Detection of small intragenic deletions using targeted comparative genomic hybridization
Today’s agenda <ul><li>Welcome — Dr. Mike Evans </li></ul><ul><li>Detection of small intragenic deletions using targeted c...
Innovative clinical genetics and diagnostic  solutions to advance molecular medicine  <ul><li>Founded by Ed Southern in 19...
CytoSure cytogenetics range    high quality data    meaningful results    standardisation <ul><ul><li>Arrays </li></ul>...
The OGT aCGH design process aCGH arrays All possible human genome probes Oligome TM  database Further selection based on O...
Today’s agenda <ul><li>Welcome — Dr. Mike Evans </li></ul><ul><li>Detection of small intragenic deletions using targeted c...
Detection of Small intragenic Deletions Using Targeted Comparative Genomic Hybridization MadhuriHegde, Ph.D., FACMG Associ...
Scherer et al. (2007) Nat Genet 39:s7-s15 Genomic Variation G-banded karyotype FISH Microarray (~5 Mb)
aCGH FISH MLPA  Real-Time PCR Deletion/Duplication Detection Methodology  in clinical diagnostics
Purpose With the help of few examples of small deletions mapped in our laboratory,  -illustrate the success of this techno...
<ul><li>Outline </li></ul><ul><li>Introduction </li></ul><ul><li>-Array design @ EGL </li></ul><ul><li>-Examples of deleti...
Probe distribution A.  GeneTargeted C.  Whole Genome B.  GeneTargeted with Backbone
Probe density Keeping a balance: decrease redundancy while not compromising of sensitivity Duplication of Ex44
Exon-centric multi-gene high density array Designed to detect CNVs encompassing single and multiple exon Increase the cost...
4x180k 4x180k 8x60k   EGL_XLIDplus_v2 EGL_NMD_NBSplus_v2 EGL_DMDplus_V2           ASD 8784 ASD 8784     Cancer 9598 Cancer...
Examples of intragenic deletions
Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC) Autosomal dominant inheritance 37 year old male personal and a fam...
exons 10  9  8  7  6  5  4  3  2  1 Familial mutation: Deletion  ~  19 kb  encompassing exon 2 to 9 of the  FH  gene FH  g...
2 year old East Indian male with a biochemical diagnosis of MSUD.  Maple Syrup Urine Disease Autosomal Recessive inheritan...
-0.6 ~-0.8 exons 11  5  4  3  2  1 Deletion  ~  3.7 kb  encompassing exon 5of the  DBT  gene DBT  gene (~63 kb) +1 -1 0 De...
Even Shorter Intragenic Deletions (< 2.5 kb)
PAH Phenylketonuria (PKU) Autosomal recessive inheritance - two mutations in trans  Metabolic disorder - biochemical profi...
Patient Reference G AA  Glutamicacid A AA  Lysine  Patient Reference Exon 12  Intron 12 PKU case 1 <ul><li>Age: 6.6 years ...
exons PAH  gene (~79 kb) 13  9  6  3  1 PKU case 1 PKU case 2
868 bp 1,286 bp Exon 6 Exon 7 Two unrelated individuals with the same deletion PKU case 1 PKU case 2 PAH  gene
Allele 1  1134 bp Allele 2  ~350 bp 100 200 300 case 1  case 2 Allele specific PCR
Green: Repeat masker Red: polymorphisms (SNP) CAPITAL: exon Underlined: primers Breakpoint within a SINE: MIRb family Brea...
868 bp 1,286 bp 800 bp 800 bp Partial exon 6 deletion Exon 6 Exon 7 Intron 6 PKU case 1 PKU case 2 Note: breakpoint within...
STK11 Peutz-Jeghers syndrome (PJS) Autosomal dominant inheritance - one mutation Clinical Presentation & Family History
<ul><li>Age: 30 years </li></ul><ul><li>Gender: female </li></ul><ul><li>Ethnicity: Caucasian </li></ul>Personal history o...
exons STK11  gene (~22 kb) +1 -1 0 1  2  3  4,5 6  7  8  9  10
+1 -1 0 Possible deletion encompassing exon 3 Designing allele specific PCR 1076 bp exons 2  3  4 AluY Exon3 Intron2 Intro...
Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT2_2F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R Data indicates a possible d...
Proximal breakpoint 1170072 in intron 2 Distal breakpoint 1171039 in intron 3 Reference Reference Patient Patient
+1 -1 0 Note: breakpoints outside of element A few probes that did not perform ideally were unique exons 2  3  4 1076 bp 9...
