Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Make DNA data actionable - Festival of Genomics London 2018

337 views

Published on

Consumers are looking for more control over their own health and healthcare, and with the advent of affordable genetic testing there are new avenues for personalised treatment and precision medicine.

As consumer tests come to the fore and patients arrive at their doctor appointments brandishing their own genetic data and full of questions and opinions. Concerns still remain that patients – and not a few physicians – don't always understand what the genetic results mean and just what to do about them. But as consumers get more comfortable with those companies' offerings, the visits with their doctors are often getting more complex.

With the increased use of the Internet for medical information, consumers have become medical consumers not just patients This has created a change in the doctor/patient relationship as individuals become more knowledgeable about their own health and want more control over their personal information and treatment decisions. Physicians, meanwhile, are concerned about giving patients too much access to information they may not properly understand. Even many doctors aren't well-trained in the clinical implications of genetics and genomics.  

The CMO’s Generation Genome report is focused on the need for the UK to maintain its presence as a world leader in genomic medicine. It presented a vision of genomics being integrated into the NHS within the next 5 years.

The “vast majority” of NHS doctors are “not up to speed” with modern genetic techniques that can transform patients’ chances.

GENOMIC INTELLIGENCE
Suisse Life Science specialiSes in making DNA data useful for population health management.

Using our flagship Scienceof[DNA]f(x) technology, Suisse Life Science Group can provide you with an evidence-based lifestyle behavioural medicine dynamic system based on the associated genetic variants supported by literature citations for health, wellness or chronic diseases, and customised around your needs.

What used to take weeks of painstaking manual curation can now be completed in days.

PERSONALISED HEALTH TECHNOLOGY FOR GENOMIC COMPANIES OR CUSTOM APPLICATIONS
We help companies by providing a comprehensive nutritional, metabolic and lifestyle analysis and management program that includes nutrition intake and lifestyle monitoring, followed by a personalised nutritional, chronic disease prevention and sport recommendations, tailored for the user, informed on their biomarkers but updated - in real-time - with life data from consumer devices (smartphones, wearables…).

Ready-to-market technology.

Ask for a demo at info@suisselifescience.com

Published in: Healthcare
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m77EgH } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m77EgH } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m77EgH } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy & Proven Way to Build Good Habits & Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • DOWNLOAD THIS BOOKS INTO AVAILABLE FORMAT (Unlimited) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { https://tinyurl.com/yyxo9sk7 } ......................................................................................................................... Download Full EPUB Ebook here { https://tinyurl.com/yyxo9sk7 } ......................................................................................................................... ACCESS WEBSITE for All Ebooks ......................................................................................................................... Download Full PDF EBOOK here { https://tinyurl.com/yyxo9sk7 } ......................................................................................................................... Download EPUB Ebook here { https://tinyurl.com/yyxo9sk7 } ......................................................................................................................... Download doc Ebook here { https://tinyurl.com/yyxo9sk7 } ......................................................................................................................... ......................................................................................................................... ......................................................................................................................... .............. Browse by Genre Available eBooks ......................................................................................................................... Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult,
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • How can I improve my memory and concentration? How can I improve my memory for studying?➤➤ https://bit.ly/2GEWG9T
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Protect your brain from memory loss with brain pill. find out more...  https://tinyurl.com/brainpill101
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • System for lasting clear skin, How to get flawless complexion ex-sufferer reveals his secrets ●●● http://t.cn/AiWGkfAm
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

