1. Expression Patterns of Tdp2 and Top2β in Danio rerio
Kevin Loftis*, Lacy Thompson, Bonny B. Millimaki Ph.D.
Department of Biology, Lipscomb University, Nashville, Tennessee
References
Champoux JJ (2001) DNA topoisomerases: Structure, function, and mechanism. Annu Rev Biochem 70:369–413.
Cuvier O, Hirano T (2003) A role of topoisomerase II in linking DNA replication to chromosome condensation. J Cell Biol 160:645–655.
Tiwari, V. K., Burger, L., Nikoletopoulou, V., Deogracias, R., Thakurela, S., Wirbelauer, C., ... & Schübeler, D. (2012). Target genes of Topoisomerase IIβ regulate neuronal survival and are
defined by their chromatin state. Proceedings of the National Academy of Sciences, 109(16), E934-E943.
Watanabe M, Tsutsui K, Tsutsui K, Inoue Y (1994) Differential expressions of the topoisomerase II alpha and II beta mRNAs in developing rat brain. Neurosci Res 19: 51–57.
S. Pype, W. Declercq, A. Ibrahimi, C. Michiels, J.G. Van Rietschoten, N. Dewulf, M. de Boer, P. Vandenabeele, D. Huylebroeck, J.E. Remacle (2000)
TTRAP, a novel protein that associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor-associated factors (TRAFs), and that inhibits nuclear factor-kappa B
activation J. Biol. Chem., 275, pp. 18586–18593
Gómez-Herreros, F., Schuurs-Hoeijmakers, J. H., McCormack, M., Greally, M. T., Rulten, S., Romero-Granados, R., ... & Caldecott, K. W. (2014). TDP2 protects transcription from abortive
topoisomerase activity and is required for normal neural function. Nature genetics, 46(5), 516-521..
Xia Yang, Wei Li, Elizabeth D. Prescott, Steven J. Burden, and James C. Wang(2000)DNA Topoisomerase IIβ and Neural Development Science 287 (5450), 131-134.
[DOI:10.1126/science.287.5450.131]
Thompson, L., Millimaki, B. (2014) Expression profile of top2b in developing zebrafish embryos
Sean-Arno, N.S., Williams, A., Millimaki, B., (2014) Semi-quantitaion & localization of tdp2-beta in Danio rerio development
Results
Figure 3: PCR Product
from tdp2 primers and
cDNA. Insert into
expression vector
200bp
100bp
300bp
400bp
500bp
Conclusion and Future Directions
100bp
Ladder
tdp2
insert
0.5kb
1.0kb
1.5kb
2.0kb
3.0kb
4.0kb
5.0kb
Figure 4: Linearized expression vector with tdp2(left) insert
from Figure 3 ligated into it . Linearized expression vector
with top2b probe insert ligated into it. The labeled bands
correspond to which RNA polymerase to be used in probe
synthesis.
1kb Ladder tdp2 SP6 tdp2 T7 1kb Ladder top2b SP6
0.5kb
1.0kb
1.5kb
2.0kb
3.0kb
5.0kb
4.0kb
top2b T7
tdp2 RNA Probe Post DIG Labeling Spectroscopy
260 280 Concentration ng/ul Ratio(280/260)
SP6 Promoter 2.8951 OD 1.5945 OD 2316.08 1.82
T7 Promoter 3.1328 OD 1.6324 OD 2506.24 1.92
top2b RNA Probe Post DIG Labeling Spectroscopy
260 280 Concentration ng/ul Ratio
SP6 Promoter 0.5942 OD 0.3061 OD 439.36 1.79
T7 Promoter .8028 OD .4504 OD 642.24 1.78
Table 1: For both probes after probe synthesis we have an expected yield for both
the probes. The discrepancy in the concentrating between tdp2 and top2b is due to
difference in volumes of reaction. Furthermore the integrity of the RNA as depicted
by the ratio is within the acceptable value for RNA, 1.8 - 2.0.
WISH 36hpf top2bWISH 24hpf top2b
WISH 30hpf tdp2
Introduction
Materials and Methods
Zebrafish Embroys: Embryos retrieved from for the fish facility at Vanderbilt University at < 2hpf then plated into 100mm dishes in embryo
medium. Fish fixed in 4% Paraformaldehyde at specified time points to preserve for hybridization
Primer Design: The tdp2 primer sequence for probe, F-TGTCGCTTCGACCGCATATT, R-ATGACCAACGTCTTCTGTCCAG, with PCR
product length of 178 base pairs(bp). The top2b primer sequence for probe:F-GAGACCTGCCTGCAGAAAGTAATCT, R-
CTTCGCACCATTGTTCTTGTCA, with a PCR product length of 228bp. The PCR product provides the template for RNA probe. Probe
length is kept less than 500bp to ensure maximum permeability of tissue to perform hybridization.
Probe Synthesis: RNA extracted from 30 embryo then performed cDNA synthesis..the Promega pGEM®-T Easy Vector using manufacturer’s
protocol(refer to vector map below). After ligation procedure we transformed TOPO-10 electrocompetent cells, and using blue white
screening technique picked white colonies and inoculated overnight in LB-AMP broth. Then we perform a mini prep on the bacteria to purify
our plasmid with our probe insert. The ligation step and transformation was only done with tdp2. The top2b plasmid was provide graciously
by Lacy Thompson. From the purified plasmid two samples, 3 ug ea, and cut one sample at the T7 site of the plasmid and the other at the SP6
site. Prior to linearization we used the Roche digoxigenin(DIG)-labeling kit following manufacturer’s protocol. Once complete we dilute the
probe to 10μg/ml in hybridization buffer.