HPRT1 Lesch-Nyhan Syndrome X-linked inheritance - one mutation Clinical Presentation & Family History
Lesch-Nyhan case Pending prenatal 24 year old female for carrier testing for a familial  HPRT1  mutation ? ?
exons HPRT1  gene (~40.5 kb) 1  2  3  4  5  6  7,8  9 +1 -1 0 -5 ? ?
2,780 bp Exon 5 is 18 bp +1 -1 0 -5
Exon 5 Max (2757bp) Min (381bp) Int4_1 Int4_2 Int4_3 Int4_4 Intron 4 Intron 5 Int5_4 HPRT_Int5_5R Int5_6 Int5_2 Int5_1 Int...
Mapped a total of 380 bp in the amplicon 157 bp of intron 4 69 bp insertion 154 bp of intron 5 157 bp of intron 4 69 bp in...
The Inserted 69 bpsequence match best on a gene desert on Chromsome 5. ATTCTAGTGATGTTTTCAGGCCTCAGGGGGCGGGTTGGGGGTGGTGGAGGT...
EMD case <ul><li>Age: 46 year </li></ul><ul><li>Gender: male </li></ul><ul><li>Ethnicity: caucasian </li></ul>
Wt Ex1  Ex2  Ex3  Ex1  Ex2  Ex3  Ex1  Ex2  Ex3  Pt. water Exon 1 and 2 did not amplify for the patient
exons EMD  gene (~2 kb) +1 -1 0 1  2  3  4  5  6 -2 -3 -4 -5
exons 1  2 252 bp +1 -1 0 -5
Wt expected band  with 1F/2R Would be 480 bp For Wt expected band  with 1F/3R Would be 677 bp Band ~370 bp Suggesting ~300...
exon1 exon2 Red nucleotides are deleted. Exons are capitalized Microhomology is limited to two nucleotides, “GC”
Deletion encompassing Partial exon 1 and entire exon 2 exons 1  2 252 bp 366 bp +1 -1 0 -5
Conclusions <ul><li>aCGH has come light years ahead from MLPA days </li></ul><ul><li>We cover all the genes that we sequen...
Acknowledgements Directors: Bradford Coffee Ph.D. FACMG Lora Bean Ph.D. FACMG Katie Rudd Ph.D. FACMG Alice Tanner Ph.D. C....
Today’s agenda <ul><li>Welcome — Dr. Mike Evans </li></ul><ul><li>Detection of small intragenic deletions using targeted c...
Modified Emory panel designs — available now! <ul><li>Modified Emory panel designs now available from OGT </li></ul><ul><u...
Disorders covered <ul><li>Autism Spectrum Disorders </li></ul><ul><li>Congenital Abnormalities </li></ul><ul><li>Congenita...
Thank you www.ogt.co.uk
Upcoming SlideShare
Loading in …5
×

ACMG Workshop 2011

1,202 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,202
On SlideShare
0
From Embeds
0
Number of Embeds
127
Actions
Shares
0
Downloads
16
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Madhuri Hegde, PhD, FACMG Associate Professor – Scientific Director Emory Genetics Lab Emory University School of Medicine
  • Madhuri Hegde, PhD, FACMG Associate Professor – Scientific Director Emory Genetics Lab Emory University School of Medicine
  • Extract from paper: Figure 1 - Lexicon of genomic variation. Descriptors of variation began in the realm of cytogenetics, followed by those from the field of molecular genetics and, most recently, by technologies such as those described in this perspective, which bridge the gap for detection of genomic variants (sometimes called cytogenomics 55 ). The designation of the category &apos;1 kb to submicroscopic&apos; is somewhat arbitrary at both ends, but is used for operational definition. In a broad sense, structural variation has been used to refer to genomic segments both smaller and larger than the narrower operational definition, as illustrated by the large bracket. The focus of recent discoveries has been the subgroup in the midrange (indicated with strong highlighting), but the gradation of shading illustrates that the biological boundaries may really encompass some forms of variation previously recognized from either cytogenetic or molecular genetic approaches. At the molecular level, SNPs can be identified that are representative of the underlying haplotype structure (tagSNPs). As structural variation becomes better integrated with the existing SNP-based linkage disequilibrium maps, it is likely that presence or absence of many structural variants will simply be inferred by typing selected SNPs
  • The modified Emory designs consist of panels of disease specific groups. For example, genes associated with neuromuscular dystrophy, x-linked intellectual disability and Duchene muscular dystrophy. There are also other panels of genes, for example, associated with cancer, diabetes and hearing loss. Contact us directly for more information on the disorders and genes included.
  • Contact us directly for more information on the disorders and genes included.
