tX-linked adrenoleukodystrophy (X-ALD) affects the nervous system white matter and adrenal cor-tex secondary to mutations in the ABCD1 gene that encodes a peroxisomal membrane protein: theadrenoleukodystrophy protein. The disease is characterized by high concentrations of very long-chainfatty acids in plasma, adrenal, testicular and nervous tissues

1. Neuroscience Research 97 (2015) 7–12
Contents lists available at ScienceDirect
Neuroscience Research
journal homepage: www.elsevier.com/locate/neures
Splicing defects in ABCD1 gene leading to both exon skipping and
partial intron retention in X-linked adrenoleukodystrophy Tunisian
patient
Fakhri Kallabia,∗
, Ikhlass Hadj Salema
, Amel Ben Chehidab
, Ghada Ben Salaha
,
Hadhami Ben Turkiab
, Neji Tebibb
, Leila Keskesa
, Hassen Kamouna,c
a
Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax, Tunisia
b
Service de Pédiatrie, Hôpital La Rabta de Tunis, Tunisia
c
Service de Génétique Médicale, Hôpital Hédi Chaker Sfax, Tunisia
a r t i c l e i n f o
Article history:
Received 10 December 2014
Received in revised form 12 March 2015
Accepted 16 March 2015
Available online 31 March 2015
Keywords:
ABCD1 gene
Adrenal insufficiency
X-ALD
mRNA splicing
Exon skipping
Intron retention
a b s t r a c t
X-linked adrenoleukodystrophy (X-ALD) affects the nervous system white matter and adrenal cor-
tex secondary to mutations in the ABCD1 gene that encodes a peroxisomal membrane protein: the
adrenoleukodystrophy protein. The disease is characterized by high concentrations of very long-chain
fatty acids in plasma, adrenal, testicular and nervous tissues. Various types of mutations have been identi-
fied in the ABCD1 gene: point mutations, insertions, and deletions. To date, more than 40 point mutations
have been reported at the splice junctions of the ABCD1 gene; only few functional studies have been per-
formed to explore these types of mutations. In this study, we have identified de novo splice site mutation
c.1780 + 2T>G in ABCD1 gene in an X-ALD Tunisian patient. Sequencing analysis of cDNA showed a minor
transcript lacking exon 7 and a major transcript with a partial intron 7 retention due to activation of a
new intronic cryptic splice site. Both outcomes lead to frameshifts with premature stop codon generation
in exon 8 and intron 7 respectively. To the best of our knowledge, the current study demonstrates that a
single splicing mutation affects the ABCD1 transcripts and the ALDP protein function.
© 2015 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.
1. Introduction
X-linked adrenoleukodystrophy (X-ALD; OMIM # 300100) is
one of the most frequent monogenic inherited peroxisomal neu-
rodegenerative disorders. It affects the cerebral white matter,
peripheral nerves, adrenal cortex and testis (Moser et al., 2002).
It is a serious and progressive genetic disorder characterized by
abnormal accumulation of saturated very long chain fatty acids
(VLCFA) in body fluids and affected tissues, most notably in the
brain and adrenal cortex due to an impaired ␤-oxidation in per-
oxisomes (Moser et al., 2002; Bezman et al., 2001; Ferrer et al.,
2010; Valianpour et al., 2003). Affected individuals may present
with seven different clinical forms that are classified according to
phenotypic expression and age at initial symptoms. Most frequent
clinical phenotypes, accounting for 70–80% of the patients, include
∗ Corresponding author at: Laboratoire de Génétique Moléculaire Humaine,
Faculté de Médecine de Sfax, Avenue Magida Boulila, 3029 Sfax, Tunisia.
Tel.: +216 74 24 18 88x159; fax: +216 74 46 14 03.
