2. Diversity can also be introduced in a targeted fashion where
changes are limited to selected sites in the antibody, such as the
complementarity determining regions (CDRs) or the vernier
framework regions (FRs), which are structurally adjacent to the
CDRs (Foote and Winter, 1992). Several site-specific mutagen-
esis procedures are available for the efficient incorporation of
mutagenized primers, such as the ‘QuikChange’ method, now
marketed by Agilent (Weiner et al., 1994). A commonly used
method in phage display is ‘Kunkel mutagenesis’ (Kunkel,
1985; Scholle et al., 2005; Fellouse et al., 2007; Huang et al.,
2012), where a uracil-incorporated, circular, single-stranded
DNA (ssDNA) serves as a template to synthesize double-
stranded DNA (dsDNA) in vitro with an oligonucleotide primer
that introduces a mutation(s). After dsDNA is introduced into
bacteria, recombinant clones predominate due to cleavage and
repair-bias of the uracilated strand in vivo. Because it avoids
ligating the product into a vector, the Kunkel mutagenesis
reaction is very efficient, yielding >108
recombinant clones
from a single transformation. However, the method requires
specifically designed randomized primers for each clone that
needs to be improved (Huang et al., 2012).
Here, we have developed a novel means for the generation
of mutagenized libraries for directed evolution. Our method
relies on the ability of T7 exonuclease to sequentially hydrolyze
DNA in the 5′ → 3′ direction and its inability to hydrolyze DNA
that contains several phosphorothioate groups at its 5′ terminus
(Nikiforov et al., 1994). In our method, a large (i.e., 800 nt
long), mutated DNA fragment is produced using polymerase
chain reaction (PCR) conditions that promote nucleotide
misincorporation into newly synthesized DNA. In the PCR
reaction, one of the primers contains phosphorothioate linkages
at its 5′ end. Treatment of the error-prone generated PCR
product with T7 exonuclease is used to preferentially
remove the strand synthesized with the non-modified
primer, resulting in a single-stranded DNA segment, or
‘megaprimer’. We demonstrate the use of this megaprimer
in a Kunkel-like mutagenesis reaction that takes advantage
of the E. coli DNA base excision repair pathway to bias
nucleotide base-changes between the megaprimer and a
complementary uracilated DNA sequence in favor of the in
vitro synthesized megaprimer. We show that this strategy
enables the efficient generation of libraries with diversity three
orders of magnitude greater than those generated using a
conventional error-prone PCR and subcloning approach.
2. Materials and methods
2.1. Bacterial strains and vectors
The CJ236 strain (Genotype: FΔ (HindIII)::cat (Tra+
Pil+
CamR
)/ung-1 relA1 dut-1 thi-1 spoT1 mcrA) was purchased from
New England BioLabs (Waverly, MA). This strain lacks functional
dUTPase and uracil N-glycosylase, and yields uracilated, single-
stranded DNA template when infected with M13 bacteriophage.
The TG1 E. coli strain (F′ (traD36 proAB + lacIq lacZΔM15) supE
thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5, (rK−
mK−
)) was pur-
chased from Lucigen (Middleton, WI). pAX143 is a derivative of
the phagemid, pAP-III6 (Haidaris et al., 2001) with a single-chain
variable fragment antibody (scFv) fused to coat protein III of
bacteriophage M13. The scFv in pAX143 contains opal (TGA)
stop codons and SacII restriction enzyme recognition sites in
each of the CDRs, rendering non-recombinant clones non-
functional with respect to the display of the scFv.
2.2. Transformation of CJ236 strain
An aliquot (25 μl) of electrocompetent CJ236 cells is
pipetted into a chilled 0.1 cm gap cuvette, and 1 μl of pAX143
plasmid DNA is added to the cells in the cuvette. The cells are
electroporated at 1.6 kV, 25 μF, and 200 Ω in a Bio-Rad Gene
Pulser electroporator (Hercules, CA). Immediately after elec-
troporation, 1 ml of SOC media (2% tryptone, 0.5% yeast
extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM
MgSO4, 20 mM glucose) is added and the media plus cells are
transferred to a 14 ml culture tube for incubation at 37 °C, with
shaking at ~225 revolutions per min (rpm) for 1 h (hr). At the
end of the hour, 250 μl of the transformed cells are spread
directly on a Petri plate containing Luria Broth (LB; 10 g/l
tryptone, 5 g/l yeast extract, 10 g/l NaCl, 1.5% agar), chloram-
phenicol (33 μg/ml), and ampicillin (100 μg/ml). The plates are
incubated overnight at 37 °C.