  • ACMG Workshop 2011

    1. 1. Detection of small intragenic deletions using targeted comparative genomic hybridization
    2. 2. Today’s agenda <ul><li>Welcome — Dr. Mike Evans </li></ul><ul><li>Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde </li></ul><ul><li>Closing remarks </li></ul>
    3. 3. Innovative clinical genetics and diagnostic solutions to advance molecular medicine <ul><li>Founded by Ed Southern in 1995 </li></ul><ul><li>64 people </li></ul><ul><li>State-of-the-art facilities </li></ul><ul><li>3 core brands </li></ul>OGT Begbroke: Corporate offices and high throughput labs OGT Southern Centre: Biomarker discovery
    4. 4. CytoSure cytogenetics range  high quality data  meaningful results  standardisation <ul><ul><li>Arrays </li></ul></ul><ul><ul><ul><li>ISCA, UPD and Syndrome Plus </li></ul></ul></ul><ul><ul><ul><li>Chromosome X </li></ul></ul></ul><ul><ul><ul><li>Aneuploidy </li></ul></ul></ul><ul><ul><ul><li>DMD* </li></ul></ul></ul><ul><ul><ul><li>Oligome custom arrays </li></ul></ul></ul><ul><ul><ul><li>New! Modified Emory panel designs </li></ul></ul></ul><ul><ul><li>Labelling kits / sample tracking spikes </li></ul></ul><ul><ul><li>Software </li></ul></ul><ul><ul><li>Reagents and consumables </li></ul></ul><ul><ul><li>Full automation options </li></ul></ul><ul><ul><li>CytoSure Services </li></ul></ul>* Not available in USA
    5. 5. The OGT aCGH design process aCGH arrays All possible human genome probes Oligome TM database Further selection based on OGT probe rating and desired coverage and content Selection based on specificity, T m , GC, etc. Design & hyb two different aCGH arrays Optimised aCGH design = PRODUCT Selection of best performing probes based on experimental results
    6. 6. Today’s agenda <ul><li>Welcome — Dr. Mike Evans </li></ul><ul><li>Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde </li></ul><ul><li>Closing remarks </li></ul>
    7. 7. Detection of Small intragenic Deletions Using Targeted Comparative Genomic Hybridization MadhuriHegde, Ph.D., FACMG Associate Professor Scientific Director, Emory Genetics Laboratory Department of Human Genetics Emory University Atlanta, GA
    8. 8. Scherer et al. (2007) Nat Genet 39:s7-s15 Genomic Variation G-banded karyotype FISH Microarray (~5 Mb)
    9. 9. aCGH FISH MLPA Real-Time PCR Deletion/Duplication Detection Methodology in clinical diagnostics
    10. 10. Purpose With the help of few examples of small deletions mapped in our laboratory, -illustrate the success of this technology -demonstrate the detection limits, and -discuss the lessons learnt thus far Scope Small intragenic deletions (~2.5 kb and shorter)
    11. 11. <ul><li>Outline </li></ul><ul><li>Introduction </li></ul><ul><li>-Array design @ EGL </li></ul><ul><li>-Examples of deletions </li></ul><ul><li>Examples of small deletions mapped </li></ul><ul><ul><li>Autosomal recessive disease gene PAH </li></ul></ul><ul><ul><li>Autosomal dominant disease gene SKT11 </li></ul></ul><ul><ul><li>X-linked gene HPRT1 and EMD </li></ul></ul>obvious ones Near the detection limit
    12. 12. Probe distribution A. GeneTargeted C. Whole Genome B. GeneTargeted with Backbone
    13. 13. Probe density Keeping a balance: decrease redundancy while not compromising of sensitivity Duplication of Ex44
    14. 14. Exon-centric multi-gene high density array Designed to detect CNVs encompassing single and multiple exon Increase the cost-effectiveness without compromising on sensitivity
    15. 15. 4x180k 4x180k 8x60k   EGL_XLIDplus_v2 EGL_NMD_NBSplus_v2 EGL_DMDplus_V2           ASD 8784 ASD 8784     Cancer 9598 Cancer 9598     CDG 4908 CDG 4908     Congenital abnormality 13373 Congenital abnormality 13373     Congenital heart disease 16421 Congenital heart disease 16421     Cystic 12271 Cystic 12271         Diabetes 941     Eyes 961 Eyes 961     Growth disorder 51 Growth disorder 51         Hearing Loss 2392     Hemoglobinopathy 42 Hemoglobinopathy 42         Leukodystrophy 2273         LSD 6596         Metabolic 8742     Mitochondrial 485 Mitochondrial 485     MR 7704             NBS 14149         NMD 47414 NMD 47414 Others 5874 Others 5874     XLMR 77999                 DMD 12713