Whole-mount in situ hybridization: First we removed the chorion from around the embryos prior to starting the WISH protocol. Before
hybridization occurs, to allow the probe to enter the tissues of the embryos we permeabilized the embryos with 4μg/ml Proteinase K.
Permeabilization is followed by subsequent 1x PBS 0.1% Tween (PTween) washes and prehybridization washes in hybridization buffer. After
the prehybridization washes, the embryos were moved to a 1μg/ml probe solution to hybridize overnight at 67ºC. Prior to hybridization the
embryos were subjected to saline-sodium-citrate(SSC)/PTween solutions of increasing concentrations of Ptween. These washes are to reduce
reaction background. Once washed, we moved the embryos into Roche anti-DIG antibody in a 10%Sheep Serum in 0.2% in Triton-X 1x
PBS(PBT) solution diluted 1:2000 and allowed to incubate overnight at 4ºC. After antibody incubation, the embryos were washed in PBT.
Subsequent to the PBT washes, the embryos are washed in alkaline phosphate(AB) buffer, then subjected to the detection reaction solution of
NBT/BCIP. The reaction proceeds in the absence of light until the desired amount of staining is present. The reaction is then stopped by
washing with AP buffer and fixing the embryos in 4% Formaldehyde solution. The embryos were imaged using a Lecia M80 microscope, and
DinoEye eyepiece camera,
TDP2, also aliased under TTRAP and EAPII, is a multifaceted protein who's functions extends far beyond DNA repair. TDP2 acts in
picornavirus replication acting as VPg unlinkase. Additionally, TDP2 acts as a factor tumor necrosis factor(TNF) receptor that up regulates
NF𝜅-B(S.Pype, et al,.2000) Furthermore, new research suggest that TDP2 plays a role in neural development. In a population study,
individuals homozygous for mutant Tdp2 show signs of intellectual impairment, have seizures, and degenerative ataxia(Gómez-Herreros, F. et
al, 2014)
Our own lab’s research shows that in a zebrafish model during the time of neural development, 12 hours post fertilization(hpf), expression
of TOPOIIβ is up regulated, and TDP2 is down regulated. then is normalized after 36hpf.(Thompson 2014)(Sean-Arno 2014) These two
proteins have been physically shown to interact in DNA repair, and both have roles within neural development. This provides reason to
hypothesize that TOPOIIβ and TDP2 may function together in neural development. To gain insight into this question, we design two DIG-
labeled probes specific for both tdp2 and top2b. We then examine gene expression patterns by performing a whole-mount in situ
hybridization(WISH) with each of the probes in a Danio rerio model.
DNA topoisomerase II (TOPOII) is a nuclear enzyme that catalyzes double stranded
breaks to relieve torsional strain during DNA replication. Such double stranded breaks
are normally rejoined by TOPOII, but in some cases TOPOII can become “abortive
and remained unsealed.” In theses cases, a class of proteins called tyrosyl DNA
phosphodiesterases(TDP), primarily the isoform TDP2 repairs the double stranded
breaks produced by “abortive TOPOII”(Champoux, et al 2001)
There are two isoforms of TOPOII, TOPOIIα and TOPOIIβ. TOPOIIα and TOPOIIβ
exhibit similar enzymatic function in vitro, but their expression pattern differ
suggesting divergent functions within the cell (Tiwari, et al., 2012). TOPOIIα is
express in high levels in mitotic cells and plays and an active role in facilitating DNA
replication. However, its counterpart TOPOIIβ functionality within the cell is still
largely unknown. Expression patterns show that top2b is found more commonly in the
postmitotic stage of cell cycle.(Watanabe, et al.,1994) Research suggest TOPOIIβ
plays a significant role in neural development. Studies in murine models have shown
that genetic disruption top2b causes aberrant axonal elongation and branching and
perinatal death explained by lack of innervation of the skeletal musculature(Yang, et
al, 2000).
Figure 1: TDP2 mediated abortive TOPOII
DNA repair
1 1478
978 1156
178bp DIG
1 5653
291 519
228bp DIG
tdpII
top2b
Figure 2: The above figure is a visualization of the WISH
probe hybridization step that shows the exact location on
each respective gene’s mRNA sequence to which our
probes binds to. Photo from Promega
From the limited time points that we have conclusive data on, preliminarily, we show that tdp2 and top2b appear to be specifically expressed in the
brain, supporting our hypothesis that our genes of interest might have related roles in neural development. In the future we would like to to gather the
expression patterns at more time points in order see a time progressive holistic view of the expression patterns of both of our genes of interest.
Furthermore, we would like to use a know TDP2 inhibitor to chemically knockdown TDP2, and then examine the expression pattern of top2b, which
will give us insight into a possible dependency that top2b and tdp2 have on one another in neural development.
Acknowlegements
Special thanks to Qiang Guan and Dr. Patton for suppling our lab with the embryo, Dr. Millimaki for their guidance and patience,
Lacy Thompson for providing guidance with laboratory procedures specific to my project and for providing the plasmid for the top2b
probe. Kadilee Adams for her incredible support and assistance with management of the zebrafish, graduate students Sarah Simmons
and Jackson Hern for their additional support in the up keep of the zebrafish, and last but not least Lipscomb Security for being
patient and understanding with the schedule of a developmental biology project.