Make DNA data actionable - Festival of Genomics London 2018

  1. 1. GIVE MEANING TO YOUR DNA DATA
  2. 2. Fred Hassan, Chairman Warburg Pincus suisselifescience.com © 2018 Suisse Life Science Group plc. All Rights Reserved. 2 Source: CNBC, 01/2018 HARNESSING THE POWER OF THE BIOLOGICAL SCIENCES THE BIG BANG IS COMING IN HEALTH CARE, AND IT WILL SPARK THE NEXT INDUSTRIAL REVOLUTION The biopharma innovation flow in 2017 was the most exciting the world has seen. Industrial revolutions occur when there is an unmet need and when different technologies come together to create magic. The Fifth Industrial Revolution will be powered by the coming acceleration in harnessing the biological sciences. Biology is difficult to characterize, difficult to chart on a systems basis. It is ever changing, difficult to intervene at specific intervention points and can take evasive action when human intervention occurs. Biology is ruled by nature, much more than the laws of physical science or mechanical science. Some say as much new research is getting added on in the previous two years as the entire period before that. The cost of sequencing a genome has dropped below $1,000, a stunning drop from $2 billion level less than two decades ago. This cost will keep dropping. It is estimated that more than a billion people will soon supply the world's databases with their genomic and phenotypic information to carry out correlations that educate us about gene variants and their linkage to diseases — and even lifestyles. THIS FIFTH REVOLUTION, WHICH I PREDICT WILL START IN THE NEXT DECADE, WILL MAKE THIS CENTURY THE LIFE SCIENCES CENTURY FOR MANKIND. We will succeed in taming biology and making it into a more predictable science that can be harnessed, similar to the way the previous four industrial revolutions harnessed the physical and mechanical sciences. As the Fifth Industrial revolution unfolds, more and more of us will be living longer and living better.
  3. 3. suisselifescience.com © 2018 Suisse Life Science Group plc. All Rights Reserved. 3 DIRECT-TO-CONSUMER GENETIC HEALTH TESTING CONSUMERS ARE LOOKING FOR MORE CONTROL OVER THEIR OWN HEALTH AND HEALTHCARE, AND WITH THE ADVENT OF AFFORDABLE GENETIC TESTING THERE ARE NEW AVENUES FOR PERSONALISED TREATMENT AND PRECISION MEDICINE. STRONG GROWTH (2018-2022) +25.6% DTC GENETIC TESTING MARKET FROM $99 MILLION TO MORE THAN $310 MILLION IN 2022 EASING OF THE REGULATORY PROCESS FOR DTC GENETIC TESTS CHANGES IN THE DOCTOR-PATIENT RELATIONSHIP As consumer tests come to the fore and patients arrive at their doctor appointments brandishing their own genetic data and full of questions and opinions. Concerns still remain that patients – and not a few physicians – don't always understand what the genetic results mean and just what to do about them. But as consumers get more comfortable with those companies' offerings, the visits with their doctors are often getting more complex. With the increased use of the Internet for medical information, consumers have become medical consumers not just patients This has created a change in the doctor/patient relationship as individuals become more knowledgeable about their own health and want more control over their personal information and treatment decisions. Physicians, meanwhile, are concerned about giving patients too much access to information they may not properly understand. Even many doctors aren't well-trained in the clinical implications of genetics and genomics.   Source: Kalorama Information report, The Market for Direct-to-Consumer Genetic Health Testing
  4. 4. Professor Patrick  Chinnery, a member of the Medical Research Council, said the pace of technical advance meant swathes of the workforce need extra training. Health chiefs are embracing the science, with a large scale pilot currently running that will lead to a full-scale Genomics Medicine Service within the NHS. But Professor Chinnery, a mitochondrial specialist at Cambridge University, told The Telegraph that while current medical students are being adequately trained, doctors above the age of 30 need to “get up to date”. He said demonstrating a working knowledge of genomics could soon be a condition of the re-licensing process all doctors go through every five years. “All doctors will need to be able to understand when to use genomic testing and how to interpret the results they get back from the lab in practice,” Professor Chinnery said. suisselifescience.com © 2018 Suisse Life Science Group plc. All Rights Reserved. 4 GENOMICS FROM THE LAB TO PRACTICE In the short-term it’s the specialists who will use it but we will increasingly see patients knowledgeable about genomics going to their GPs with questions. GPs will need to understand what is possible. THE CMO’S GENERATION GENOME REPORT IS FOCUSED ON THE NEED FOR THE UK TO MAINTAIN ITS PRESENCE AS A WORLD LEADER IN GENOMIC MEDICINE. It presented a vision of genomics being integrated into the NHS within the next 5 years. THE “VAST MAJORITY” OF NHS DOCTORS ARE “NOT UP TO SPEED” WITH MODERN GENETIC TECHNIQUES THAT CAN TRANSFORM PATIENTS’ CHANCES.
