
Madden – 2 years of age and in
hospital…. with no diagnosis
IPEX syndrome – Madden has a hyperactive
immune system and needs a bone marrow
transplant to survive
Eisenbarth GS, Gottlieb PA. N Engl J Med 2004;350:2068-2079.
4800 genes sequenced…
in one week
Post bone marrow transplant
and healing
Family history of breast cancer
Tumors are all genetically
abnormal
Normal
Tumor
Some people have a genetic change
that predisposes them to cancer
Normal
Tumor
Sporadic
Family clusters
Hereditary
Ovarian CancerBreast Cancer
5%–10% 5%–10%
15%-20%
How much breast and ovarian cancer is
hereditary?
Taking control of your genetic
risk
Why don’t elephants get cancer?
Ndutu Tanzania
Peto’s
paradox
Peto’s Paradox
li-fraumeni syndrome
Peto’s Paradox solved
extra copies of p53
li-fraumeni syndrome
Epigenomics – gene and
environment interaction
Personalized medicine
Pharmacogenomics
Medicine 2017
Precision health – we are all
unique
Disruptive technologies:
advances that will transform
life business and the global
economy
Genomics is a disruptive
technology
Gene editing
Would you have your genome
sequenced?
YES
NO
Would you have your genome
sequenced
A
YES
B
NO
Key takeaways
 The 3 billion letters of our genome contains all the
instructions necessary for development and maintenance of
the human body
 Genetic variation has a large impact on both our risk of
disease, as well as our response to treatment
 Rapid advances in sequencing and computer technologies
have brought sequencing the human genome to the
doorstep of clinic
 Human Genomics will be one of the cornerstones of the
new Precision Medicine era
• The Cumming School of Medicine at UCalgary has identified
Precision Medicine as its key strategic priority
Resources
 NHGRI Genomic Medicine and Health Care
 NHGRI A Brief Guide to Genomics
 Alberta Children’s Hospital Research Institute
 Department of Medical Genetics, Cumming School
of Medicine, University of Calgary
Thank you
Sign up for other UCalgary webinars,
download our eBooks,
and watch videos on the outcomes of our scholars’
research at
ucalgary.ca/explore/collections

More Related Content

Similar to Cracking the genetic code for better health

Make DNA data actionable - Festival of Genomics London 2018
Make DNA data actionable - Festival of Genomics London 2018Make DNA data actionable - Festival of Genomics London 2018
Make DNA data actionable - Festival of Genomics London 2018
Omar Fogliadini
 
Food Labeling final report
Food Labeling final reportFood Labeling final report
Food Labeling final report
Laura Bliss
 

Similar to Cracking the genetic code for better health (20)

Threats To Our Health
Threats To Our HealthThreats To Our Health
Threats To Our Health
 
Catalogue of innovative publication
Catalogue of innovative publicationCatalogue of innovative publication
Catalogue of innovative publication
 
Make DNA data actionable - Festival of Genomics London 2018
Make DNA data actionable - Festival of Genomics London 2018Make DNA data actionable - Festival of Genomics London 2018
Make DNA data actionable - Festival of Genomics London 2018
 
BIBLIOGRAPIYA- Kumalap ng mga Datos.pptx
BIBLIOGRAPIYA- Kumalap ng mga Datos.pptxBIBLIOGRAPIYA- Kumalap ng mga Datos.pptx
BIBLIOGRAPIYA- Kumalap ng mga Datos.pptx
 
BIL 2009 Personalized Medicine And Personal Genomics
BIL 2009 Personalized Medicine And Personal GenomicsBIL 2009 Personalized Medicine And Personal Genomics
BIL 2009 Personalized Medicine And Personal Genomics
 
OraVital DSO Intelligence Report: The Quiet Global Pandemic of Tooth Decay - ...
OraVital DSO Intelligence Report: The Quiet Global Pandemic of Tooth Decay - ...OraVital DSO Intelligence Report: The Quiet Global Pandemic of Tooth Decay - ...
OraVital DSO Intelligence Report: The Quiet Global Pandemic of Tooth Decay - ...
 
Merck & CO
Merck & COMerck & CO
Merck & CO
 
Teach It Write Write Right Incredible Critique Forms
Teach It Write Write Right Incredible Critique FormsTeach It Write Write Right Incredible Critique Forms
Teach It Write Write Right Incredible Critique Forms
 
Food Labeling final report
Food Labeling final reportFood Labeling final report
Food Labeling final report
 
BIOMES - NOAH19 Berlin
BIOMES - NOAH19 BerlinBIOMES - NOAH19 Berlin
BIOMES - NOAH19 Berlin
 
The Gut Health Workshop
The Gut Health WorkshopThe Gut Health Workshop
The Gut Health Workshop
 
Forage Agriculture's Future in a Changing Climate
Forage Agriculture's Future in a Changing ClimateForage Agriculture's Future in a Changing Climate
Forage Agriculture's Future in a Changing Climate
 
A Modern Approach to Healthcare: Bridging Dentistry, Medicine, Pharmacy, and ...
A Modern Approach to Healthcare:Bridging Dentistry, Medicine, Pharmacy, and ...A Modern Approach to Healthcare:Bridging Dentistry, Medicine, Pharmacy, and ...
A Modern Approach to Healthcare: Bridging Dentistry, Medicine, Pharmacy, and ...
 
