1- Identify one job position to develop- compentency based job descrip.docx

•Download as DOCX, PDF•

0 likes•2 views

1. Identify one job position to develop, compentency based job description (CBJD). 2. Explain the detail of the job such as relationship, grade, category and etc.). 3. Analyze the job responsibilities /job task for the chosen job (Min 5 job tasks). 4. Determine the related knowledge, skill, attitude and other abilities for each task. .

Education

1. The following represent various stages of cell division (mitosis/meiosis) in cells from the same individual organism. Size and shape of cell is not drawn to scale. R. C. D. What stage of mitosis or meiosis is represented by each drawing? A. B. C. D. E. What is the total number of chromosomes for a somatic cell (not sperm or egg) of the organism used in the images above? Make sure to use the proper symbols if it is a haploid or diploid cell. .

1- In cats- again- black color is dominant to a special- temperature-s.docx

Nicholas3uGPooled

1. In cats, again, black color is dominant to a special, temperature-sensitive albino gene which produces cats with dark legs, faces and tails (Siamese cats, in case you don't recognize it). A short haired (dominant) Siamese colored female is bred to a long-haired black male. They have eight kittens: 2 black, short-haired; 2 black, long-haired; 2 Siamese, short-haired; and 2 Siamese, long-haired. What were the genotypes of the two parents? .

1- The ability of a virus to infect one type of organism and not anoth.docx

Nicholas3uGPooled

1- The 3-part- multiple human brain refers to the A- brainstem- limbi.docx

Nicholas3uGPooled

1. The 3-part, multiple human brain refers to the A. brainstem, limbic system and cortex B. the somatic, sympathetic and parasympathetic systems C. dendrites, soma and axons 2. Fluid leaves closed circulatory systems A. lymph nodes B. fenestrated capillaries C. septa D. valves 3. Myelin is formed by A. axons B. the retina C. oligodendroglia D. astroglia 4. Neurons summarize information in their A. dendrites B. soma C. axon 5. Proprioceptors are located within A. bone B. muscle C. skin D. spinal cord 6. A major contributing factor to age-related disorders of the nervous system is A. humans live much longer than they used to B. genetic predisposition C. nutritional deficiencies D. all of these 7. The lymph system A. produces blood cells B. drains fluid from the body C. removes CO2 from tissues 8. The hippocampus participates in A. memory formation B. memory retrieval C. both 9. An artificial pacemaker A. maintains regular heartbeat B. controls pressure within arteries C. controls valve opening and closing 10. A myocardial infarction refers to A. a drop in blood pressure B. fatty deposits in arterie C. a tear in the wall of a vessel D. death of heart muscle 11. Hemoglobin A. carries oxygen B. carries CO2 C. carries both D. carries neither .

1- System in science- Types- Feedbacks 2- Nature of Physical Geography.docx

Nicholas3uGPooled

1. System in science/ Types/ Feedbacks 2. Nature of Physical Geography 3. How do we depict Earth's surface lelevation, depthirelief. 4. Latitude and Longitude, Time Zones, Great circles and Small circles. 5. Remote Sensing - basic concepts (Textbook P. 24-29) 6. Solar energy, Electromagnetic spectrum 7. Methods of energy transfer, Albedo, Heat and temperature / Greenhouse effect. 8. Sun-earth relation/ Sun anglel Why do we have seasons? 9. Atmospheric Structure (layers)/composition, Atmospheric Ozone 10. Air Pressure, Air Temperature and Air Density Their vertical variation. 11. Forces affecting airflow, Pressure gradient force, Coriolis force, Frictional force, Gravitational force. 12. Global Wind Patterns, Tropical Easterlies, MidLatitude Westerlies, Polar Easterlies, winds at upper levels/ Jet streams/ rotating winds, monsoons, Local winds, 13. Atmospheric Moisture, Moisture Parameters, moisture distribution. 14. What is Latent heat and Phase changes, types? 15. Air Lifting Mechanisms, Cloud Classification. Forms of Precipitation .