  5. 5. Even though the number of genetic counsellors has grown 88% over the last decade— there are currently about 4,200 genetic counsellors in the U.S. —experts say there won't be an appropriate ratio of counsellor-to-patients until 2023, at the earliest. China will need at least 100,000 genetic counselors. “You cannot even find the term for genetic counsellors in the Chinese occupational classification system,” said He Ping, a director at the Genetics Society of China. With the gradual introduction of genetic testing services into clinical practice, the industry began to show a supply shortage. WHAT THE PATIENT WANTS The world of genomic sequencing and genetic testing has undergone rapid changes over the last two decades, driven in part by the drop in the cost of the technology. Now, at-home DNA tests are marketed as holiday gifts during Black Friday and younger patients are more interested in obtaining information about their own health — and they are more willing to pay for it out of pocket. In the past, patients often gave full autonomy of their health choices and care to their doctors. That's changing, as MORE PATIENTS WANT TO TAKE OWNERSHIP OF THEIR HEALTH. suisselifescience.com 5 WE DON’T NEED MORE DATA – OR MORE GENETIC COUNSELLORS Population Health Management Specialization 5% Hospital or Specialist 25% Licensed Clinician 70% Smart Technologies, Health Coaches and Allied Providers © 2018 Suisse Life Science Group plc. All Rights Reserved.
  6. 6. suisselifescience.com 6 DATA-DRIVEN MEDICINE © 2018 Suisse Life Science Group plc. All Rights Reserved. GENETIC TESTING IS DEAD. A new business model must be created to bring genomics into healthcare. Rather than the traditional diagnostic testing model, Invitae is working to create this new model through partnering with pharmaceutical companies, healthcare systems and patient advocacy companies. The next big opportunity that Invitae is exploring is how genomic data could benefit an asymptomatic person. Invitae CEO Sean George
  7. 7. SUISSE LIFE SCIENCE SPECIALISES IN MAKING DNA DATA USEFUL FOR POPULATION HEALTH MANAGEMENT. Using our flagship Scienceof[DNA]f(x) technology, Suisse Life Science Group can provide you with an evidence-based lifestyle behavioural medicine dynamic system based on the associated genetic variants supported by literature citations for health, wellness or chronic diseases, and customised around your needs. What used to take weeks of painstaking manual curation can now be completed in days. PERSONALISED HEALTH TECHNOLOGY FOR GENOMIC COMPANIES OR CUSTOM APPLICATIONS The Scienceof[DNA]f(x) technology - after being validated through the My iDDNA® proof of concept with more than 2,000 customers - is now available for enterprises and global premium brands that wants to leverage personalisation from genomics and an enhanced user experience with a ready-to-market technology. suisselifescience.com 7 GENOMIC INTELLIGENCE FINDING THE ANSWER CAATTCCCAGGCTACCGAACTGTCGAGGGGT CATAAAGCTACGGGTTAACTGAGCTATTCCAT AACTCGGGCACAGATTAGGTGGTTACTCAAT CAATTCCCAGGCTACCGAACTGTCGAGGGGT CATAAAGCTACGGGTTAACTGAGCTATTCCAT AACTCGGGCACAGATTAGGTGGTTACTCAATT CAATTCCCAGGCTACCGAACTGTCGAGGGGT CATAAAGCTACGGGTTAACTGAGCTATTCCAT AACTCGGGCACAGATTAGGTGGTTACTCAATT CATAAAGCTACGGGTTAACTGAGCTATTCCAT IS DIFFICULT © 2018 Suisse Life Science Group plc. All Rights Reserved.
  8. 8. If precision medicine is the future and this type of care is all about the individual, then the healthcare industry needs to become nimble like an Amazon to compete against other businesses that are frankly better at zooming in on consumers’ needs. “If I bought books on Amazon two years ago, they still know what I like and need,” said Pfizer CMO Freda Lewis-Hall, MD. “I think Amazon is around changing the dynamic. We are still in a system delivering Star Wars advancement in technology in a Flintstones’ healthcare system.” The ability to sequence the human genome to predict adverse health events and the onset of chronic diseases, that’s the Star Wars part. Meet the Flintstones: Today’s existing technological infrastructure to support personalised care and all the data it will demand is not nearly robust enough. PERSONALISED MEDICINE NEEDS SMARTER DATA Every two years the world’s database doubles, and every three years health information alone also doubles. By 2020, global healthcare data will double every three days – with 80% of the data being UNSTRUCTURED, without a clear relationship. To truly get the results consumers deserve, health & wellness data need to translate into accurate, actionable recommendations for both consumers and professionals. suisselifescience.com 8 PERSONALISED MEDICINE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  9. 