The Secrets to a Happy, Successful Legal Career Part 2 of 2
The Secrets to a Happy, Successful Legal Career Part 2 of 2The Secrets to a Happy, Successful Legal Career Part 2 of 2
The Secrets to a Happy, Successful Legal Career Part 2 of 2
 
Smoking and lung cancer and now Covid
Smoking and lung cancer and now CovidSmoking and lung cancer and now Covid
Smoking and lung cancer and now Covid
 
The Pharma 2020 series : PWC Pharma-success-strategies
The Pharma 2020 series : PWC Pharma-success-strategiesThe Pharma 2020 series : PWC Pharma-success-strategies
The Pharma 2020 series : PWC Pharma-success-strategies
 
Significance of biostatistics in public health
Significance of biostatistics in public healthSignificance of biostatistics in public health
Significance of biostatistics in public health
 
Difference Between Essay Writing And Article Writing
Difference Between Essay Writing And Article WritingDifference Between Essay Writing And Article Writing
Difference Between Essay Writing And Article Writing
 
Gut health - Improving digestion and absorption of food
Gut health - Improving digestion and absorption of foodGut health - Improving digestion and absorption of food
Gut health - Improving digestion and absorption of food
 
Good Proposal Essay Topics
Good Proposal Essay TopicsGood Proposal Essay Topics
Good Proposal Essay Topics
 

More from University of Calgary

More from University of Calgary (20)

COVID-19 support webinar - Managing ADHD during isolation
COVID-19 support webinar - Managing ADHD during isolationCOVID-19 support webinar - Managing ADHD during isolation
COVID-19 support webinar - Managing ADHD during isolation
 
Voter's bootcamp
Voter's bootcampVoter's bootcamp
Voter's bootcamp
 
Learning to tread lightly in the boreal forest
Learning to tread lightly in the boreal forestLearning to tread lightly in the boreal forest
Learning to tread lightly in the boreal forest
 
Aging well: Are you prepared?
Aging well: Are you prepared?Aging well: Are you prepared?
Aging well: Are you prepared?
 
Elections in the digital age
Elections in the digital ageElections in the digital age
Elections in the digital age
 
Power and collective resistance
Power and collective resistancePower and collective resistance
Power and collective resistance
 
Women in politics: Access, impact and outcomes
Women in politics: Access, impact and outcomes Women in politics: Access, impact and outcomes
Women in politics: Access, impact and outcomes
 
7 Steps to an international strategy implementation
7 Steps to an international strategy implementation7 Steps to an international strategy implementation
7 Steps to an international strategy implementation
 
Let food be thy medicine: Diet and disease
Let food be thy medicine: Diet and diseaseLet food be thy medicine: Diet and disease
Let food be thy medicine: Diet and disease
 
Overcoming anxiety in schools
Overcoming anxiety in schoolsOvercoming anxiety in schools
Overcoming anxiety in schools
 
The roots of anxiety
The roots of anxietyThe roots of anxiety
The roots of anxiety
 
Cannabis legalization and youth
Cannabis legalization and youthCannabis legalization and youth
Cannabis legalization and youth
 
What does legalized cannabis mean for Canadians?
What does legalized cannabis mean for Canadians?What does legalized cannabis mean for Canadians?
What does legalized cannabis mean for Canadians?
 
Technology and gaming in education
Technology and gaming in educationTechnology and gaming in education
Technology and gaming in education
 
Top tips to build student teams that excel
Top tips to build student teams that excelTop tips to build student teams that excel
Top tips to build student teams that excel
 
Preparing students for the unknown
Preparing students for the unknownPreparing students for the unknown
Preparing students for the unknown
 
Energy and environment: Are our laws keeping up?
Energy and environment: Are our laws keeping up?Energy and environment: Are our laws keeping up?
Energy and environment: Are our laws keeping up?
 
Leaving carbon behind
Leaving carbon behindLeaving carbon behind
Leaving carbon behind
 
Climate change in Canada's Arctic: Impacts on Inuit communities and marine ec...
Climate change in Canada's Arctic: Impacts on Inuit communities and marine ec...Climate change in Canada's Arctic: Impacts on Inuit communities and marine ec...
Climate change in Canada's Arctic: Impacts on Inuit communities and marine ec...
 
Are we ready to flip the switch on clean energy?
Are we ready to flip the switch on clean energy?Are we ready to flip the switch on clean energy?
Are we ready to flip the switch on clean energy?
 

Recently uploaded

🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
Call Girls In Delhi Whatsup 9873940964 Enjoy Unlimited Pleasure
 

Recently uploaded (20)

Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
 
Call Girls Vadodara Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Vadodara Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Vadodara Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Vadodara Just Call 8617370543 Top Class Call Girl Service Available
 
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
Model Call Girls In Chennai WhatsApp Booking 7427069034 call girl service 24 ...
 
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
 
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
 
Most Beautiful Call Girl in Bangalore Contact on Whatsapp
Most Beautiful Call Girl in Bangalore Contact on WhatsappMost Beautiful Call Girl in Bangalore Contact on Whatsapp
Most Beautiful Call Girl in Bangalore Contact on Whatsapp
 
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kurnool Just Call 8250077686 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
Call Girls Guntur Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Guntur  Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Guntur  Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Guntur Just Call 8250077686 Top Class Call Girl Service Available
 
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
 
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
 
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Top Rated Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
Top Rated  Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...Top Rated  Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
 
Call Girls Hosur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Hosur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Hosur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Hosur Just Call 9630942363 Top Class Call Girl Service Available
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
 
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
Best Rate (Guwahati ) Call Girls Guwahati ⟟ 8617370543 ⟟ High Class Call Girl...
 
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
8980367676 Call Girls In Ahmedabad Escort Service Available 24×7 In Ahmedabad
 

Cracking the genetic code for better health