    16. 16. Examples of intragenic deletions
    17. 17. Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC) Autosomal dominant inheritance 37 year old male personal and a family history of multiple cutaneousleiomyomatosis
    18. 18. exons 10 9 8 7 6 5 4 3 2 1 Familial mutation: Deletion ~ 19 kb encompassing exon 2 to 9 of the FH gene FH gene (~22 kb) +1 -1 0 Deletion ~ 19 kb
    19. 19. 2 year old East Indian male with a biochemical diagnosis of MSUD. Maple Syrup Urine Disease Autosomal Recessive inheritance c.871C>T (p.R291X) nonsense mutation in exon 7 of DBT gene identified
    20. 20. -0.6 ~-0.8 exons 11 5 4 3 2 1 Deletion ~ 3.7 kb encompassing exon 5of the DBT gene DBT gene (~63 kb) +1 -1 0 Deletion 3.7 kb
    21. 21. Even Shorter Intragenic Deletions (< 2.5 kb)
    22. 22. PAH Phenylketonuria (PKU) Autosomal recessive inheritance - two mutations in trans Metabolic disorder - biochemical profile adds to clinical suspicion
    23. 23. Patient Reference G AA Glutamicacid A AA Lysine Patient Reference Exon 12 Intron 12 PKU case 1 <ul><li>Age: 6.6 years </li></ul><ul><li>Gender: male </li></ul><ul><li>Ethnicity: Hispanic </li></ul>Established patient of PKU Currently enrolled in the Kuvan study at Emory One copy of the c.838G>A (p.E280K) missense mutation in exon 7 of PAH gene PKU case 2 <ul><li>Age: 4 months </li></ul><ul><li>Gender: female </li></ul><ul><li>Ethnicity: Hispanic </li></ul>Picked up on NBS, Elevated plasma phenylalanine. One copy of the IVS12+1G>A splice donor site mutation
    24. 24. exons PAH gene (~79 kb) 13 9 6 3 1 PKU case 1 PKU case 2
    25. 25. 868 bp 1,286 bp Exon 6 Exon 7 Two unrelated individuals with the same deletion PKU case 1 PKU case 2 PAH gene
    26. 26. Allele 1 1134 bp Allele 2 ~350 bp 100 200 300 case 1 case 2 Allele specific PCR
    27. 27. Green: Repeat masker Red: polymorphisms (SNP) CAPITAL: exon Underlined: primers Breakpoint within a SINE: MIRb family Breakpoint within a exon 6 Red box: “CT” is the microhomology at breakpoints.
    28. 28. 868 bp 1,286 bp 800 bp 800 bp Partial exon 6 deletion Exon 6 Exon 7 Intron 6 PKU case 1 PKU case 2 Note: breakpoint within an element
    29. 29. STK11 Peutz-Jeghers syndrome (PJS) Autosomal dominant inheritance - one mutation Clinical Presentation & Family History
    30. 30. <ul><li>Age: 30 years </li></ul><ul><li>Gender: female </li></ul><ul><li>Ethnicity: Caucasian </li></ul>Personal history of polyps and intussusceptions and family history of cancer; paternal aunt with breast cancer and paternal grandmother with pancreatic cancer.
    31. 31. exons STK11 gene (~22 kb) +1 -1 0 1 2 3 4,5 6 7 8 9 10
    32. 32. +1 -1 0 Possible deletion encompassing exon 3 Designing allele specific PCR 1076 bp exons 2 3 4 AluY Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT1_1F ex2_1F INT2_1F INT2_2F INT2_3F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R
    33. 33. Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT2_2F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R Data indicates a possible deletion of ~1kb. Expected band size in bp Possible exon 3 deletion 678 1130 1324 1580 1595
    34. 34. Proximal breakpoint 1170072 in intron 2 Distal breakpoint 1171039 in intron 3 Reference Reference Patient Patient
    35. 35. +1 -1 0 Note: breakpoints outside of element A few probes that did not perform ideally were unique exons 2 3 4 1076 bp 967 bp AluY
    36. 36. HPRT1 Lesch-Nyhan Syndrome X-linked inheritance - one mutation Clinical Presentation & Family History
    37. 37. Lesch-Nyhan case Pending prenatal 24 year old female for carrier testing for a familial HPRT1 mutation ? ?
    38. 38. exons HPRT1 gene (~40.5 kb) 1 2 3 4 5 6 7,8 9 +1 -1 0 -5 ? ?