2.3. Production of uracilated, circular, single-stranded template
(dU-ssDNA)
This protocol was adapted from Fellouse and Sidhu (2007).
To a culture tube, 1 ml of the growth media, LB with ampicillin
(60 μg/ml), and 100 μl of M13K07 helper phage (New England
BioLabs, 1011
colony forming units/ml) are added. Thirty
colonies from an overnight transformation plate are added
into each culture tube with a single 10 μl pipette tip. The
culture tube is shaken at 200 rpm at 37 °C. After 2 h, 0.5 μl of
Kanamycin stock (for a final concentration of 30 μg/ml) is
added to each culture tube and the tube is shaken at 225 rpm at
37 °C for 6 h (or until cloudy). Each culture is then diluted into
30 ml of fresh 2× YT medium (per liter: 16 g tryptone, 10 g
yeast extract, 5 g NaCl) containing ampicillin (60 μg/ml),
Kanamycin (30 μg/ml), and uridine (0.3 μg/ml) in a 250 ml
baffled flask. The cultures are shaken at 225 rpm overnight
(approximately 18 h) at 30 °C. A 30 ml cell culture is transferred
to a round bottom centrifuge tube and the cells were pelleted for
15 minutes (min) at 15,000 rpm in a Sorvall RC-5B centrifuge
using an SS34 rotor (or equivalent) at 4 °C. The supernatant is
filtered using a 0.22 μm filter and transferred to a new round
bottom tube containing 1/5 volume (6 ml for each 30 ml
culture) of 20% PEG8000/2.5 M NaCl. Each tube is sealed with
Parafilm, inverted several times to mix, and then incubated
for 60 min on ice. Each tube is spun at 4 °C for 20 min at
10,000 rpm in the Sorvall RC-5B centrifuge using an SS34
rotor. The supernatant is decanted, the tube was respun at
5000 rpm in the Sorvall RC-5B centrifuge using an SS34 rotor
for 5 min, and the remaining liquid was aspirated using a
pipette. The pellet of precipitated phage particles is resuspended
in 500 μl of sterile PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM
Na2PO4, 1.47 mM KH2PO4, pH 7.4) and transferred to a 1.7 ml
Eppendorf tube. The resuspended phage is spun for 5 min at 4 °C
in a bench-top microcentrifuge (14,000 rpm), to remove any
remaining cell debris. The supernatant is transferred to a new
1.7 ml tube. The dU-ssDNA is purified using the M13 extraction
kit from Qiagen (Valencia, CA). The eluate, which contains the
uracilated-containing ssDNA is analyzed by running 1.0 μl on a
1% agarose Tris–acetate–EDTA (TAE: 40 mM Tris, 20 mM acetic
56 E.G. Holland et al. / Journal of Immunological Methods 394 (2013) 55–61
3. acid, 1 mM EDTA) gel. DNA should appear as a predominant
single band, but faint bands of lower electrophoretic mobility are
often visible. These are likely caused by secondary structure in
the dU-ssDNA.
2.4. Error prone PCR
The Error-prone PCR protocol of Cadwell and Joyce (1994)
was followed. Briefly, 10 μl of 10× mutagenic PCR buffer
(70 mM MgCl2, 500 mM KCl, 100 mM Tris (pH 8.3), 0.1%
(wt/vol) gelatin) is combined with 10 μl of 10× dNTP mix
(2 mM dGTP, 2 mM dATP, 10 mM dCTP, 10 mM dTTP),
20 fmol of input DNA, 30 pmol each of forward and reverse
primers, and H2O for a final volume of 88 μl. For amplifying the
scFv genes we used the following two oligonucleotide primers:
AXL6AS4-PCRR 5′Phos-G*T*C*G*ACTGAGGAGACGGTGACC-3′
and AXL6KunkPCRF2, 5′AAGCTTTCCTATGAGCTGACACAGCC-3′.
The primers were synthesized by Integrated DNA Technologies
(Coralville, IA), where * corresponds to a phosphorothioate
linkage. Ten microliters of 5 mM MnCl2 is then added, mixed
well, and the absence of any precipitate was visually verified.