1- T-F- Annual borius plans are long-term executive inctitives- and at.docx

Nicholas3uGPooled

1. T.F. Annual borius plans are long-term executive inctitives, and atsce optiona arw shos. highs incured to erpolorets bused on heir. objoctives. developing a training plan, claritying a training budget and desging the traniog 7. T.F.As compared to time series analysis, controlled experimentaton a a vald and relable training evaluation mothod. 8. T.F. Upward 1 subordinates appraisal is when a supervisor conducts. the arnul Pertormance appraisal of empioyee under his her supervision. 9. T.F. The basic puipose of a performance appraisal system is to improve the petormatice of individuals, fearns, and the entire organ zation 10. T.F. Simulators are training and delivery systems commonly usod for training airline pilats. 11. T.F. Exit interviews are typically used as an employee selection method. 12. T.F. Achievament tests measure a candidate's knowledge of the job dubes. 13. T.F. Unlike other forms of tests, personalify tests do not focus an-qualites but are ratur designed to predict an employeels future perfocmance by locking at personal trats. temperamente, attitudes or dispositions. 14. T.F. Behavioral interviews ask applicants about specif everts as opposed to just hang them tell about themselves. 15. T.F. Sifuational interviews focus on how an individual handled job-related ciraumstances in the past. 16. T.F. According to Vroom's theory, if expectancy, instrumentaity, or valence is equal ts zarp. there will be no employee motivation. 17. T.F. Direct finaricial compensation consists of the poy that a person receses in the form of wages, salaries, and corminissions. 18. T.F. Edward Dec found that extrintic rewards could at times actualy detract hon the parson's intrifsic motivation. 19. T.F. Interviews are vald predictors of sucoess on the job, which is ahy they are commoriy used to evaluate applicants 20. T.F. During the proces of test validation, predictive validation invelves asminatering the test of the cufrent employees. 21 T.F. Intervidws can be made more efledive f the interviener studes the job deserigton and ustesz siandardized interview iorm. 23 The Pinis organizational stuctuce and gouis. at il ipencific bine .

1- Select all that apply- Software testing is a process that helps in.docx

Nicholas3uGPooled

1. Select all that apply. Software testing is a process that helps in __________ Group of answer choices Identifying systems issues/bugs. Mitigating legal liability Maximizing profits Increasing product value 2. Group of answer choices ___________________ gives a valuation for all program input variables. Test set Test review Test case Test inspection 3. Group of answer choices Which of the following is not a quality attribute of software? Interoperability Validity Efficiency Recoverability .

1- Reflected and stored are types of XSS attacks- 2- An attack has occ.docx

Nicholas3uGPooled

1. Reflected and stored are types of XSS attacks. 2. An attack has occurred on your network. An attacker was able to traverse several files and folders, looking for sensitive data. What type of attack has occurred? 3. AH is the protocol within IPSec used for encryption services. 4. As network administrator, you are concerned with the plaintext transmission of sensitive data on the network. Which of the following protocols are used to help secure communications? (Select three.) A. IPSec . HITP 5. To increase network security, you have decided to use HTTPS on your shopping cart site. Which of the following ports does HTTPS use? A. 80 B. 53 C. 443 D. 51 6. _____and AH are used to secure IPSec transmissions. 7. CSRF attacks exploit the trust a Web site has in a user's Web browser. 8. Kerberos is a(n)___ protocol. 9. To increase overall communication security, you decide to implement 3DES encryption. Which of the following statements is true of 3DES? 10. You are concerned about a cross-site forgery attack. Which of the following can you do to help prevent such an attack? 11. To establish IPSec encryption, two hosts must create a shared key with each other before SA negotiations can take place. .

1. Pandoravirus salinus is virus that infects amoeba, is very large ( 1 m ) and has a genome composed of double-stranded DNA that is 2.47 Mbp in size ( 247 , 000 , 000 bp). P . salinus has genes not typically associated with viruses, such as genes required for the synthesis of amino acids. In what ways might this force virologists to re-examine the definition of virus? 2. Many chemical biocides (disinfectants) target the lipid envelopes of viruses. Why would the chemical destruction of the envelope render the virus non-infectious? 3. Some viruses cause cancer. For example, Human Papillomavirus (HPV) that is associated with the development of cervical cancer and believed to play a role in head and neck tumors. Given what you know about viral replication, would the induction of cancer be beneficial to the virus? 4. What is one major way in which next generation sequencing differs from dideoxy sequencing (Sanger)? .