9. WORKING AT THE CREATIVE EDGE OF BIOLOGY AND INFORMATICS This vision of personal health monitoring is becoming achievable in part because of dramatic cost reductions for sequencing DNA and measuring the many thousands of biological compounds and processes that regulate the body. What all that means for any one of us, especially when all the readings are combined, is unclear. But Suisse Life Science is part of a new wave of companies that figure they can find something meaningful in the data and enable medicine to stop merely reacting to an illness you have; these companies want to keep you healthy at a fraction of the cost. Unlocking this puzzle, with its millions of moving pieces, is where AI and other advanced computing techniques will have to come in. AI is how we can take all of this information and tell you things that you don’t know about your health. Mainstream medical testing tends to be static, with one test taken at a time— an EKG in a clinical setting every year or two, for example, or when symptoms seem to warrant it. Now you’ve the possibility to discover the early stages of when a person shifts from good health to, say, becoming a diabetic. LIFESTYLE AND DATA-DRIVEN MEDICINE FROM DEVICES The Scienceof[DNA]f ( x )  is an Artificial Intelligence (AI) platform technology that can automatically read and collate unstructured data, then learn to make personalised recommendations that will dramatically impact anybody’s personal health & wellness outcomes or enhance a specific medication (or medical device) user experience. ENABLING PEOPLE TO LIVE LONGER, HAPPIER AND HEALTHIER LIVES THROUGH DNA AND DIGITAL TECHNOLOGY. suisselifescience.com 9 DATA-DRIVEN MEDICINE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  10. 10. The critical translation between genotype, biochemistry, gene expression, biomarker tests, phenotype and personalised advice – based on evidence- based research – makes the difference in empowering consumers and practitioners in such a rapidly-evolving field. The beginning of the era of Personalised Precision Medicine is here. Personalised Medicine involves best practice treatment guidelines being customised for an individual, based on their unique attributes, their environment and lifestyle choices, as well as their genomic makeup. Today we strive to treat the individual, and not just ‘a’ general condition. The effective development of Personalised Medicine requires the collection and analysis of large volumes of data that can be subjected to deep machine learning. In today’s connected world, the aggregation of large volumes of complete longitudinal medical records of an individual, together with their unique genomic data in an accessible database, requires bulletproof privacy, security and access controls for the individual clinical records. PRECISION MEDICINE PROGRAMS TURN DATA INTO ACTIONABLE INSIGHTS Suisse Life Science is a technology company that is building the world's largest library of molecular data and lifestyle behaviour for an ageing population linked to individual genetic traits and an operating system to make that data accessible and useful. suisselifescience.com 10 FUTURE HAPPENS. BE READY TRANSFORM UNSTRUCTURED DATA We aggregate and structure real time scans to uncover phenotypic, therapeutic and outcomes data for every customer. PRODUCE MOLECULAR DATA Our genomic tests analyze DNA data to understand a customer’s predisposition at a molecular level and uncover more personalised treatment options. GENERATE ACTIONABLE INSIGHTS Our platform analyses thousands of clinical and molecular data points supporting our partners with actionable insights for more impactful outcomes. © 2018 Suisse Life Science Group plc. All Rights Reserved.
  11. 11. suisselifescience.com 11 CONNECTING THE DOTS BETWEEN DNA AND LIFE02 © 2018 Suisse Life Science Group plc. All Rights Reserved.
  12. 12. Disease § Age of 1st occurrence Heart Disease 610.000 65 Lung cancer 158.060 60 Chronic obstructive pulmonary disease (COPD) 147.101 45 Stroke 140.000 65 Lower respiratory infections 131.800 75 Alzheimer´s disease 93.541 65 Type 2 diabetes 69.071 54 Colorectal cancers 50.260 70 Breast cancer 40.000 62 Prostate cancer 25.000 66 In the United Kingdom, chronic diseases are projected to account for 85% of all deaths. At least 80% of premature heart disease, stroke and type 2 diabetes, and 40% of cancer, could be prevented through healthy diet, regular physical activity and avoidance of tobacco products. Cost-effective interventions exist: The most successful strategies have employed a range of population-wide approaches combined with interventions for individuals. Using these approaches, the United Kingdom has already made important gains in reducing chronic disease death rates. The World Health Organisation estimates that an additional 2% annual reduction in national-level chronic disease death rates in the United Kingdom over the next 10 years would result in an economic gain of 2 billion dollars for the country. Top ten causes of death in the US and their average or median age of first occurrence. Source: Department of Medicine, Washington University in St. Louis Lifespan Healthspan Average healthspan vs. average lifespan in the US (in years) suisselifescience.com 12 THE UNSEEN DILEMMA: 7963 Source: World Health Organization Healthspan is more important than Lifespan, so why don’t more people know about it?  © 2018 Suisse Life Science Group plc. All Rights Reserved.