Two microliters of Taq DNA polymerase is added to bring the
final volume to 100 μl. Cycling conditions consist of 30 cycles
of: 94 °C 1 min, 55 °C 1 min, and 72 °C 1 min. After PCR is
complete, cleanup is performed using the Qiagen QIAquick PCR
Purification Kit according to the manufacturer's protocol. The
purified DNA is eluted in 40 μl of buffer EB (Qiagen). For scFvs,
we expect a PCR amplification product of approximately 800
base pairs.
2.5. T7 exonuclease treatment
Forty microliters of the cleaned-up PCR product (20 pmol)
is incubated with 10 μl T7 exonuclease (10,000 units per ml,
New England BioLabs) in 1× buffer 4 (50 mM Potassium
acetate, 20 mM Tris–acetate, 10 mM Magnesium acetate,
1 mM Dithiothreitol, pH 7.9). The reaction is incubated at
25 °C for 1 h, and the T7 exonuclease treated sample is purified
using the Qiagen QIAquick PCR Purification Kit and eluted in
40 μl EB buffer.
2.6. DNA heteroduplex formation
Forty microliters of T7 exonuclease treated- and
cleaned-up reaction (~20 pmol) is mixed with 13 μl or 4 μl
of pAX143 ssDNA (12 pmol or 4 pmol for the 2:1 and 5:1
ratios of megaprimer to dU-ssDNA, respectively), 25 μl of
10× TM buffer (0.1 M MgCl2, 0.5 M Tris, pH 7.5) buffer, and
dH20 for a final reaction volume of 250 μl. For the reactions
with synthetic oligonucleotides, we annealed 600 nano-
grams (ng) of the non-phosphorothioated oligonucleotide
(/5Phos/GTCGACTGAGGAGACGGAATTCAGGGTGCCCGGGCC
CCAGTG) or phosphorothioated oligonucleotide (/5Phos/
G*T*C*G*ACTGAGGAGACGGAATTCAGGGTGCCCGGGCCCCA-
GTG) to 20 μg of dU-containing ssDNA template, pAX143, in
1× TM buffer. The annealing reaction is carried out by heating
the mixture at 90 °C for 2 min, followed by a temperature
decrease of 1 °C per minute to 25 °C in a thermal cycler. To the
annealed product, 10 μl of 10 mM ATP, 10 μl of 100 mM dNTP
mix, 15 μl of 100 mM DTT, 0.5 μl (30 U) T4 DNA ligase and 3 μl
(30 U) T7 DNA polymerase are added. The mixture is
distributed equally into five PCR tubes and incubated overnight
(16 h) at 20 °C.
The DNA is desalted and purified using a Qiagen QIAquick
DNA purification kit. One milliliter of buffer QG (Qiagen) is added
and the reaction is mixed. The sample is applied to two QIAquick
spin columns placed in 1.7 ml microcentrifuge tubes. The
columns are spun at 13,000 rpm for 1 min in a microcentrifuge,
and the flow-through discarded. To each column, 750 μl of buffer
PE is added and the sample is spun again at 13,000 rpm in a
microcentrifuge. The column is transferred to a clean 1.7 ml
microcentrifuge tube, and DNA is eluted from each column in
35 μl of buffer EB (Qiagen's QIAquick DNA purification kit). The
eluates from the two columns (70 μl final) are combined. Two
microliter of the product is resolved by agarose gel electropho-
resis, alongside 2 μl of ssDNA. For the heteroduplex product, up
to 3 bands are generally observed: the upper (and often most
prevalent) band corresponds to strand displaced DNA, the
middle (usually faint) band corresponds to nicked DNA (i.e.,
not properly extended and ligated), and the lower band
represents the extended and ligated product. The ssDNA runs
faster than the ligated band.
2.7. Standard subcloning
For traditional cloning of the error-prone PCR product, the
DNA is digested with HindIII and SalI and ligated into the pAPIII6
vector for phage display (Haidaris et al., 2001). Recombinants
are verified by PCR and DNA sequencing.
2.8. Library transformation
Transformation reactions are set up as follows: 0.5 μl
heteroduplex DNA or ligation product is mixed with 25 μl of
TG1 electrocompetent cells (Lucigen) and added to a 0.1 cm
gap cuvette. DNA is electroporated into bacterial cells using a
Gene Pulser (Bio-Rad, at the following settings: 1.6 kV, 200 Ω,
25 μF). One milliliter of recovery media is added and the
electroporated cells are transferred to 14 ml culture tubes and
shaken at 37 °C. After 1 h, 2 μl of the culture is removed and
diluted 10−2
into 198 μl of LB media and vortexed to mix.