1- Joe Smith works in the IT department of a large industrial company-.docx

Nicholas3uGPooled

1. Joe Smith works in the IT department of a large industrial company. He is tasked with maintaining IT security for the company. He also teaches a night class at the local career tech center. He has overheard several of the students in the class talking about a software tool they downloaded that would allow them to launch automated software attacks. If the students were to use this software, what category of attacker would these students be considered? Cyberterrorists Brokers Insiders Cybercriminals Script Kiddies 2. Sally Wilson works for a small retail business and provides all IT support for the company. As part of her job, Sally has recently been tasked with ensuring that all IT systems are secured appropriately. To ensure company-wide IT security, Sally implemented a security awareness training program for all employees. After this training was completed, an employee informed Sally about the following situation: 1. The employee (Jim) mentioned that he was at a party and was befriended by a person that knew several of his other friends. This "new friend" began asking him about the company he worked for and was particularly interested in his company's marketing strategy for a new product being developing when Jim mentioned that he was the marketing manager. Jim was concerned and cautious as to any company information he provided. 2. As the party progressed, a drinking game was initiated which required players to provide information like: family member names, pet names, previous addresses, favorite colors and flowers, and a variety of other personal information. 3. A week for so after the party, Jim noticed that sporadically his email account would be locked out, and he would be required to reset his password to gain access. This occurred on several times and was continuing to occur. 4. Jim also received an email that indicated that his system password needed to be changed, and a URL was provided to access the web location for making the change. Sally was concerned that someone might be trying to hack into Jim's email and corporate access account. What security attack topic should she review with the company employees that was more than likely the beginning of this situation? Identity Theft Password Cracking Social Engineering Hoaxes Spear Phishing Dumpster Diving 3. George Mills works for a government agency in the IT security department. Upon arriving at work, he reviewed last night's network security logs and found indications that there was potential for a network security breach. Upon further inspection, it seems that an intruder from the Internet gained access to the internal network, accessed a server with enhanced privileges via a documented OS flaw, and installed a keylogger. Which of the following security defenses seem to be deficient in this situation? (Choose three) effective backup strategy implementation of least privilege regular operating system patching Up-to-date malware software proper firewall rules.

1- In order to beat- the heart requires A- nervous system input B- h.docx

Nicholas3uGPooled

1. In order to beat, the heart requires A. nervous system input B. hormonal signalling C. generates its own pulse 2. Voluntary movement is controlled by the A. somatic system B. autonomic system 3. __________________ means producing a few offspring, with a lot of parental care provided. A. Protective reproduction B. Shotgun reproduction C. Sexual reproduction D. Asexual reproduction 4. Following injury, a scar may form within brain tissue by A. blood vessel cells B. astroglia C. injured neurons D. microglia 5. The central nervous system consists of the A. brain and spinal cord B. sensory neurons C. motor neurons D. sensory and motor neurons 6. Background regulatory systems like are toggled up by the A. sympathetic system B. parasympathetic system C. somatic system .

1- In terms of the environment of early earth- what resulted from the.docx

Nicholas3uGPooled

1. In terms of the environment of early earth, what resulted from the development of photosynthesis? Cell Membranes Oceans An aerobic environment An anaerobic environment 2. Which of the following enzymes will create an RNA strand? DNA Polymerase Primase Helicase RNA Polymerase 3. Which of the following I S NOT a characteristic of living organisms? Can live with no energy provided by the external world Can convert molecules obtained from their environment into a new biological molecule Use genetic information to reproduce themselves Consist of one or more cells They evolve 4. Which of the following is not a force of evolution? Natural Selection Genetic Drift Mutation Gene Flow Vestigial Structures 5. True or False: Evolution is the optimization of organisms over multiple generations. 6. Which of the following is needed for natural selection to occur? (Select all that apply) Variation within a population Time Geographic isolation More offspring are produced than can survive. Traits are inherited by offspring. Two populations mating 7. Select all of the statements that are true of DNA DNA is double-stranded DNA is single-stranded DNA is less stable than RNA DNA is more stable than RNA DNA is directly involved in the synthesis of proteins. DNA is antiparallel. 8. True or False: Speciation due to two populations breeding at different times in the same area is an example of sympatric speciation 9. True or False: Allele frequencies can change within an organism 10. Which of the following is not a DNA sequence? AUGUGCGUAACUGUGA ATTTTGGGGGCCCCGGAATT ATGTGCGTAACTGTGA .