  13. 13. Given these statistics, it should be clear that 1) chronic disease is the biggest threat to our health that we face, and 2) changing our behaviour is the most important step we can take to prevent and reverse chronic disease. The lack of tools, specialty segregation, limited ability of healthcare professionals to access unstructured data and follow the consumer out of the office lead to average diagnostic journeys of over 5-7 years, during which patients see an average of 5 different specialists. FINDING THE ANSWER FOR EACH ONE OF US IS DIFFICULT: • What should I eat? • What vitamins should I take? • What is the best exercise for me if it was a difficult week? What if I am exercising only once a week ? • My body is changing because of menopause; what should I do? ON AVERAGE, WE LIVE UP TO 20% OF OUR LIVES UNHEALTHY, NEEDLESS TO SAY, THAT IS A LONG TIME HELP ME STAY BETTER 10 MODIFIABLE FACTORS PREVENT 70-80% OF ALL CHRONIC DISEASES CDC report in 2001 chronic diseases contributed approx. 46% of all disease burden. Proportion is expected to increase to 57% by 2020. LIFETIME HEALTH CAUSES 60% Behavior & Environment 30% Genetics 10% Healthcare suisselifescience.com 13 THE PROBLEM THE DIAGNOSTIC ODYSSEY AN INTERPRETATION CHALLENGE HEALTH COACHING = BEHAVIOURAL CHANGE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  14. 14. suisselifescience.com 14 YOUR EXPERTISE - ONE GENE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  15. 15. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 15 VALUE CREATION FROM YOUR EXPERTISE WITH MULTI -OMICS RELATIONSHIPS
  16. 16. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  17. 17. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  18. 18. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  19. 19. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  20. 20. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  21. 21. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  22. 22. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  23. 23. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  24. 24. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  25. 25. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 16
  26. 26. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 26 GIVE A SENSE TO YOUR DNA DATA WITH MULTI -OMICS RELATIONSHIPS
  27. 27. Health Kit suisselifescience.com 27 GENOMIC INTELLIGENCE LIFESTYLE User preferences Exercise Stress Sleep Nutrition Drink At home/Out ENVIRONMENT Pollution UVA-B Sun exposure Season Location Temperature Humidity NUTRITION COUNSELLING Food selection Free servings choice (real-time food environment redesign) Shopping list AR Restaurant concierge DRINK COUNSELLING EXERCISE COACHING STRESS MANAGEMENT PHENOTYPIC TRAITS 24/7 Healthkit monitoring Pollen Health goal-matching diet DIETARY SUPPLEMENT COUNSELLING BEHAVIOURAL HEALTH COACHING SLEEP COUNSELLING BIOMARKERS PERSONALISED LIFESTYLE RECOMMENDATIONS © 2018 Suisse Life Science Group plc. All Rights Reserved.
  28. 28. suisselifescience.com 28 VALUE CREATION © 2018 Suisse Life Science Group plc. All Rights Reserved.
  29. 29. GENOMIC INTELLIGENCE suisselifescience.com 29© 2018 Suisse Life Science Group plc. All Rights Reserved.
  30. 30. suisselifescience.com 30 FROM GENOMICS TO DAILY LIFE © 2018 Suisse Life Science Group plc. All Rights Reserved. GENETIC PREDISPOSITION CONSUMER Implicit query aspect Explicit query aspect CONTEXT LIFESTYLEENVIRONMENT Search history Keywords Location SYMPTOMS HEALTH ASSOCIATED CONDITIONS RISK FACTORS CONTEXT Like/Dislike Molecular interventions RECOMMEND AVOID Behavioural Coaching Customised Products PERSONALISATION PHENOTYPE
  31. 31. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 31 GIVE A SENSE TO YOUR DNA DATA
  32. 32. suisselifescience.com 32 VALUE CREATION FROM YOUR EXPERTISE © 2018 Suisse Life Science Group plc. All Rights Reserved. https://invis.io/D4FG385AWUG
  33. 33. suisselifescience.com 33 BIOLOGY-PERSONALIZED BEHAVIOURAL HYPER-TARGETING © 2018 Suisse Life Science Group plc. All Rights Reserved.
  34. 34. Arginine LEAD Citrulline + NO Peroxynitrite Super Oxide GST SOD 0BH41BH42BH4 ammonia NOS T Purines 5, 10 Tryptophan Tyrosine BH4 TALUM BH2 Serotonin MAO A HIAA Dopamine COMT HVA glutamate gaba GAD T T T T NorEp SAH SAMe SAHCOMT VMA VDR 5 Methyl MTHFR DHPR dUMP THF Thymidine MTR LEAD B12 MTRR BHMT DMG Homocysteine TMG CBS cystathionine AMMONIA Cysteine + KG taurine glutathione G6PDH sulfite sulfate cortisol Angiotensin I Angiotensin II adenosine Creatine Creatinine SAH Guanido AC Methylation SAH DNA, RNA MAT Methionine SAMe SUOX ACE MAO B MAO B suisselifescience.com 34© 2018 Suisse Life Science Group plc. All Rights Reserved.