Then, using a clean pipette, 2 μl of the 10−2
dilution is further
diluted into 198 μl of LB media for a 10−4
dilution. These 10−2
serial dilutions are repeated up to 10−14
. One hundred
microliter of each of the dilutions is plated onto LB plates
containing ampicillin (100 μg/ml), and the plates are incubated
overnight at 37 °C.
3. Results
3.1. The AXM mutagenesis approach
We have developed a new method of generating diverse
libraries for directed evolution experiments. In our method,
a large error-prone PCR product is produced using PCR
conditions that promote nucleotide misincorporation by a
thermal stable DNA polymerase into newly synthesized DNA
(Cadwell and Joyce, 1994). Unlike conventional approaches,
however, the PCR reaction is carried out with a pair of primers
of which one contains phosphorothioate linkages on its 5′
terminus. The treatment of the resulting PCR product with a 5′
to 3′ exonuclease (i.e., T7 exonuclease) preferentially degrades
57E.G. Holland et al. / Journal of Immunological Methods 394 (2013) 55–61
4. the strand synthesized with the non-modified primer and
generates a single-stranded DNA fragment. This fragment can
then serve as a megaprimer to prime DNA synthesis on a
uracilated, circular, single-stranded template (dU-ssDNA) in a
Kunkel-like mutagenesis reaction that biases nucleotide base-
changes between the megaprimer and uracilated DNA se-
quence in favor of the in vitro synthesized megaprimer (Fig. 1).
This method eliminates the inefficient subcloning steps that are
normally required for the construction of affinity maturation
libraries from randomly mutagenized antibody genes (Thie et
al., 2009). The same approach can be applied to generating
secondary libraries of phage-displayed scaffold proteins, such
as FN3 monobodies, DARPins, affibodies, lipocalins, or green
fluorescent protein (GFP) (Hackel et al., 2008; Milovnik et al.,
2009; Lindborg et al., 2011; Schlehuber et al., 2000; Xiong et al.,
2012).
3.2. Conversion of double-stranded PCR product to single-stranded
megaprimer
For this new approach to be effective, an error-prone PCR
product must be efficiently converted to single-stranded DNA.
We took advantage of the knowledge that oligonucleotides
containing phosphorothioate bonds are resistant to nuclease
activity and that phosphodiester bonds can be chemically
substituted with phosphorothioates to protect the DNA from
cleavage by exonucleases (Nikiforov et al., 1994). Exonucleases
encoded by bacteriophages T7 and lambda hydrolyze double-
stranded DNA in the 5′ to 3′ direction. We determined that if one
of the 5′ ends is selectively protected from the hydrolytic action
of T7 exonuclease, then the opposite strand could be hydrolyzed
completely by the enzyme.
DNA fragments of 800 base pairs from amplification of
an scFv gene under conditions that favor nucleotide
misincorporation were treated either with or without T7
exonuclease for 1 h at 25 °C. Following treatment, the
products were visualized on a native acrylamide gel stained
with SYBR Gold. The single-stranded DNA product shows a
slower mobility than the corresponding double-stranded DNA
(Fig. 2). As expected, T7 exonuclease fully degrades the
unprotected DNA if neither primer contains phosphorothioates.
Interestingly, one or two phosphorothioate residues on the 5′
end of one primer do not provide sufficient protection from the
hydrolytic action of the enzyme (Fig. 2). However, when one of
the 5′ ends has 3 or 4 phosphorothioates, the terminus of one
strand resists degradation, and the PCR product is fully converted
to single-stranded DNA (Fig. 2).
3.3. Use of megaprimer for Kunkel mutagenesis
Once we were able to generate single-stranded PCR
products efficiently, we next considered the possibility that
phosphorothioates might influence the efficiency of Kunkel
mutagenesis by interfering with the biased repair of the
uracilated DNA strand in favor of the in vitro synthesized,
recombinant strand in E. coli. To test this hypothesis, we
generated a synthetic oligonucleotide containing four
phosphorothioate linkages at its 5′ end and used it for
Kunkel mutagenesis in parallel with the same oligonucle-
otide lacking the phosphorothioates. The heteroduplex DNA
products were transformed into E. coli TG1 cells that encode
wild type uracil N-glycosylase, which removes uracils from
DNA and consequently favors the propagation of the recombi-
nant, non-uracilated strand. Recombinants were generated
from both the unmodified and modified oligonucleotides at
rates of 44% and 50%, respectively (Table 1), indicating that
phosphorothioate oligonucleotides can be employed in Kunkel
mutagenesis experiments.