1- Implement a Python function that accepts an positive integer and re.docx

Nicholas3uGPooled

1. Implement a Python function that accepts an positive integer and returns a list of strings that resembles binary counting starting from aero up to the input number. A non-positive input integer must return an empty list. 2. A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward such as the number 108801 . Write a Python function that accepts either an integer or string and returns a tuple consisting of two possible palindromes that can be made from the input sequence. .

1- How may have the complex lifestyle of digentic trematodes evolved-.docx

Nicholas3uGPooled

1- identify and discuss the two most imporant factors in population dy (1).docx

Nicholas3uGPooled

1. identify and discuss the two most imporant factors in population dynamics, birth and death , and how theh shape population charecteristics. 2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns. 3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment. 2. demonstrate how the movement of population is affected by both push and pull factors and expain how these factors are key to understanding new settlement patterns. 3. describe the challenges of providing for the worlds growing population with adequate food and safe drinking water , as well as a sustainable enviroment. .

1- How does ancestry and race play into disease genetics- 2- How does.docx

Nicholas3uGPooled

1- Historical Development of Computing and Information Technology a) H.docx

Nicholas3uGPooled

1. Historical Development of Computing and Information Technology a) Historical Background b) The Development of the Microprocessor c) Development of Computer Software and the Personal Computer (PC) 2. Development of the Internet 3. Development of the World Wide Web 4. The Emergence of Social and Ethical Problems in Computing a) The Emergence of Computer Crimes b) The Present Status: An Uneasy Cyberspace 5. The Case for Computer Ethics Education a) What Is Computer Ethics? b) Why You Should Study Computer Ethics .

1- How has examining your beliefs- assumptions- and values related to.docx

Nicholas3uGPooled

1. How has examining your beliefs, assumptions, and values related to your historical and current events impacted how you process information in your daily life? For example, consider claims made by politicians, news headlines, tweets by celebrities, or articles shared by your family on social media. 2. What changes, big or small, have occurred in how you apply historical inquiry skills to classes, your personal life, and/or your career? .

1- Given the Trilemma- if a country has the free flow of capital and a.docx

Nicholas3uGPooled

1- Give a definition of heteroscedasticity- 2- For what reasons does h.docx

Nicholas3uGPooled

1- Give any relevant literature article pertaining to the patient cult.docx

Nicholas3uGPooled

1. Give any relevant literature article pertaining to the patient cultural background or promoting cultural competency among professionals 1b. Summary of the article? 1c. Discuss why it is related to patients in the hospital primarily mental illness patients with major depression with suicidal ideation. 2a, Summarize an article that is related to a patient nursing diagnosis with "ineffective coping related to depression" 3Summarize OTHER an article that is related to the psychiatric diagnosis (MAJOR DEPRESSION WITH SUICIDAL THOUGHT) Any article should be cited please, thanks .

1- Gas exchange occurs in which part of the respiratory system- Select.docx

Nicholas3uGPooled

1- Do you believe that technological determinism is a bad thing for bu.docx

Nicholas3uGPooled

1. Do you believe that technological determinism is a bad thing for businesses? Why or why not? 2. Many social media platforms are currently addressing the ethical lags that have developed surrounding user data and privacy. What responsibilities do you believe social media companies have to stakeholders in maintaining user data and privacy? Do you believe that new ethical questions may develop over time surrounding social media? .

1- Explain the purpose of change management and how it applies to infr.docx

Nicholas3uGPooled

1- Develop a timeline or or table that captures the evolution of quali.docx

Nicholas3uGPooled

1- During which of the following phases is the Moon's dark portion bri.docx

Nicholas3uGPooled

1- Discuss the scientific merit of various integrative modalities- 2-.docx

Nicholas3uGPooled

1. Discuss the scientific merit of various integrative modalities. 2. Examine scientific evidence to support the use of integrative health approaches to treatment. 3. Explore the economic impact of integrative approaches in the current healthcare system. 4. Apply cultural models to understand the use of integrative modalities. 5. Explore the ethics of using integrative modalities with health problems. 6. Collaborate with the interprofessional healthcare team to explore various integrative modalities. 7. Identify the credentials of integrative practitioners. .