  35. 35. T T VDR 5-MTHF MTHFR dUMP THF Thymidine synthesis MTR LEAD B12 MTRR BHMT DMG Homocysteine TMG SAH Methylation SAH DNA, RNA Protein, lipids Methionine SAMe MTR/FOLATE CYCLE MTR (METHIONINE SYNTHASE) combines folate, methyl B12 and homocysteine into methionine. MTR variants FASTER PROCESS MTRR attaches a methyl group to B12 MTRR variants SLOWER PROCESS MTR+MTRR DISFUNCTIONS FROM GENOMICS TO DAILY LIFE NO inhibits MTR and B12. Subjects with IMMUNE DYSFUNCTION CHRONIC FATIGUE SYNDROME CHEMICAL SENSITIVITY LYME’S DISEASE FIBROMYALGIA tend to have higher NO levels. B12 DEFICIENCY ZINC DEFICIENCY FOLATE DEFICIENCY SELENIUM DEFICIENCY ALCOHOL CANDIDA THE BIRTH CONTROL PIULL LEAD MERCURY (FISH) CADMIUM (NON ORGANIC FOODS) suisselifescience.com 35© 2018 Suisse Life Science Group plc. All Rights Reserved.
  36. 36. SNPs XB% ew2% ew2% ew2% PERMUTATIONS Genetable METABOLIC TRAITS ASSOCIATED HEALTH CONDITIONS BEHAVIOURAL HEALTH NUTRITION MICRONUTRIENTS EXERCISE STRESS SLEEP LIFESTYLE ENVIRONMENT User preferences | Recommended/Avoid Foods, dietary approach, caloric restrictions Micronutrients Exercise technique, frequency, intensity Foods, micronutrients, exercise, lifestyle recommendations Foods, micronutrients, exercise, lifestyle recommendations Foods, micronutrients, exercise, lifestyle recommendations Foods, micronutrients, exercise, lifestyle recommendations XB% ew2% ew2% ew2% AI Avatar Brain GOAL AND PREFERENCES suisselifescience.com 36© 2018 Suisse Life Science Group plc. All Rights Reserved.
  37. 37. T T VDR 5-MTHF MTHFR dUMP THF Thymidine synthesis MTR LEAD B12 MTRR BHMT DMG Homocysteine TMG SAH Methylation SAH DNA, RNA Protein, lipids Methionine SAMe ACTIONABLE RECOMMENDATIONS FROM DNA ALCOHOL CANDIDA THE BIRTH CONTROL PIULL LEAD MERCURY (FISH) CADMIUM (NON ORGANIC FOODS) suisselifescience.com 37© 2018 Suisse Life Science Group plc. All Rights Reserved. VITAMIN B2 MANGANESE Beets Beet greens Turnips Turnips greens Broccoli Romaine lettuce Spinach Carrots Romaine Carrots Turnip greens VITAMIN B12 ZINC VITAMIN B2 Prebiotics Raw dandelion greens Garlic Leeks Onion Asparagus Chicory Oats PABA Mushrooms Spinach EGCG GRAPEFRUIT SEED EXTRACT
  38. 38. Source: https://jamanetwork.com/journals/jamainternalmedicine/article-abstract/2669907?utm_source=silverchair&utm_medium=email&utm_campaign=article_alert- jamainternalmedicine&utm_content=olf&utm_term=012218&redirect=true suisselifescience.com 38© 2018 Suisse Life Science Group plc. All Rights Reserved. ROI FROM YOUR WORK
  39. 39. The first studies have been released showing that AI Smart Apps are delivering health outcomes comparable to in-person lifestyle interventions for T2D. This study showed that use of an AI health coach is associated with weight loss comparable to in-person lifestyle interventions. Source: https://diabetes.jmir.org/2017/2/e28/? mkt_tok=eyJpIjoiWkRkbU0yUTVNR1JpTlROaiIsInQiOiIxQldLM2tDOTNrOEh5OWNJODJwTEJGblA3 TlRNK1VGUGdNTzg3Vis3eEdaQ215dmpSNXVPUVBLdkZ1akY4R0tCaXlOQnc3Mk5ndHNVRldsUzMy Q0Y0N3BwQkhjdURkWldKQWd0UVgweVd0cVkweGhFR2NWWTh6aGRZd3VKblFzTSJ9#Abstract AI PERSONAL COACHING suisselifescience.com 39© 2018 Suisse Life Science Group plc. All Rights Reserved.
  40. 40. suisselifescience.com 40 DIGITAL BIOLOGICAL INTELLIGENCE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  41. 41. suisselifescience.com 41 DIGITAL BIOLOGICAL INTELLIGENCE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  42. 42. suisselifescience.com 42 DIGITAL BIOLOGICAL INTELLIGENCE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  43. 43. suisselifescience.com 43 PRECISION CONSUMER HEALTH THROUGH LIVING DATA PASSIVE REACTIVE PROACTIVE PREDICTIVE PREVENTIVE ENABLED BY DATASYMPTOM-DRIVEN © 2018 Suisse Life Science Group plc. All Rights Reserved.
  44. 44. suisselifescience.com 44 HEALTHCARE EVERYWHERE: Supporting people through their health challenges © 2018 Suisse Life Science Group plc. All Rights Reserved.
  45. 45. suisselifescience.com 45© 2018 Suisse Life Science Group plc. All Rights Reserved.
  46. 46. Source: PSFK The Future of Health Vol.3 suisselifescience.com 46© 2018 Suisse Life Science Group plc. All Rights Reserved.
  47. 47. suisselifescience.com 47 Source: PSFK The Future of Health Vol.3 © 2018 Suisse Life Science Group plc. All Rights Reserved.
  48. 48. suisselifescience.com 48 Source: PSFK The Future of Health Vol.3 © 2018 Suisse Life Science Group plc. All Rights Reserved.
  49. 49. suisselifescience.com 49 PERSONALIZED HEALTH PLATFORM FOR CUSTOM APPLICATIONS03 © 2018 Suisse Life Science Group plc. All Rights Reserved.
  50. 50. suisselifescience.com 50 WHAT FUTURE FOR HEALTH & WELLNESS? PERSONALISED HEALTH MANAGEMENT TECHNOLOGY Lifestyle + Environment + Biomarkers (molecular personalization) Two levels of personalisation outcome: a) Personalised recommendation engine/personalised regimen b) Custom formula personalisation. BUSINESS APPLICATIONS: • AI PERSONAL NUTRITIONIST or RETAIL ASSISTANT (skincare, supplements, pharmacies…) for personalised health & beauty purchasing recommendations • D-T-C PERSONALIsED NUTRITION or SKINCARE business models • “HEALTH” PREMIUM TIER FOR MEAL-KIT COMPANIES to differentiate and upgrade the customer base • PHARMA’S NEW STRATEGIC PARTNER: Nutrition moves to population health. As established health organisations and new entrants focus on nutrition as a way to prevent costly medical problems and improve the overall health of the populations they serve, the demand for these services among populations fuels growth and innovation. © 2018 Suisse Life Science Group plc. All Rights Reserved.