E-mail address: fakhrikallabi@yahoo.fr (F. Kallabi).
severe progressive, inflammatory, demyelinating childhood cere-
bral form (ccALD) and slowly progressive, noninflammatory, adult
adrenomyeloneuropathy (AMN) affecting mainly peripheral nerves
and spinal cord (Van Geel et al., 1997; Jardim et al., 2010; Kemp
et al., 2001). Other less frequently occurring phenotypes include
adolescent cerebral (AdolCALD), adult cerebral (acALD), olivopon-
tocerebellar, addison-only and asymptomatic patients (Kemp et al.,
2001). The biochemical diagnosis of X-ALD patients and carriers is
based on the elevated levels of C24:0 and C26:0 in plasma. However,
in 0.1% of affected males, the plasma C26:0 level is at borderline of
the healthy subjects and 15% of female heterozygotes have nor-
mal levels of VLCFA (Valianpour et al., 2003; Moser et al., 1999;
Igarashi et al., 1976). The diagnosis of X-ALD is based on the clini-
cal manifestation, the cerebral magnetic resonance imaging (MRI),
the elevated levels of: C24:0 and C26:0 and the ratios: C24:0/C22:0
and C26:0/C22:0 but the molecular analysis is the only effective
and reliable method to unambiguous determination of the genetic
status of X-ALD patients (Moser et al., 2007).
X-ALD occurs due to alterations in the ATP-binding cassette,
subfamily D, member 1 (ABCD1) gene localized at Xq28 encoding
the adrenoleukodystrophy protein (ALDP) (Boehm et al., 1999). If
http://dx.doi.org/10.1016/j.neures.2015.03.005
0168-0102/© 2015 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

2. 8 F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12
the ALDP protein function is impaired, there is no peroxisomal ␤-
oxidation of VLCFAs, hence their accumulation in body fluids and
tissues leading either to neuroinflammation and demyelination in
the brain characterizing the ccALD form or to axonal degeneration
in spinal cord in AMN form (Migeon et al., 1981; Mosser et al., 1993).
Currently, all over the world, 1585 distinct mutations have so far
been reported in ABCD1 gene as the cause of a wide spectrum of clin-
ical severity (http://www.x-ald.nl/). Many ABCD1 intronic variants
have been identified during diagnostic screening: they account for
about 3% of all variants listed at X-ALD database. For the majority of
intronic variations, the consequences on mRNA splicing have been
only inferred by in-silico analysis, whereas experimental demon-
stration of their pathogenicity has been obtained by mRNA studies
for only few of them (Chiu et al., 2006; Shi et al., 2003; Guimarães
et al., 2001, 2002).
In this study, we performed a molecular genetic analysis of the
ABCD1 gene in X-ALD Tunisian patient. The availability of RNA splic-
ing analysis from blood samples was exploited to demonstrate the
effect of the c.1780 + 2T>G splicing mutation in ABCD1 gene on
mRNA splicing.
2. Materials and methods
The patient is a 16-year old boy belonging to a Tunisian fam-
ily. He was born from unrelated healthy parents. One additional
healthy sibling and the parents were also recruited. Informed
consent was obtained from patients and control individuals in
accordance with the ethics committee of La Rabta Hospital (Tunis,
Tunisia). The diagnosis of X-ALD was made on the basis of clini-
cal manifestation; cerebral magnetic resonance imaging (MRI) and
accumulation of very long chain fatty acid (VLCFA). Blood samples
were collected from four family members and healthy individuals.
Genomic DNA was extracted from the whole blood following a
standard phenol-chloroform method (Lewin and Stewart-Haynes,
1992).
2.1. Mutation analysis of ABCD1 gene
The 10 exons and flanking intron region of the ABCD1 gene were
tested for mutation in the X-ALD patient by sequence analysis. PCR
amplification of all 10 ABCD1 fragments was performed using the
primer sets as previously published (Boehm et al., 1999). All exons
were amplified in a thermal cycler (Applied Biosystem 2720) in a
final volume of 50 ␮l containing 100 ng of genomic DNA, 0.2 ␮M of
each primer, 1x PCR buffer (Promega), 1.2 mM MgCl2, 0.2 mM each
dNTP, and 1 U Taq DNA polymerase (Promega). The polymerase
chain reaction conditions were as follows: initial denaturation at
95 ◦C for 5 min followed by 35 cycles of denaturation at 95 ◦C for
30 s, annealing at 63–71 ◦C (depending on the melting temper-
atures of the primer pairs used) for 30 s and extension at 72 ◦C
for 45 s, and final extension at 72 ◦C for 10 min. Each PCR product
was then purified by enzyme reaction (Exonuclease I; 20 units/␮l;
Fermentas), and directly sequenced using a Big-Dye di-deoxy-
terminator cycle sequencing kit and an ABI-PRISM 3100 automated
sequencer (Applied Biosystems). The BLAST homology searches
were performed using the programs available at the NCBI (National
Center for Biotechnology Information) website and compared the
human ABCD1 gene sequence with the wild-type sequence.