We then substituted the synthetic oligonucleotide for the
megaprimer generated by T7 exonuclease treatment of an 800
base pair PCR fragment, corresponding to a mutated scFv coding
region. Since the mutated megaprimer is 20 times larger than
the typical oligonucleotide primer, the ratio of the megaprimer
to the dU-ssDNA template had to be optimized in order to
achieve efficient production of a heteroduplex product (Fig. 3).
Following electroporation of the dsDNA product into TG1 cells,
individual clones were sequenced. Recombinants were generat-
ed at a rate of 46%, which is comparable to the efficiencies
observed with synthetic oligonucleotide primers (Table 1). In
addition to full recombinants, the megaprimer reaction also
yielded some partial recombinants, in which only part of
the megaprimer sequence was incorporated (Table 1). These
products may result from incompletely extended PCR products
that were converted to ssDNA by T7 exonuclease serving as
primers of in vitro DNA synthesis.
3.4. Generation of diverse libraries using AXM mutagenesis
To compare our new method to the conventional approach of
generating affinity maturation libraries by error-prone PCR, the
same scFv coding region was amplified by error-prone PCR and
subcloned into the phagemid vector using standard molecular
biology techniques (Thie et al., 2009). Following electroporation
of the ligated product into TG1 cells, serial dilutions were plated
onto solid media in order to get an estimate of the number of
Affinity
Select
Fig. 1. AXM mutagenesis procedure. The coding region for the recombinant antibody (rAb) is amplified under error-prone PCR conditions, using a reverse primer
containing phosphorothioate linkages on its 5′ end. The resulting double-stranded DNA is treated with T7 exonuclease to selectively degrade the unmodified
strand of the dsDNA molecule. The resulting single-stranded DNA, or ‘megaprimer’, is then annealed to the uracilated, circular, single-stranded phagemid DNA
and used to prime in vitro synthesis by DNA polymerase. The ligated, heteroduplex product is then transformed into E. coli TG1 cells, where the uracilated strand
is cleaved in vivo by uracil N-glycosylase, favoring survival of the newly synthesized, recombinant strand containing the megaprimer.
58 E.G. Holland et al. / Journal of Immunological Methods 394 (2013) 55–61
5. transformants. Individual clones were sequenced to determine
the percentage of recombinants and mutation frequencies.
Among the transformants from the standard library, 75%
were recombinant, and on average, each recombinant clone
had 8 mutations, which is equal to a point mutation rate of
approximately 1% (Table 2). A similar mutation rate of 1.5% was
observed using the AXM mutagenesis approach (Table 2). The
frequency of recombinants was slightly lower for the AXM
mutagenesis derived library than for the library generated by
standard cloning (46% versus 75%, respectively), due to some
persistence of the parental single-strand template. However,
the overall number of bacterial transformants was three orders
of magnitude higher using the AXM mutagenesis approach
(2.8 × 108
versus 1 × 105
, respectively). Based on these
efficiencies, the overall library diversity from a single transfor-
mation using the AXM mutagenesis approach was approxi-
mately 108
recombinant clones (Table 2). To achieve a similar
size library using the standard approach would require one
thousand transformations, making the AXM mutagenesis
approach an attractive alternative for generating libraries for
the purpose of directed evolution.
4. Discussion
Affinity maturation is an important part of the recombinant
antibody development process as strong binding is required for
many therapeutic and diagnostic applications. There are several
well-established approaches for generating libraries of mutated
scFv coding regions for affinity maturation, but neither approach
is sufficiently fast or inexpensive to allow high-throughput,
parallel processing of multiple antibodies simultaneously.
Random mutagenesis by error-prone PCR is a universal approach
that utilizes a common set of primers that are easy to synthesize.
However, an inefficient subcloning step is required to incorpo-
rate the mutagenized scFv gene into a new vector, so many E. coli
transformations are needed to generate diverse libraries of
greater than 106
clones. A site-directed mutagenesis approach,
like Kunkel mutagenesis, is more efficient, yielding greater than
108
recombinant clones from a single transformation, but
specifically designed randomized primers are typically required
for each clone, making this approach costly to apply to many
antibodies simultaneously.