1- Elevator and the Vertical Price of Office Space Draw a curve showin.docx

Nicholas3uGPooled

বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf

eBook.com.bd (প্রয়োজনীয় বাংলা বই)

বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত .. আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ... তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...। বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...

Your Skill Boost Masterclass: Strategies for Effective Upskilling

Excellence Foundation for South Sudan

Recently uploaded

বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf

eBook.com.bd (প্রয়োজনীয় বাংলা বই)

Your Skill Boost Masterclass: Strategies for Effective Upskilling

Excellence Foundation for South Sudan

Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...

Dr. Vinod Kumar Kanvaria

How to Setup Warehouse & Location in Odoo 17 Inventory

Celine George

Reimagining Your Library Space: How to Increase the Vibes in Your Library No ...

Diana Rendina

Librarians are leading the way in creating future-ready citizens – now we need to update our spaces to match. In this session, attendees will get inspiration for transforming their library spaces. You’ll learn how to survey students and patrons, create a focus group, and use design thinking to brainstorm ideas for your space. We’ll discuss budget friendly ways to change your space as well as how to find funding. No matter where you’re at, you’ll find ideas for reimagining your space in this session.

Main Java[All of the Base Concepts}.docx

adhitya5119

RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students

Himanshu Rai

How to Create a More Engaging and Human Online Learning Experience

Wahiba Chair Training & Consulting

NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx

iammrhaywood

How to Fix the Import Error in the Odoo 17

Celine George

How to Build a Module in Odoo 17 Using the Scaffold Method

Celine George

C1 Rubenstein AP HuG xxxxxxxxxxxxxx.pptx

mulvey2

A Independência da América Espanhola LAPBOOK.pdf

Jean Carlos Nunes Paixão

How to deliver Powerpoint Presentations.pptx

HajraNaeem15

คำศัพท์ คำพื้นฐานการอ่าน ภาษาอังกฤษ ระดับชั้น ม.1

สมใจ จันสุกสี

How to Manage Your Lost Opportunities in Odoo 17 CRM

Celine George

The basics of sentences session 6pptx.pptx

heathfieldcps1

BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...

Nguyen Thanh Tu Collection

Liberal Approach to the Study of Indian Politics.pdf

WaniBasim

Chapter wise All Notes of First year Basic Civil Engineering.pptx

Denish Jangid

Chapter wise All Notes of First year Basic Civil Engineering Syllabus Chapter-1 Introduction to objective, scope and outcome the subject Chapter 2 Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country. Chapter 3 Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements. Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station. Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps. Chapter 4 Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation Chapter 5 Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures. Chapter 6 Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems. Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect Text Books: 1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers. 2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers. 3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House. 4. BCP, Surveying volume 1

Recently uploaded (20)

বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf

Your Skill Boost Masterclass: Strategies for Effective Upskilling

Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...

How to Setup Warehouse & Location in Odoo 17 Inventory

Reimagining Your Library Space: How to Increase the Vibes in Your Library No ...

Main Java[All of the Base Concepts}.docx

RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students

How to Create a More Engaging and Human Online Learning Experience

NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx

How to Fix the Import Error in the Odoo 17

How to Build a Module in Odoo 17 Using the Scaffold Method

C1 Rubenstein AP HuG xxxxxxxxxxxxxx.pptx

A Independência da América Espanhola LAPBOOK.pdf

How to deliver Powerpoint Presentations.pptx

คำศัพท์ คำพื้นฐานการอ่าน ภาษาอังกฤษ ระดับชั้น ม.1

How to Manage Your Lost Opportunities in Odoo 17 CRM

The basics of sentences session 6pptx.pptx

BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...

Liberal Approach to the Study of Indian Politics.pdf

Chapter wise All Notes of First year Basic Civil Engineering.pptx