2.2. Bioinformatics prediction of splice consensus score
To evaluate the strength of the altered splice-site of
c.1780 + 2T>G mutation, splice site scores were predicted by
the Human Splicing Finder software (HSF V2.4 at http://www.
umd.be/HSF) (Desmet et al., 2009).
2.3. RNA extraction and reverse transcriptase-polymerase chain
reaction (RT-PCR) analysis
The functional effect of the c. 1780 + 2T>G mutation was
assessed by RT-PCR analysis of nuclear lymphocytes RNAs
obtained from affected and control individuals. Total RNA was
isolated from 10 ml of blood samples using PureLinkTM Micro-
to-Midi Total RNA Purification System (Invitrogen, Karlsruhe,
Germany). Nucleic acids were quantified using the Nano Drop
ND-1000 UV–Vis spectrophotometer. RT-PCR, covering the cod-
ing sequence of exons 6–10, was performed for the patient carrier
of splicing mutation c.1780 + 2T>G, using the following primers:
5 ACGTACGGTGGTGTGCTCTA3 (forward primer 69 pb down-
stream of exon 6) and 5 CATCGAACTGTAGCAAGTGT3 (reverse
primer 12 pb upstream of exon 10), according to the manufac-
turer’s recommendations of SuperScript Tm One-Step RT-PCR with
platinum® Taq kit (Invitrogen). The expected RT-PCR products of
448 bp were separated and visualized under UV light by elec-
trophoresis on 2% agarose gel stained with ethidium bromide.
Direct sequencing of RT-PCR products was performed by standard
conditions in both directions.
2.4. Estimation of expression levels of transcripts
To estimate the transcript expression levels of ABCD1 gene, sep-
arate bands on the agarose gel were quantified using the Quantity
1D analysis software. Band intensity is expressed in arbitrary units
(intensity × area) calculated by the software.
3. Results
In this current study, we identified a Tunisian family with one
X-ALD affected male. The healthy parents were unrelated and orig-
inated from South Tunisia. Clinical and biological data indicated
that the initial presentation was adrenal insufficiency followed by
neurological manifestations.
3.1. Clinical analysis of X-ALD patient
The 16-year old male patient was asymptomatic up to the
age of 5 after which he presented clinical data suggesting melan-
odermia and generalized hypotonia. He presented difficulties
in understanding spoken language, and hearing deficit. Plasma
VLCFAs levels of the patient showed C26:0 to be 3.78 ␮mol/L
(normal level <1.31 ␮mol/L), C24:0 to be 46.44 ␮mol/L (nor-
mal level: 11–39 ␮mol/L) and C22:0 to be 36 ␮mol/L (normal
level = 22–43 ␮mol/L).
The C26:0/C22:0 ratio was 0.105 (normal ratio = 0.002–0.018)
and C24:0/C22:0 was 1.29 (normal ratio = 0.5–0.98). Hormonal
dosages showed high plasmatic ACTH levels (1890 ng/L at 11 years
old; normal level <48 ng/L), therefore glucocorticoid replacement
therapy was initiated for adrenal insufficiency. His neurological
abilities have worsened with progressive impairment of cognition
and behavior. A brain magnetic resonance imaging (MRI) exam
revealed a signal abnormality in the bilateral cerebral white matter,
predominantly in the parieto-occipital region: low signal intensity
in T1 (Fig. 1a) and high signal intensity in T2 (Fig. 1b). The patient
was categorized into ccALD phenotype.
3.2. De novo c.1780 + 2T>G mutation in the ABCD1 gene
The sequencing analysis of coding regions and intron–exon
boundaries of ABCD1 gene of the patient revealed de novo splic-
ing site mutation T>G at the second nucleotide of intron 7
(c.1780 + 2T>G) already described (Fig. 2). Using direct sequencing,
the mutation was absent in the mother and the brother.

3. F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12 9
Fig. 1. (A) T1-weighted MRI with contrast shows low signal intensity on the white matter lesion with contrast enhancement along the margins. (B) T2-weighted MRI shows
bilateral symmetrical, ill-defined high signal intensity on the white matter of both temporo-parietooccipital lobes, including the internal and external capsules, corpus
callosum, and brain stem.