  51. 51. suisselifescience.com 51 PERSONALISED NUTRITION HEALTH & WELLNESS03 © 2018 Suisse Life Science Group plc. All Rights Reserved.
  52. 52. suisselifescience.com 52 FOODTECH AND PERSONALIZED NUTRITION IS IT POSSIBLE TO DESIGN A BETTER, HEALTHIER AND MORE INDIVIDUAL DIET? UNDERSTANDING THE RELATIONSHIP BETWEEN FOOD AND GENES MAKE THIS A REALITY. The alarming rise in the prevalence of obesity and associated pathologies (type 2 diabetes, cardiovascular diseases, hypertension, stroke) points an accusing finger at the inadequacies between modern diets, a sedentary lifestyle and our genetic inheritance. Nutrigenomics relies on these new high-performance tools to define and characterize «diet signatures» reflecting the action of nutrients on the structure and expression of the human genome. “NUTRIGENOMICS IS THE STUDY OF MOLECULAR RELATIONSHIPS BETWEEN NUTRITION AND THE RESPONSE OF GENES, WITH THE AIM OF UNDERSTANDING HOW SUCH SUBTLE CHANGES CAN AFFECT HUMAN HEALTH.” 
 Chavez A, Munoz de Chavez M . Eur J Clin Nut, 57 (Suppl. 1) 97-100, 2003. The challenges of nutrigenomics are, first, to prevent illness by detecting nutrient impacts on biological markers identifying the early stages of diseases. The second challenge is therapeutic, once the disease takes hold. Here, nutrigenomics allies itself with pharmacogenomics in seeking maximum benefit from treatments. Tailor-made nutritional recommendations are already possible, taking into account individuals’ personal nutritional needs on the basis of their genotype, age, sex, physical activity and profession, the purpose of all this being to improve the population’s general state of health. © 2018 Suisse Life Science Group plc. All Rights Reserved.
  53. 53. suisselifescience.com 53 FOODTECH AND PERSONALISED NUTRITION Suisse Life Science has already developed, applied and validated all the steps that Food4Me - European Union project focused on personalized nutrition - acknowledged to translate individual health data into dietary recommendations: • Explore the best methods for phenotype characterisation, which can be used to assess nutritional status and provide targeted meal strategies. Phenotypic characterisation means assessing an individual by their physical, biochemical, and physiological traits. • Compile data on food choice, related nutrient intake, phenotypic data, and genotypic data. This will be used to create algorithms for personalised nutrition. • Map out guidelines that connect individualised phenotypes to suggested dietary changes. • Construct new personalised nutrition tools, including a meal nutrient database, meal coding system and a personalised recipe advice system. • Provide access to web-based information on healthy eating and meal planning. TRANSLATIONAL PERSONALISED NUTRITION TECHNOLOGY: • Level 1: Personalised analysis of an individual’s diet and make recommendations for improved food choice. • Level 2: Embraces all of level 1, and introduce phenotypic data in addition to dietary data. • Level 3: Embraces all of level 2, and introduces genotypic data in addition to phenotypic data and dietary data. Scientific ref: http://www.food4me.org/scientific-publications READY TO MARKET DATA-DRIVEN CONNECTED PERSONALIZED CONTEXTUALIZED IMMERSIVE © 2018 Suisse Life Science Group plc. All Rights Reserved.
  54. 54. suisselifescience.com 54 WHAT FUTURE FOR FOOD? NUTRITIONAL SYSTEMS BIOLOGY • 4,000 foods • 22 International cuisines • AR Healthy Menu Creator • 10 Medically validated dietary approaches (Mediterranean, Nordic, Zone, Okinawan, Elimination diet, Fasting mimicking, Alternate day fasting) caliberable on macros ration, Saturated fats control, Fiber, Glycemic index, Insulinemic index, ORAC, PRAL • BMR, Body frame index variation • Religion dietary restrictions (Halal, Hindu, Buddhist, Kosher) • Food intolerances (lactose, gluten, other (sulfites, Eggs, Milk protein, Peanuts, Dried fruits, Fruits (citrus), Legumes, Soybeans, Shellfish, Fish, Sesame, Sulfites, Meat, Cereals (wheat and corn), Apples, plums, apricots, peaches, cherries, almonds, pears, pineapple, Potatoes and solanaceae (tomatoes, peppers, chilies, aubergine, kiwi, eggplant, goji), Nickel) • Pseudo-allergic reactions (hystamine-rich foods, tyramine reaction …) • Metabolic exercise calculation • Food frequency and chrono-nutrition controls according to the chosen dietary approach • Food seasonality auto-setting • Shopping list. SPECIFIC PLANS FOR CHILDREN (age 5-6, 7-10), TEENS (age 11-14, 15-17) © 2018 Suisse Life Science Group plc. All Rights Reserved.
  55. 55. suisselifescience.com 55 NUTRITIONAL SYSTEMS BIOLOGY TECH                                                                      © 2018 Suisse Life Science Group plc. All Rights Reserved.
  56. 56. suisselifescience.com 56 NUTRITIONAL SYSTEMS BIOLOGY TECH (See how we train deep learning tech: https://youtu.be/-UHU0lYNwTY) © 2018 Suisse Life Science Group plc. All Rights Reserved.