We sought an affinity maturation approach that would
combine the universal nature of error-prone PCR with the
efficiency of Kunkel mutagenesis to rapidly generate libraries
of high diversity at a reasonable cost. To this end, we developed
an efficient method of converting an error-prone PCR product
to a single-stranded megaprimer that can substitute for a
synthetic oligonucleotide primer in the Kunkel mutagenesis
reaction. Several approaches have been described for generat-
ing single-stranded DNA from a PCR reaction, such as
asymmetric PCR, where one strand is linearly amplified using
Fig. 2. Conversion of PCR product to ssDNA megaprimer. T7 exonuclease was
added (lanes 7–11) to error-prone PCR products (lanes 2–6), which were
generated using an unmodified forward primer and a phosphorylated reverse
primer containing either 0, 1, 2, 3, or 4 phosphorothioates at its 5′ terminus. The
products were resolved by native polyacrylamide gel electrophoresis, and the gel
was stained with SYBR Gold. As can be seen from the gel, at least three
phosphorothioates are required at the 5′ terminus to protect a strand from the
exonucleolytic activity of T7 exonuclease.
Table 1
Analysis of recombinants from Kunkel mutagenesis reactions.
Input DNA Number of recombinants Number of non-recombinants Number of partial recombinants % recombinants
Standard oligonucleotide primer 7 9 0 44
Phosphorothioated oligoprimer 8 8 0 50
Phosphorothioated megaprimer 12 5 9 46
Fig. 3. Conversion of ssDNA to heteroduplex DNA. DNA synthesis products
from heteroduplexes, formed by annealing the single-stranded megaprimer
to uracilated, circular ssDNA, were analyzed by agarose gel electrophoresis.
Lanes M, 1, 2, and 3 correspond to marker (2 log DNA ladder; New England
BioLabs), uracilated, circular ssDNA (pAX143) alone, heteroduplex formed
with 2:1 ratio of megaprimer to dU-ssDNA, and heteroduplex formed with
5:1 ratio of megaprimer to dU-ssDNA, respectively. ssDNA, single-stranded
DNA; hetDNA, heteroduplex DNA.
59E.G. Holland et al. / Journal of Immunological Methods 394 (2013) 55–61
6. unequal concentrations of primers (Huang et al., 2012), or
asynchronous PCR, where two primers have melting temper-
atures that differ by 10 to 30 °C (Chen et al., 2011). Due to the
linear amplification, however, results using these methods
have been reported to be variable (Huang et al., 2012).
Another commonly used approach is alkaline denaturation
of biotinylated PCR products attached to streptavidin-coated
magnetic beads (Wilson, 2011). However, interfering amounts
of streptavidin and biotinylated DNA can be released using this
method (Wilson, 2011).
We have taken advantage of a more efficient approach for
the conversion of a PCR product from a standard exponential
amplification to a single-stranded megaprimer. In this method,
one PCR primer is modified at its 5′ end with the incorporation
of phosphorothioate bonds (16). These phosphorothioates
provide protection of one strand of the initial double-stranded
PCR product from the hydrolytic action of the 5′ to 3′
exonuclease T7 while the opposite, non-protected strand
is hydrolyzed. Although it has been observed that one or
two phosphorothioates on the 5′ end of an oligonucleotide
can inhibit degradation by 5′ exonucleases in mammalian
cells (Samani et al., 2001), we found that one or two
phosphorothioates was insufficient to prevent hydrolysis
by T7 exonuclease in vitro, whereas the addition of 3 or 4
phosphorothioates resulted in complete protection of the
corresponding strand.
Another strategy that has been recently described used one
5′ phosphorylated PCR primer and took advantage of the
preferential cleavage of 5′ phosphorylated ends over non-
phosphorylated 5′ ends by lambda exonuclease, to convert a
PCR product to single-stranded DNA (Lim et al., 2012). A
disadvantage of this approach is that non-phosphorylated 5′
ends are also attacked, albeit at a slower rate and they are,
therefore, not completely protected from degradation. Since
a 5′ phosphate is needed for proper ligation of heteroduplex
products in the Kunkel mutagenesis reaction, the single-
stranded DNA generated using this method would require a
subsequent incubation with kinase to introduce a 5′ phosphate.
In contrast, the phosphorothioate-containing primers used for
AXM mutagenesis can be synthesized with a 5′ phosphate,
allowing the single-stranded product to be used directly in the
heteroduplex reaction. The phosphorothioates may provide
an additional benefit in vivo by protecting any incompletely
ligated heteroduplex product from degradation by endogenous
exonucleases in E. coli (Wang et al., 2011), preventing biased
incorporation of mutations in the Kunkel mutagenesis reaction.