3.3. “in silico” HSF prediction
According to the splice site consensus sequence in mammals,
a Thymine nucleotide is located at position +2 of the donor site
(Mount, 1982). Indeed, in the wild-type ABCD1 allele Thymine is
located at position +2 of intron 7; however, in our patient, Thymine
was changed by Guanine (Fig. 2). To predict the effect of this muta-
tion on splicing, we performed “in silico” analysis of the sequence
using the human splicing finder (HSF) software. Each splice site is
characterized by the consensus value and the consensus value vari-
ation: CV. By introducing the 3 sequence of exon 7 and the 5
sequence of intron 7, HSF determines the predicted splice donor
sites with consensus value (0–100). Based on the HSF predictions,
the altered sequence (GAG/ggagga) abolished the initial donor site
(GAG/gtagga) eliciting an abnormal splicing process by activation
of a new cryptic splice donor site (intron inclusion) or/and broking
wild type site (exon skipping) (Tables 1 and 2).
Analysis by “in silico” HSF software showed the presence of sev-
eral potential 5 consensus splicing sites within intron 7. In order
to determine the effect of the splicing site mutation, and the pos-
sible activation of intronic cryptic sites, RT-PCR and sequencing
analysis of cDNA were performed using ABCD1 mRNA obtained
from lymphocytes. Using primers within exons 6 and 10, RT-PCR
revealed an amplified fragment of 448 bp in the control, which
corresponds to the expected splicing product. In contrast, RT-PCR
electrophoretic profile of the patient showed two different bands:
a minor aberrant transcript lacking exon 7 and a major aber-
rant transcript included 103 bp of intron 7 (Fig. 3). The 3 of this
retained sequence of intron 7 contains a splice donor site motif
(CAG/GTGCCA) located 101 bp downstream of the native splice site
within intron 7, which becomes an activated cryptic splice site.
Our results confirm that the c.1780 + 2T>G mutation abolishes the
conserved GU splice donor site at 5 of intron 7, leading to the pro-
duction of two splicing mutant transcripts. The aberrant splicing
Fig. 2. Sequences in the region of the c.1780 + 2T>G splice mutation showing a control subject, patient’s mother and the X-ALD patient. Nucleotide variation is indicated by
an arrow.

4. 10 F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12
Table 1
Potential donor splice site calculation in 3 exon 7 and 5 intron 7 (http://www.umd.be/HSF/4DACTION/input SSF).
Table 2
HSF prediction of the c.1780 + 2T>G mutation on the splicing (http://www.umd.be/HSF/4DACTION/input SSF).
Fig. 3. (A) Sequence chromatograms of amplified cDNA products in the normal subject and X-ALD patient: exon 7 skipping and retention of 103 nucleotides of intron 7. (B)
Gel electrophoresis of the RT-PCR amplification product of the region spanning exons 6–10 of the ABCD1 gene showing a single band in the control (lane 5) as well as in the
unaffected parents (lanes 1 and 2) and brother (lane 4) at the expected size of 448 bp, two bands (551 bp) and (302 bp) in the X-ALD patient (lane 3). A negative control is
shown (lane C). MW: a 100 bp DNA ladder.

5. F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12 11
Fig. 4. Ideogram of detected splicing consequences of the c.1780 + 2T>G mutation. (A) Normal ABCD1 splicing pattern. (B) Aberrant ABCD1 splicing induced by c.1780 + 2T>G
mutation. (b.1) exon 7 skipping (b.2) intron 7 inclusion with activation of cryptic splice site.
generates a translation frameshift and creation of a premature ter-
mination codon (PTC): TGA at position +17 within exon 8 in the
transcript with exon 7 skipping and TAA at the position +93 within
intron 7 in the transcript with partial intron retention (Fig. 4).
3.4. Estimating of expression levels of ABCD1 transcripts by
quantity 1D analysis software
To estimate the transcript expression levels of ABCD1 gene, the
cDNA amplified by RT-PCR was analyzed on agarose gel and quanti-
fied using the Quantity 1D analysis software. The sum of the scores
of the two aberrant transcripts is almost equal to the normal tran-
script score. The expression level of the aberrant transcripts was
distributed as follows: ≈60% for the major aberrant transcript with
partial intron 7 retention and ≈40% for the minor aberrant tran-
script with exon 7 skipping (Fig. 5).
