2007. stephen chanock. technologic issues in gwas and follow up studies
ACMG Workshop 2011
1. Detection of small intragenic deletions using targeted comparative genomic hybridization
2.
3.
4.
5. The OGT aCGH design process aCGH arrays All possible human genome probes Oligome TM database Further selection based on OGT probe rating and desired coverage and content Selection based on specificity, T m , GC, etc. Design & hyb two different aCGH arrays Optimised aCGH design = PRODUCT Selection of best performing probes based on experimental results
6.
7. Detection of Small intragenic Deletions Using Targeted Comparative Genomic Hybridization MadhuriHegde, Ph.D., FACMG Associate Professor Scientific Director, Emory Genetics Laboratory Department of Human Genetics Emory University Atlanta, GA
8. Scherer et al. (2007) Nat Genet 39:s7-s15 Genomic Variation G-banded karyotype FISH Microarray (~5 Mb)
9. aCGH FISH MLPA Real-Time PCR Deletion/Duplication Detection Methodology in clinical diagnostics
10. Purpose With the help of few examples of small deletions mapped in our laboratory, -illustrate the success of this technology -demonstrate the detection limits, and -discuss the lessons learnt thus far Scope Small intragenic deletions (~2.5 kb and shorter)
13. Probe density Keeping a balance: decrease redundancy while not compromising of sensitivity Duplication of Ex44
14. Exon-centric multi-gene high density array Designed to detect CNVs encompassing single and multiple exon Increase the cost-effectiveness without compromising on sensitivity
17. Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC) Autosomal dominant inheritance 37 year old male personal and a family history of multiple cutaneousleiomyomatosis
19. 2 year old East Indian male with a biochemical diagnosis of MSUD. Maple Syrup Urine Disease Autosomal Recessive inheritance c.871C>T (p.R291X) nonsense mutation in exon 7 of DBT gene identified
22. PAH Phenylketonuria (PKU) Autosomal recessive inheritance - two mutations in trans Metabolic disorder - biochemical profile adds to clinical suspicion
23.
24. exons PAH gene (~79 kb) 13 9 6 3 1 PKU case 1 PKU case 2
25. 868 bp 1,286 bp Exon 6 Exon 7 Two unrelated individuals with the same deletion PKU case 1 PKU case 2 PAH gene
26. Allele 1 1134 bp Allele 2 ~350 bp 100 200 300 case 1 case 2 Allele specific PCR
27. Green: Repeat masker Red: polymorphisms (SNP) CAPITAL: exon Underlined: primers Breakpoint within a SINE: MIRb family Breakpoint within a exon 6 Red box: “CT” is the microhomology at breakpoints.
28. 868 bp 1,286 bp 800 bp 800 bp Partial exon 6 deletion Exon 6 Exon 7 Intron 6 PKU case 1 PKU case 2 Note: breakpoint within an element
29. STK11 Peutz-Jeghers syndrome (PJS) Autosomal dominant inheritance - one mutation Clinical Presentation & Family History
32. +1 -1 0 Possible deletion encompassing exon 3 Designing allele specific PCR 1076 bp exons 2 3 4 AluY Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT1_1F ex2_1F INT2_1F INT2_2F INT2_3F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R
33. Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT2_2F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R Data indicates a possible deletion of ~1kb. Expected band size in bp Possible exon 3 deletion 678 1130 1324 1580 1595
34. Proximal breakpoint 1170072 in intron 2 Distal breakpoint 1171039 in intron 3 Reference Reference Patient Patient
35. +1 -1 0 Note: breakpoints outside of element A few probes that did not perform ideally were unique exons 2 3 4 1076 bp 967 bp AluY
40. Exon 5 Max (2757bp) Min (381bp) Int4_1 Int4_2 Int4_3 Int4_4 Intron 4 Intron 5 Int5_4 HPRT_Int5_5R Int5_6 Int5_2 Int5_1 Int5_3 Int5_5 HPRT_Int4_1F HPRT_Int4_2F HPRT_Int5_5R 2745 bp fragment expected in wild type 2657 bp fragment expected in wild type 88bp size difference 500- 400- 300- 500- 400- 300-
41. Mapped a total of 380 bp in the amplicon 157 bp of intron 4 69 bp insertion 154 bp of intron 5 157 bp of intron 4 69 bp insertion
42. The Inserted 69 bpsequence match best on a gene desert on Chromsome 5. ATTCTAGTGATGTTTTCAGGCCTCAGGGGGCGGGTTGGGGGTGGTGGAGGTGGTGTGTATAATATCACT
43.
44. Wt Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Pt. water Exon 1 and 2 did not amplify for the patient
47. Wt expected band with 1F/2R Would be 480 bp For Wt expected band with 1F/3R Would be 677 bp Band ~370 bp Suggesting ~300 bp deletion Band ~170 bp Suggesting ~300 bp deletion Forward Primer 1F 1F Reverse Primer 2R 3R Wt Pt. H2O Wt Pt. H2O 1kb+ -100 -200 -300 -400 -500 -650 -850 -------1000
48. exon1 exon2 Red nucleotides are deleted. Exons are capitalized Microhomology is limited to two nucleotides, “GC”
Madhuri Hegde, PhD, FACMG Associate Professor – Scientific Director Emory Genetics Lab Emory University School of Medicine
Madhuri Hegde, PhD, FACMG Associate Professor – Scientific Director Emory Genetics Lab Emory University School of Medicine
Extract from paper: Figure 1 - Lexicon of genomic variation. Descriptors of variation began in the realm of cytogenetics, followed by those from the field of molecular genetics and, most recently, by technologies such as those described in this perspective, which bridge the gap for detection of genomic variants (sometimes called cytogenomics 55 ). The designation of the category '1 kb to submicroscopic' is somewhat arbitrary at both ends, but is used for operational definition. In a broad sense, structural variation has been used to refer to genomic segments both smaller and larger than the narrower operational definition, as illustrated by the large bracket. The focus of recent discoveries has been the subgroup in the midrange (indicated with strong highlighting), but the gradation of shading illustrates that the biological boundaries may really encompass some forms of variation previously recognized from either cytogenetic or molecular genetic approaches. At the molecular level, SNPs can be identified that are representative of the underlying haplotype structure (tagSNPs). As structural variation becomes better integrated with the existing SNP-based linkage disequilibrium maps, it is likely that presence or absence of many structural variants will simply be inferred by typing selected SNPs
The modified Emory designs consist of panels of disease specific groups. For example, genes associated with neuromuscular dystrophy, x-linked intellectual disability and Duchene muscular dystrophy. There are also other panels of genes, for example, associated with cancer, diabetes and hearing loss. Contact us directly for more information on the disorders and genes included.
Contact us directly for more information on the disorders and genes included.
![Today’s agenda ,[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)