We found that phosphorothioates do not interfere with the
repair of the DNA in vivo, most likely because bacteria contain
DNA that is phosphorothioate modified naturally at specific
sequences (Xie et al., 2012).
We have demonstrated that the AXM mutagenesis ap-
proach allows the efficient generation of libraries with 108
recombinant clones from a single transformation. The conven-
tional error-prone PCR and subcloning approach required
one-thousand transformations to yield a library of equiva-
lent size. Hence, the new method represents a substantial
savings in both cost and labor. The same approach that we
have developed can be applied to generating secondary
libraries of phage-displayed scaffold proteins, such as FN3
monobodies, DARPins, affibodies, lipocalins, or green fluo-
rescent protein (GFP) (Hackel et al., 2008; Milovnik et al.,
2009; Lindborg et al., 2011; Schlehuber et al., 2000; Xiong et
al., 2012). Since the parent single-strand template used for
AXM mutagenesis contains Sac II restriction sites in the CDR
regions, further improvements, including cleavage of paren-
tal clones by a Sac II isoschizomer in vivo to increase the
percentage of recombinant clones in the library, are being
tested.
Acknowledgments
This work was supported by the National Institutes of
Health [1 U54 DK093444-01].
References
Cadwell, R.C., Joyce, G.F., 1994. Mutagenic PCR. PCR Methods Appl. 3, S136.
Chen, C., Ruff, D., Halsey, J., 2011. Asynchronous PCR. Methods Mol. Biol. 687, 231.
Coia, G., Ayres, A., Lilley, G.G., Hudson, P.J., Irving, R.A., 1997. Use of mutator
cells as a means for increasing production levels of a recombinant
antibody directed against Hepatitis B. Gene 201, 203.
Emond, S., Mondon, P., Pizzut-Srin, S., Douchy, L., Crozet, F., Bouayadi, K.,
Kharrat, H., Potocki-Veronese, G., et al., 2008. A random mutagenesis
approach using human mutagenic DNA polymerases to generate
enzyme variant libraries. Protein Eng. Des. Sel. 21, 267.
Fellouse, F.A., Sidhu, S.S., 2007. Making antibodies in bacteria. In: Howard,
G.C., Hahn, K.O., Kaser, M.R. (Eds.), Making and Using Antibodies: A
Practical Handbook. Taylor and Francis Group, Boca Raton, FL.
Fellouse, F.A., Esaki, K., Birtalan, S., Raptis, D., Cancasci, V.J., Koide, A., Jhurani, P.,
Vasser, M., Wiesmann, C., Kossiakoff, A.A., Koide, S., Sidhu, S.S., 2007. High-
throughput generation of synthetic antibodies from highly functional
minimalist phage-displayed libraries. J. Mol. Biol. 373, 924.
Foote, J., Winter, G., 1992. Antibody framework residues affecting the
conformation of the hypervariable loops. J. Mol. Biol. 224, 487.
Fromant, M., Blanquet, S., Plateau, P., 1995. Direct random mutagenesis of
gene-sized DNA fragments using polymerase chain reaction. Anal.
Biochem. 224, 347.
Hackel, B.J., Kapila, A., Wittrup, K.D., 2008. Picomolar affinity fibronectin
domains engineered utilizing loop length diversity, recursive mutagenesis,
and loop shuffling. J. Mol. Biol. 38, 1238.
Haidaris, C.G., Malone, J., Sherrill, L.A., Bliss, J.M., Gaspari, A.A., Insel, R.A.,
Sullivan, M.A., 2001. Recombinant human antibody single chain variable
fragments reactive with Candida albicans surface antigens. J. Immunol.
Methods 257, 185.
Huang, R., Fang, P., Kay, B.K., 2012. Improvements to the Kunkel mutagenesis
protocol for constructing primary and secondary phage-display libraries.
Methods 58, 10.
Jackel, C., Kast, P., Hilvert, D., 2008. Protein design by directed evolution.
Annu. Rev. Biophys. 37, 153.
Kunkel, T.A., 1985. Rapid and efficient site-specific mutagenesis without
phenotypic selection. Proc. Natl. Acad. Sci. U. S. A. 82, 488.
Lim, B.N., Choong, Y.S., Ismail, A., Glokler, J., Konthur, Z., Lim, T.S., 2012.
Directed evolution of nucleotide-based libraries using lambda exonu-
clease. Biotechniques 53, 357.