4. Discussion
In the present work, we report one X-linked adrenoleukodys-
trophy patient associated with de novo splicing mutation
c.1780 + 2T>G at the 5 splice-site in intron 7 of the ABCD1
gene. It affects the invariable intronic GU motif of the splice donor
site of exon 7. To the best of our knowledge, this donor splice varia-
tion was identified in one previous report as a milder mutation in a
German boy. The patient was affected by the ‘Addison-only’ form of
ALD at the age of 18 from a carrier mother asymptomatic (Wichers
et al., 1999). In our study, the X-ALD patient carries the same
mutation (c.1780 + 2T>G) but De novo, his mother was healthy. He
showed both Addison disease and neurological dysfunction and
was categorized into ccALD, the signs of the disease appeared from
the age of 5. Therefore, we note that the same mutation causes two
different phenotypes at two different ages. Although the identifi-
cation of the c.1780 + 2T>G mutation, no functional studies were
performed on this mutation and its effect on splicing mechanism.
Splice site mutations are involved in the production of aberrant
transcripts by full skipping of one or more exons, retention of
introns, formation of pseudo-exons, or activation of a cryptic splice
site (Berget, 1995). In our study, HSF predictions suggested that T>G
change disrupted the recognition of the splice donor site of exon
7 causing an abnormal splicing process. This finding motivated us
to analyze the effect in vivo of the splicing mutation c.1780 + 2T>G
on the pre-mRNA process and to identify all types of transcripts
produced. Indeed, RNA analysis was performed by RT-PCR of an
amplicon spanning exons 6–10 of ABCD1 gene. As shown by our
Fig. 5. Estimating diagram of expression levels of ABCD1 transcripts by Quantity
1D analysis. Band intensity is expressed in arbitrary units (intensity × area) calcu-
lated by the software. Normal transcript ABCD1: 9855.406; aberrant major transcript
ABCD1: 5624.406; aberrant minor transcript ABCD1: 3903.187.

6. 12 F. Kallabi et al. / Neuroscience Research 97 (2015) 7–12
data, two mutant transcripts were identified: one minor transcript
with exon 7 skipping and one major transcript with intron partial
retention resulting from the activation of cryptic splicing site
within intron 7. These results confirm the “in silico” predictions
analyzed by HSF. The RT-PCR electrophoresis gel showed an
intense band corresponding to the major transcript and a less
intense band corresponding to the minor transcript. This finding
can be explained by the difference in expression levels of the two
transcripts. In fact, the major transcript could be more expressed
than the minor transcript in the lymphocytes cells of patient.
In the X-ALD disease, many splice site mutations have been
described in ABCD1 gene. Indeed, Guimarães et al. reported a
splice site mutation at the +1 position of donor site of exon 7
(c.1780 + 1G>A) in a Portuguese family but no functional study
was performed (Guimarães et al., 2002). In addition, a putative
splicing mutation c.1081 + 5G>C was identified in an Argentinean
patient, the sequencing analysis of cDNA showed a loss of 588
nucleotides encoding exons 2–5 (Amorosi et al., 2012). Many stud-
ies have examined the effect of splicing mutations on pre-mRNA
maturation in other genetic diseases. Similar to our findings, Nel-
son et al. reported a functional study on the ATRX gene in a patient
affected by ␣-thalassemia-myelodysplastic syndrome and carrying
the IVS4 + 2T>C mutation. This substitution leads to two different
abnormal transcripts; the first one lacks exon 4 and the second one
presents a partial intron 4 retention due to the activation of a new
cryptic splice site. Both outcomes induced a frameshifts with pre-
mature stop codon generation in exon 5 (Nelson et al., 2005). This
evidence regarding the frequent detection of alterations at the +1
and +2 sites are matching with the finding that GT at nucleotide
positions +1 and +2 of splice donor sites is highly conserved (98%)
in human genes (Sahashi et al., 2007).
Precise pre-mRNA splicing is catalyzed by the spliceosome that
recognizes conserved sequences at the exon–intron boundaries
and branch point sites (Roca et al., 2005). The 5 splicing site
(5 ss) is composed of nine partially conserved nucleotides at the
exon–intron boundary, and base pairing to the 5 -terminus of U1
snRNA occurs in this complex (Roca et al., 2005; Wilusz et al., 2001).
The variation of donor site causes a nucleotide mismatch with
U1snRNA (Boldina et al., 2009). In our study, it seems reasonable to
deduce that the generated dysfunctional mRNA splicing isoforms
are the consequence of a disruption of conserved sequences at exon
7–intron 7 boundary recognized by the spliceosome.