    39. 39. 2,780 bp Exon 5 is 18 bp +1 -1 0 -5
    40. 40. Exon 5 Max (2757bp) Min (381bp) Int4_1 Int4_2 Int4_3 Int4_4 Intron 4 Intron 5 Int5_4 HPRT_Int5_5R Int5_6 Int5_2 Int5_1 Int5_3 Int5_5 HPRT_Int4_1F HPRT_Int4_2F HPRT_Int5_5R 2745 bp fragment expected in wild type 2657 bp fragment expected in wild type 88bp size difference 500- 400- 300- 500- 400- 300-
    41. 41. Mapped a total of 380 bp in the amplicon 157 bp of intron 4 69 bp insertion 154 bp of intron 5 157 bp of intron 4 69 bp insertion
    42. 42. The Inserted 69 bpsequence match best on a gene desert on Chromsome 5. ATTCTAGTGATGTTTTCAGGCCTCAGGGGGCGGGTTGGGGGTGGTGGAGGTGGTGTGTATAATATCACT
    43. 43. EMD case <ul><li>Age: 46 year </li></ul><ul><li>Gender: male </li></ul><ul><li>Ethnicity: caucasian </li></ul>
    44. 44. Wt Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Pt. water Exon 1 and 2 did not amplify for the patient
    45. 45. exons EMD gene (~2 kb) +1 -1 0 1 2 3 4 5 6 -2 -3 -4 -5
    46. 46. exons 1 2 252 bp +1 -1 0 -5
    47. 47. Wt expected band with 1F/2R Would be 480 bp For Wt expected band with 1F/3R Would be 677 bp Band ~370 bp Suggesting ~300 bp deletion Band ~170 bp Suggesting ~300 bp deletion Forward Primer 1F 1F Reverse Primer 2R 3R Wt Pt. H2O Wt Pt. H2O 1kb+ -100 -200 -300 -400 -500 -650 -850 -------1000
    48. 48. exon1 exon2 Red nucleotides are deleted. Exons are capitalized Microhomology is limited to two nucleotides, “GC”
    49. 49. Deletion encompassing Partial exon 1 and entire exon 2 exons 1 2 252 bp 366 bp +1 -1 0 -5
    50. 50. Conclusions <ul><li>aCGH has come light years ahead from MLPA days </li></ul><ul><li>We cover all the genes that we sequence </li></ul><ul><li>(except two that have pseudogenes) </li></ul><ul><li>Array design has been a continuous process </li></ul><ul><ul><li>Time to assess individual probe performance </li></ul></ul><ul><li>Small Intragenic deletions (<2.5 kb) data is valuable </li></ul><ul><li>Insight into the mechanism </li></ul><ul><li>Most breakpoints have 2-3 bases of microhomology at breakpoints </li></ul><ul><li>Duplications? </li></ul>
    51. 51. Acknowledgements Directors: Bradford Coffee Ph.D. FACMG Lora Bean Ph.D. FACMG Katie Rudd Ph.D. FACMG Alice Tanner Ph.D. C.G.C. SyedHussainAskree, MBBS, PhD EphremLip Hon Chin, BS (Tech), CLSp (MB)
    52. 52. Today’s agenda <ul><li>Welcome — Dr. Mike Evans </li></ul><ul><li>Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde </li></ul><ul><li>Closing remarks </li></ul>
    53. 53. Modified Emory panel designs — available now! <ul><li>Modified Emory panel designs now available from OGT </li></ul><ul><ul><li>Including complimentary class-leading CytoSure Interpret Software </li></ul></ul>Visit booth 416 for disorder lists and special introductory offer
    54. 54. Disorders covered <ul><li>Autism Spectrum Disorders </li></ul><ul><li>Congenital Abnormalities </li></ul><ul><li>Congenital Disorders of Glycosylation </li></ul><ul><li>Congenital Heart Disease </li></ul><ul><li>Cystic Disorders </li></ul><ul><li>Diabetes </li></ul><ul><li>Duchenne Muscular Dystrophy* </li></ul><ul><li>Eye Disorders </li></ul><ul><li>Hearing Loss </li></ul><ul><li>Hemoglobinopathy </li></ul><ul><li>Inheritable Cancer </li></ul><ul><li>Intellectual Disability (MR) </li></ul><ul><li>Leukodystrophy </li></ul><ul><li>Lysomal Storage Disorders </li></ul><ul><li>Metabolic Disorders </li></ul><ul><li>Mitochondrial Disorders </li></ul><ul><li>Neuro Muscular Dystrophy </li></ul><ul><li>X Linked Intellectual Disabilities </li></ul>* Not available in US.
    55. 55. Thank you www.ogt.co.uk

    ×