Lindborg, M., Cortez, E., Holden-Guthenberg, I., Gunneriusson, E., von Hage, E.,
Syud, F., Morrison, M., Abrahmsen, L., Herne, N., Pietras, K., Frejd, F.Y.,
2011. Engineered high-affinity affibody molecules targeting platelet-
derived growth factor receptor beta in vivo. J. Mol. Biol. 407, 298.
Table 2
Comparison of library diversities generated either by the conventional approach or the AXM mutagenesis method.
Mutagenesis method Number of transformants % recombinants Library diversity Average number of mutations Mutation rate of recombinants
Standard error-prone PCR 1.00E+05 75 7.50E+04 8.3 1.1
AXM mutagenesis 2.80E+08 46 1.29E+08 11.7 1.5
60 E.G. Holland et al. / Journal of Immunological Methods 394 (2013) 55–61
7. Martineau, P., 2002. Error-prone polymerase chain reaction for modification
of scFvs. Methods Mol. Biol. 178, 287.
Milovnik, P., Ferrari, D., Sarkar, C.A., Pluckthun, A., 2009. Selection and
characterization of DARPins specific for the neurotensin receptor 1.
Protein Eng. Des. Sel. 22, 357.
Nikiforov, T.T., Rendle, R.B., Kotewicz, M.L., Rogers, Y.-H., 1994. The use of
phosphorothioate primers and exonuclease hydrolysis for the prepara-
tion of single-stranded PCR products and their detection by solid-phase
hybridization. PCR Methods Appl. 3, 285.
Samani, T.D., Jolles, B., Laigle, A., 2001. Best minimally modified antisense
oligonucleotides according to cell nuclease activity. Antisense Nucleic
Acid Drug Dev. 11, 129.
Schlehuber, S., Beste, G., Skerra, A., 2000. A novel type of receptor protein,
based on the lipocalin scaffold, with specificity for digoxigenin. J. Mol.
Biol. 297, 1105.
Scholle, M.D., Kehoe, J.W., Kay, B.K., 2005. Efficient construction of a large
collection of phage-displayed combinatorial peptide libraries. Comb.
Chem. High Throughput Screen. 8, 545.
Smith, G.P., Scott, J.K., 1993. Libraries of peptides and proteins displayed on
filamentous phage. Methods Enzymol. 217, 228.
Stemmer, W.P., 1994. Rapid evolution of a protein in vitro by DNA shuffling.
Nature 370, 389.
Thie, H., Voedisch, B., Dubel, S., Hust, M., Schirrmann, T., 2009. Affinity maturation
by phage display. In: Dimitrov, A.S. (Ed.), Therapeutic Antibodies: Methods
and Protocols, vol. 525. Humana Press.
Wang, H.H., Xu, G., Vonner, A.J., Church, G., 2011. Modified bases enable high-
efficiency oligonucleotide-mediated allelic replacement via mismatch repair
evasion. Nucleic Acids Res. 39, 7336.
Waterhouse, P., Griffiths, A.D., Johnson, K.S., Winter, G., 1993. Combinatorial
infection and in vivo recombination: a strategy for making large phage
antibody repertoires. Nucleic Acids Res. 21, 2265.
Weiner, M.P., Costa, G.L., Schoettlin, W., Cline, J., Mathur, E., Bauer, J.C., 1994.
Site-directed mutagenesis of double-stranded DNA by the polymerase
chain reaction. Gene 151, 119.
Wilson, R., 2011. Preparation of single-stranded DNA from PCR products
with streptavidin magnetic beads. Nucleic Acid Ther. 21, 437.
Xie, X., Liang, J., Pu, T., Xu, F., Yao, F., Yang, Y., Zhao, Y.-L., You, D., Zhou, X., Deng, Z.,
Wang, Z., 2012. Phosphorothioate DNA as an antioxidant in bacteria. Nucleic
Acids Res. 40, 9115.
Xiong, A.S., Peng, R.H., Zhuang, J., Davies, J., Zhang, J., Yao, Q.H., 2012.
Advances in directed molecular evolution of reporter genes. Crit. Rev.
Biotechnol. 32, 133.
Zaccolo, M., Williams, D.M., Brown, D.M., Gherardi, E., 1996. An approach to
random mutagenesis of DNA using mixtures of triphosphate derivatives
of nucleoside analogs. J. Mol. Biol. 255, 589.
61E.G. Holland et al. / Journal of Immunological Methods 394 (2013) 55–61