In splicing analysis, proteins are often undetected because of
degradation of aberrant transcripts by the nonsense-mediated
decay NMD (Maquat, 2004). About 78% of PTCs were located in more
than 50 nucleotides upstream of the last exon–exon junction, and
were thus predicted to produce a marked proportion of NMD sub-
strates (Maquat, 2004). Based on this data and according to the PTC
position rule, we suggested that the resulting nonsense mRNA due
to exon 7 skipping and partial intron 7 retention will be probably
destroyed by the NMD process during the translation mechanism.
Often, retention of internal introns decreases the expression of the
corresponding mRNAs and targets them to degradation by the NMD
pathway (Jaillon et al., 2008; Farlow et al., 2010).
Acknowledgements
We are indebted to the family for their invaluable cooperation
and for providing the blood samples. This research was funded by
the Tunisian Ministry of Higher Education and Scientific Research.
References
Amorosi, C.A., Myskova, H., Monti, M.R., Argarana, C.E., Morita, M., Kemp,
S., de Kremer, R.D., Dvorakova, L., de Ramırez, A.M.O., 2012. X-Linked
adrenoleukodystrophy: molecular and functional analysis of the ABCD1 gene
in Argentinean patients. PLoS ONE 7, e52635.
Berget, S.M., 1995. Exon recognition in vertebrate splicing. J. Biol. Chem. 270,
2411–2414.
Bezman, L., Moser, A.B., Raymond, G.V., Rinaldo, P., Watkins, P.A., 2001.
Adrenoleukodystrophy: incidence, new mutation rate, and results of extended
family screening. Ann. Neurol. 49, 512–517.
Boehm, C.D., Cutting, G.R., Lachtermacher, M.B., Moser, H.W., Chong, S.S., 1999.
Accurate DNA-based diagnostic and carrier testing for X-linked adrenoleukodys-
trophy. Mol. Genet. Metab. 66, 128–136.
Boldina, G., Ivashchenko, A., Regnier, M., 2009. Using profiles based on nucleotide
hydrophobicity to define essential regions for splicing. Int. J. Biol. Sci. 5, 13–19.
Chiu, H.C., Liang, J.S., Wang, J.S., Lu, J.F., 2006. Mutational analyses of Tai-
wanese kindred with X-linked adrenoleukodystrophy. Pediatr. Neurol. 35,
250–256.
Desmet, F.O., Hamroun, D., Lalande, M., Collod-Béroud, G., Claustres, M., Béroud, C.,
2009. Human splicing finder: an online bioinformatics tool to predict splicing
signals. Nucleic Acids Res. 37, e67.
Farlow, A., Meduri, E., Dolezal, M., Hua, L., Schlötterer, C., 2010. Nonsense mediated
decay enables intron gain in Drosophila. PLoS Genet. 6, e1000819.
Ferrer, I., Aubourg, P., Pujol, A., 2010. General aspects and neuropathology of X-linked
adrenoleukodystrophy. Brain Pathol. 20, 817–830.
Guimarães, C.P., Lemos, M., Menezes, I., Coelho, T., Sá-Miranda, C., Azevedo, J.E., 2001.
Characterisation of two mutations in the ABCD1 gene leading to low levels of
normal ALDP. Hum. Genet. 109, 616–622.
Guimarães, C.P., Lemos, M., Sá-Miranda, C., Azevedo, J.E., 2002. Molecular character-
ization of 21 X-ALD Portuguese families: identification of eight novel mutations
in the ABCD1 gene. Mol. Genet. Metab. 76, 62–67.
Igarashi, M., Schaumburg, H.H., Powers, J., Kishmoto, Y., Kolodny, E., 1976. Fatty acid
abnormality in adrenoleukodystrophy. J. Neurochem. 26, 851–860.
Jaillon, O., Bouhouche, K., Gout, J., Aury, J., Noel, B., 2008. Translational control of
intron splicing in eukaryotes. Nature 45, 1359–1362.
Jardim, L.B., da Silva, A.C., Blank, D., Villanueva, M.M., Renck, L., Costa, M.L., Vargas,
C.R., Deon, M., Coelho, D.I., Vedolin, L., de Castro Jr., C.G., Gregianin, L., Bonfim, C.,
Giugliani, R., 2010. X-linked adrenoleukodystrophy: clinical course and minimal
incidence in South Brazil. Brain Dev. 32, 180–190.