  57. 57. suisselifescience.com 57 HCP DASHBOARD © 2018 Suisse Life Science Group plc. All Rights Reserved.
  58. 58. suisselifescience.com © 2017 Suisse Life Science Group plc. All Rights Reserved. 25Health Scale - London FOR FURTHER INFORMATION PLEASE CONTACT Omar Fogliadini omar.fogliadini@suisselifescience.com       omarfogliadini       omarfogliadini Suisse Life Science Group plc The DNA-Lifestyle Company suisselifescience.com SIGN UP FOR A DEMO OR BUSINESS APPLICATION CASES AT https://suisselifescience.com
  59. 59. suisselifescience.com 59 WHAT FUTURE FOR FOOD? MOLECULAR PERSONALISATION R&D/PRODUCT INNOVATION • New family of active ingredients Ref. http://www.actigenomics.com/products/ Swiss company Actigenomics offers natural “active nutrigenomic” ingredients, aimed specifically at avoiding the weakening of the immune system, the imbalance of bone metabolism and sleep disorders. The US company  Metagenics  sells dietary supplements based on nutrigenomics. Their Protectair range is specifically designed to “strengthen” intestinal flora (intestinal microbiota). Life Extension™ and Insilico Medicine have announced an exclusive collaborative effort to identify novel biomarkers of human aging through the use of big data analytics and artificial intelligence, with the ultimate goal of nutrient formulation discovery to support health and longevity. • Highly personalised ingredients selection to create mass customised products, for example: Children, Seniors, Ethnicity-based • Health-scientific ingredients or combinations for example: Diabetics, Alzheimer’s prevention, Heart health Nestlé, via its subsidiary Nestlé Health Science, is taking interest in so-called “nutritional therapies”. Focus on applying advanced signalling pathway activation analysis techniques and deep learning algorithms to find nutraceuticals that mimic the tissue-specific transcriptional response of many known interventions and pathways associated with health and longevity. They will also search for dietary ingredients referred to as "geroprotectors" that mimic the young healthy signaling state in older human tissues and use this information to develop novel nutraceutical products to support health and longevity. © 2018 Suisse Life Science Group plc. All Rights Reserved.
  60. 60. suisselifescience.com 60 WHAT FUTURE FOR FOOD? FOOD AS MEDICINE FUNCTIONAL MEDICINE is a science-based system of personalised medicine that focuses on the root causes of chronic illness and the correction of these underlying dysfunctions rather than treating symptoms. 
 FOOD IS NOT JUST THE SUM OF ITS NUTRIENTS The nutritional value of a food should be evaluated on the basis of the foodstuff as a whole, and not as an effect of the individual nutrients. Scientific references: The American Journal of Clinical Nutrition, http://ajcn.nutrition.org/content/105/5/1033 Whole dairy matrix or single nutrients in assessment of health effects: current evidence and knowledge gaps. Authors: Tanja Kongerslev Thorning, Hanne Christine Bertram, Jean-Philippe Bonjour, Lisette de Groot, Didier Dupont, Emma Feeney, Richard Ipsen, Jean Michel Lecerf, Alan Mackie, Michelle C McKinley, Marie-Caroline Michalski, Didier Rémond, Ulf Risérus, Sabita S Soedamah-Muthu, Tine Tholstrup, Connie Weaver, Arne Astrup, Ian Givens NUTRITIONAL ECOLOGY Current approaches to analysing human nutrition focusing on individual nutrients are inadequate and should be replaced by a more holistic approach, a research paper suggests. Nutritional ecology, therefore, focuses not specifically on the organism or its environment, but rather on the dynamic interface between organism and environment. Scientific references: Annual Review of Nutrition, Published online ahead of print, doi: 10.1146/annurev-nutr-071715-051118 “Nutritional Ecology And Human Health” Authors: Raubenheimer, D.; Simpson, S.J. © 2018 Suisse Life Science Group plc. All Rights Reserved.
  61. 61. suisselifescience.com 61 PERSONALISED SKINCARE03 © 2018 Suisse Life Science Group plc. All Rights Reserved.
  62. 62. suisselifescience.com 50 BEAUTY TECH AND PERSONALISED SKINCARE IS IT POSSIBLE TO DESIGN A PERSONALISED SKIN CARE REGIMEN WITH BESPOKE SKINCARE PAIRED WITH BEAUTY FOODS SUGGESTIONS AND DIETARY SUPPLEMENTS FOR SIMULTANEOUS AND MAXIMUM BENEFITS? Estimated to reach $675 billion by 2020, the global beauty industry is undergoing seismic change that will call for vast innovation and adaptation. According to WGSN-Future of Beauty the four key trends that will steer the beauty industry as we head into 2020 are: 1. NEXT GENERATION GENETICS 2. THE ALL-CLUSIVE CONSUMER 3. THE ALWAYS-ON ASSISTANT 4. NATURE HACKING. Suisse Life Science created as my iDDNA® as validation case history to show how its technology can differentiate: • Cosmetic manufacturers • Cosmetic etailers, retailers and pharmacies With streamlined, efficient, just-in-time process for a high-end, personalised beauty on-demand offer aimed to create a winning positioning, customer loyalty and sales. © 2018 Suisse Life Science Group plc. All Rights Reserved.

×