Kemp, S., Pujol, A., Waterham, H.R., van Geel, B.M., Boehm, C.D., Raymond, G.V.,
Cutting, G.R., Wanders, R.J., Moser, H.W., 2001. ABCD1 mutations and the X-
linked adrenoleukodystrophy mutation database: role in diagnosis and clinical
correlations. Hum. Mutat. 18, 499–515.
Lewin, H.A., Stewart-Haynes, J.A., 1992. A simple method for DNA extraction from
leukocytes for use in PCR. Biotechniques 13, 522–524.
Maquat, L.E., 2004. Nonsense-mediated mRNA decay: splicing, translation and
mRNP dynamics. Nat. Rev. Mol. Cell Biol. 5, 89–99.
Migeon, B.R., Moser, H.W., Moser, A.B., Axelman, J., Sillence, D., 1981.
Adrenoleukodystrophy: evidence for X linkage, inactivation, and selection favor-
ing the mutant allele in heterozygous cells. Proc. Natl. Acad. Sci. 78, 5066–
5070.
Mount, S.M., 1982. A catalogue of splice junction sequences. Nucleic Acids Res. 10,
459–472.
Moser, A.B., Kreite, N., Bezman, L., Lu, S., Raymond, G.V., 1999. Plasma very long
chain fatty acids in 3000 peroxisome disease patients and 29,000 controls. Ann.
Neurol. 45, 100–110.
Moser, H.W., Mahmood, A., Raymon, R.V., 2007. X-linked adrenoleukodystrophy.
Nat. Clin. Pract. Neurol. 3, 140–151.
Moser, H.W., Smith, K.D., Watkins, P.A., Powers, J., Moser, A.B., Seriver, C.R., Beaudet,
A.L., Sly, W.S., Valle, D., 2002. X-Linked adrenoleukodystrophy, the metabolic
and molecular bases of inherited disease. J. Genet. 8, 3257–3301.
Mosser, J., Douar, A.M., Sarde, C.O., Kioschis, P., Feil, R., Moser, H., Poustka, A.M.,
Mandel, J.L., Aubourg, P., 1993. Putative X-linked adrenoleukodystrophy gene
shares unexpected homology with ABC transporters. Nature 361, 726–730.
Nelson, M.E., Thurmes, P.J., Hoyer, J.D., Steensma, D.P., 2005. A novel 5 ATRX muta-
tion with splicing consequences in acquired alpha thalassemia-myelodysplastic
syndrome. Haematologica 90, 1463–1470.
Roca, X., Sachidanandam, R., Krainer, A.R., 2005. Determinants of the inherent
strength of human 5 splice sites. RNA 11, 683–698.
Sahashi, K., Masuda, A., Matsuura, T., Shinmi, J., Zhang, Z., Takeshima, Y., Matsuo,
M., Sobue, G., Ohno, K., 2007. In vitro and in silico analysis reveals an efficient
algorithm to predict the splicing consequences of mutations at the 5 splice sites.
Nucleic Acids Res. 35, 5995–6003.
Shi, X.R., Chen, Y.C., Xie, W.H., Huang, M.F., Hou, X.J., Wang, N., 2003. Analysis on
mutation of adrenoleukodystrophy gene in exon 1 and exon 5. Zhonghua. Yi.
Xue. Yi. Chuan. Xue. Za. Zhi. 20, 43–45.
Valianpour, F., Selhorst, J.J., van Lint, L.E., van Gennip, A.H., Wanders, R.J., 2003.
Analysis of very long-chain fatty acids using electrospray ionization mass spec-
trometry. Mol. Genet. Metab. 79, 189–196.
Van Geel, B.M., Assies, J., Wanders, R.J.A., Barth, P.G., 1997. X-linked adrenoleukodys-
trophy: clinical presentation, diagnosis and therapy. J. Neurol. Neurosurg.
Psychiatry 63, 4–14.
Wichers, M., Köhler, W., Brennemann, W., Boese, V., Sokolowski, P., Bidlingmaier, F.,
Ludwig, M., 1999. X-linked adrenomyeloneuropathy associated with 14 novel
ALD-gene mutations: no correlation between type of mutation and age of onset.
Hum. Genet. 105, 116–119.
Wilusz, C.J., Wang, W., Peltz, S.W., 2001. Curbing the nonsense: the activation and
regulation of mRNA surveillance. Genes Dev. 15, 2781–2785.